ID: 936011378

View in Genome Browser
Species Human (GRCh38)
Location 2:108927389-108927411
Sequence GCCTGAATTCTTCTAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936011371_936011378 24 Left 936011371 2:108927342-108927364 CCAGAGAGCAGCCTGCCCACTAA 0: 1
1: 0
2: 1
3: 12
4: 158
Right 936011378 2:108927389-108927411 GCCTGAATTCTTCTAGAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 120
936011374_936011378 9 Left 936011374 2:108927357-108927379 CCCACTAATTCTGCAGATGGCTG 0: 1
1: 0
2: 0
3: 7
4: 143
Right 936011378 2:108927389-108927411 GCCTGAATTCTTCTAGAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 120
936011372_936011378 13 Left 936011372 2:108927353-108927375 CCTGCCCACTAATTCTGCAGATG 0: 1
1: 0
2: 2
3: 10
4: 149
Right 936011378 2:108927389-108927411 GCCTGAATTCTTCTAGAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 120
936011375_936011378 8 Left 936011375 2:108927358-108927380 CCACTAATTCTGCAGATGGCTGT 0: 1
1: 0
2: 1
3: 11
4: 135
Right 936011378 2:108927389-108927411 GCCTGAATTCTTCTAGAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 120
936011370_936011378 25 Left 936011370 2:108927341-108927363 CCCAGAGAGCAGCCTGCCCACTA 0: 1
1: 0
2: 2
3: 75
4: 235
Right 936011378 2:108927389-108927411 GCCTGAATTCTTCTAGAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936011378 Original CRISPR GCCTGAATTCTTCTAGAGGC AGG Intronic
900898538 1:5501409-5501431 GCTTGACTTCTGCCAGAGGCTGG - Intergenic
900972355 1:5998602-5998624 CCCTGGATTCTTCCAGAGCCCGG + Intronic
901285523 1:8075590-8075612 GCATGCATTCTTCTGAAGGCTGG + Intergenic
902843895 1:19094384-19094406 GCCTGCATTCTTTTACAGGGAGG - Intronic
903641349 1:24862465-24862487 GCCTGATTTCTTCTAGGTCCAGG - Intergenic
906603635 1:47149828-47149850 CCCTGAAATCTTCTAGGGGTGGG - Intergenic
906660931 1:47580999-47581021 GCCTGAAGTCTTCCAGAGCCTGG - Intergenic
907397892 1:54204751-54204773 GTGTGAATTCCTCTAGTGGCAGG + Intronic
914745940 1:150501068-150501090 ATCTGAATTCTTCATGAGGCAGG + Intronic
916552480 1:165861861-165861883 GCGTGTATTTTGCTAGAGGCAGG - Intronic
920570068 1:207009677-207009699 GCCTGGATGCTTCCAGAGGTGGG + Intronic
920736930 1:208541337-208541359 TCCTGTATTCTTCTAAATGCAGG + Intergenic
1063546470 10:6986654-6986676 GTCTGGATCCTTCTAGGGGCTGG - Intergenic
1064266803 10:13831895-13831917 GGATGAATTCTGATAGAGGCAGG - Intronic
1065062613 10:21920899-21920921 GCCTGTATTCTACTACAGGCGGG - Exonic
1066526485 10:36284571-36284593 ACCTGAATTGGTCTAGAAGCTGG + Intergenic
1068648772 10:59498813-59498835 GACTGAAATTTTCTAGAGGAAGG + Intergenic
1069177525 10:65312283-65312305 GCCTGAATTCTGCTAGATGTAGG + Intergenic
1070910032 10:80109860-80109882 GCTTGAATGCTTCCAGAGACAGG - Intergenic
1073692712 10:105828323-105828345 GCATGGATTCTTCTAAAAGCTGG - Intergenic
1075005938 10:118830181-118830203 GGCTGAACTCTTAGAGAGGCAGG - Intergenic
1078537304 11:12185271-12185293 GACTGCACTCTTCTAGATGCTGG + Intronic
1082776585 11:57249501-57249523 GCCTTAATTCTCCAAGAGACTGG - Intergenic
1084578122 11:70003955-70003977 GCCTGGATTCTTCCAGAAGTGGG - Intergenic
1085818441 11:79766892-79766914 GCTTGAATTCCTCTAGTGACAGG + Intergenic
1090200040 11:124847400-124847422 TCTTGAATCCTTCCAGAGGCAGG - Intergenic
1091286379 11:134410962-134410984 GCATGGATTCTTGTAGAAGCTGG - Intronic
1092009587 12:5098319-5098341 GCCTGAATTTTACCAGAGGCTGG - Intergenic
1092174373 12:6393093-6393115 GCCTGTATTTTTTTAGAGACAGG + Intergenic
1092682742 12:11004974-11004996 GTCTGAATTCTTTTTAAGGCAGG + Intronic
1092685421 12:11039191-11039213 GTCTGAATTTTTTTAAAGGCAGG + Intronic
1093814136 12:23522764-23522786 TCCTGATTTTTTGTAGAGGCAGG + Intergenic
1095160728 12:38912089-38912111 GGCTGCATTCAGCTAGAGGCTGG + Intergenic
1098010708 12:66048161-66048183 TCCTAAATTCTTCTAGGGGAAGG - Intergenic
1100040090 12:90305715-90305737 CCCTGAAATCTTATAGATGCAGG - Intergenic
1102641863 12:114373946-114373968 GCCTCAATCCTTCTGGAAGCTGG + Intronic
1104871881 12:132005193-132005215 CCCTGAATTCTTCCAAAGGCTGG - Intronic
1105441279 13:20416895-20416917 GCCTGATTTCATCTAGAGGAGGG + Intronic
1108549802 13:51532539-51532561 AGTTGACTTCTTCTAGAGGCAGG - Intergenic
1109439493 13:62350542-62350564 AGCTGAATTCTACTAGAGGTAGG - Intergenic
1109681512 13:65758002-65758024 CCCTGCATTCATCCAGAGGCTGG + Intergenic
1113798518 13:113074541-113074563 GCCTGATTTCTCCTCGAAGCTGG - Exonic
1117408772 14:55430565-55430587 GCCTAAATTTTTATAGAGACAGG + Intronic
1118884282 14:69853562-69853584 GTCTGATTTCCTCTGGAGGCAGG + Intergenic
1120669821 14:87350804-87350826 GCCTGTCTGCTTCTAGAGCCTGG - Intergenic
1124874588 15:33580006-33580028 GCAGGACTTCTTCTATAGGCAGG - Exonic
1125577118 15:40763724-40763746 GCCTGAAGTGTTCAAGAAGCGGG + Intergenic
1126662218 15:51044323-51044345 TCCAGAATTTTTCTAGAGGAAGG + Intergenic
1128236408 15:66070537-66070559 CCCTGTATTCTACAAGAGGCTGG + Intronic
1130307691 15:82725586-82725608 TCCAGAATTCGTCTAGAGACCGG - Intergenic
1134892136 16:17850689-17850711 GCCTGAATTCTAAGCGAGGCGGG - Intergenic
1137292386 16:47060807-47060829 ACCTCAATTCTTCCAGGGGCAGG + Intergenic
1138208298 16:55141608-55141630 GCTAGAATCCTTCTATAGGCTGG - Intergenic
1139182187 16:64761579-64761601 GGCTGATTTCTTCTGGAGGTGGG + Intergenic
1140847890 16:78907416-78907438 GCCTGAATTCTGCTAAAGAGTGG - Intronic
1143518536 17:7432221-7432243 GCTTGGGTTCTTGTAGAGGCTGG - Intergenic
1144952959 17:19003954-19003976 GCCTGAGTTCTTCTACAGCGAGG - Exonic
1148714936 17:49709100-49709122 GCCAGAAGTCTTTTAGAGGGAGG + Intergenic
1149715979 17:58790782-58790804 GCATGAAGTCATCTAAAGGCTGG - Intronic
1152338890 17:79713622-79713644 GGCTGGCTTCTTCTGGAGGCTGG - Intergenic
1156514144 18:37665678-37665700 GACAGAATTCTTCTAGAAGATGG - Intergenic
1157790559 18:50527597-50527619 GCCTGAATTCTGGCAGAGGCCGG + Intergenic
1160624864 18:80196724-80196746 CCCTGGATTCTTCTGGAGGGGGG + Intronic
1162450358 19:10750629-10750651 GCCTTATTTATTTTAGAGGCAGG - Intronic
1163736096 19:18981811-18981833 GCCTGAATTTTTTTAAAGACAGG + Intergenic
926550623 2:14296418-14296440 GCCTGACTTCATCTAGAGAAAGG - Intergenic
927453916 2:23232873-23232895 GCCTGAACTCCTCCAAAGGCAGG - Intergenic
928942076 2:36736421-36736443 GCAGGAATTGTTCTAGAGTCTGG - Intronic
930389929 2:50747626-50747648 GACTTAATTCTTCTCAAGGCAGG + Intronic
930424305 2:51194013-51194035 GCCAGACTGCTTCTATAGGCAGG - Intergenic
933010438 2:77055303-77055325 GGCTGATTTCTACTAGAGGTTGG - Intronic
936011378 2:108927389-108927411 GCCTGAATTCTTCTAGAGGCAGG + Intronic
940024915 2:149195951-149195973 GCCTGAGTGCCTCCAGAGGCCGG + Intronic
943167997 2:184356939-184356961 GCCTGCATTCTTCTGGAGCAAGG + Intergenic
943972286 2:194426255-194426277 CCCTGAATTCTTCCAGAGGAAGG + Intergenic
944664466 2:201948347-201948369 GCCTGAGGTTTTCTAGAGGCAGG + Intergenic
945893980 2:215462005-215462027 GCCTGCATTCTTCTTGTGGCTGG + Intergenic
1170626858 20:18036815-18036837 GCCTGCTTGCTTCTAGAGGAAGG - Intronic
1170733322 20:18992492-18992514 GCCTGAATTCTTTAAGATGTAGG + Intergenic
1171494440 20:25545591-25545613 GCCTGAATTATTCTAAAGGGAGG - Intronic
1175703355 20:61156732-61156754 ACCTGGTTTCTTCTGGAGGCTGG - Intergenic
1177055220 21:16293303-16293325 CCCTGAATTCTTCTAGATCCTGG - Intergenic
1181134858 22:20757895-20757917 TGCTTAATTCTTCTAGAGGTTGG + Intronic
1182757969 22:32696179-32696201 CCCTGAATTCTACTAGGGGAAGG + Intronic
1184023504 22:41836749-41836771 GCCTGGATGCTTCTAGGAGCCGG + Intronic
949471595 3:4402218-4402240 CCCTGAATTCCTCAAAAGGCTGG + Intronic
953278129 3:41524609-41524631 GCCTGAAGTCAGCCAGAGGCAGG + Intronic
959376795 3:105598082-105598104 CTCTGAATTCTTAGAGAGGCAGG - Intergenic
960680091 3:120238775-120238797 GCCAGACTGCTTCTTGAGGCAGG - Intronic
960719630 3:120613090-120613112 TCCTGATTTGTTCAAGAGGCTGG + Intergenic
961122158 3:124381990-124382012 GCCTATATTCTTATAGAGGCAGG + Intronic
963483138 3:145903167-145903189 GGCTTAATTATTCCAGAGGCAGG + Intergenic
964859827 3:161189286-161189308 ACCTGAATACTTCTAGGGCCTGG - Intronic
965514908 3:169610837-169610859 GCCAGCCTTGTTCTAGAGGCTGG - Intronic
966126121 3:176578601-176578623 GGCTGAATTTTTAGAGAGGCAGG - Intergenic
966409300 3:179632081-179632103 TCCTGAATTCTTCCATAGGATGG + Intergenic
971379265 4:26081765-26081787 GTCTACATTCTTCTAGTGGCAGG - Intergenic
976060666 4:81124595-81124617 GCCTTAATTCTTCTCCAGGTGGG - Intronic
977494592 4:97759118-97759140 GCCAGAAGTTTTATAGAGGCAGG + Intronic
988217979 5:28301596-28301618 GCCTGAATTCTGCTAAATGTAGG + Intergenic
989174545 5:38510383-38510405 GCCTTAATTCTTCTGGAGTGGGG - Intronic
993281663 5:85933083-85933105 GATTGAATTCTTCAAAAGGCAGG - Intergenic
994269167 5:97756446-97756468 GCATGAATACTTCTTGGGGCTGG + Intergenic
994506261 5:100646394-100646416 GCCTTCATTCTTCTAGTGGCTGG - Intergenic
1001143365 5:169163631-169163653 CCCTGATTTCTCCTTGAGGCTGG + Intronic
1002152679 5:177248259-177248281 CCCTGCATTTTTTTAGAGGCAGG - Exonic
1002425126 5:179170450-179170472 GCTAAAATTCTTCTAGAGACGGG + Intronic
1003581191 6:7342332-7342354 GCCTCCATTCTTCCAGCGGCAGG + Intronic
1006826089 6:36937435-36937457 GCCTAGTTCCTTCTAGAGGCTGG + Intergenic
1010339653 6:74733565-74733587 GCCTGAGTCCTTCTCCAGGCAGG - Intergenic
1011054955 6:83194063-83194085 GCCTGAATTCTGGGAAAGGCTGG - Intronic
1013512218 6:110855558-110855580 ACCTGCATCCTTCTAGATGCAGG - Intronic
1015625736 6:135180362-135180384 TCCTGAGTTCTGCTAGGGGCGGG + Intergenic
1017148401 6:151255624-151255646 GGCTAATTTCTTGTAGAGGCAGG - Intronic
1020382779 7:7565332-7565354 GCCTACATTCTTCTAATGGCAGG + Intergenic
1021439448 7:20661411-20661433 GCCAGCATTGTTCTAGAGGTGGG - Intronic
1022179522 7:27905133-27905155 GGCTAAATTTTTGTAGAGGCAGG + Intronic
1023374666 7:39544038-39544060 ACATGAATACTTCTGGAGGCAGG - Intergenic
1023699793 7:42881879-42881901 GTCTGAATTCTGCTAGATGTAGG + Intergenic
1026389539 7:69886678-69886700 GGTTGCATTGTTCTAGAGGCAGG - Intronic
1027468267 7:78541416-78541438 GCCAGTGTTGTTCTAGAGGCTGG - Intronic
1039691532 8:39870030-39870052 GCCTGAATTCTACTCTGGGCAGG + Intergenic
1045909018 8:107383567-107383589 GTCTGAATTACTTTAGAGGCAGG + Intronic
1047437626 8:124847840-124847862 TTGTGAAATCTTCTAGAGGCAGG + Intergenic
1056450645 9:86713502-86713524 GCCTGAATTATTCTAGAGAGTGG + Intergenic
1058858202 9:109087573-109087595 GTCTGAATCCTTGTAGAGTCAGG + Intronic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1060535063 9:124379407-124379429 GCCTGAATTCTTCTCGGGCAGGG - Intronic
1186861379 X:13675673-13675695 GCCAGAACTATTCTAGGGGCTGG - Intronic
1187276236 X:17818612-17818634 GGCTGAAATATTTTAGAGGCAGG + Intronic
1187912217 X:24121404-24121426 GCCTGATTTTTTGTAGAGACGGG - Intergenic
1190746616 X:53326998-53327020 GCCTTAATTTTTGTAGAGACAGG - Intergenic
1191955211 X:66636620-66636642 GCTTGAACACTTCTAGAGGGAGG - Intronic
1192988302 X:76424224-76424246 GTCTGAGATCTTCCAGAGGCTGG - Intergenic
1198156269 X:133963899-133963921 GCCTGAATGCCTCAAGAGACAGG - Intronic
1199835274 X:151583850-151583872 GCCTGAATTCTTCTAGGACTGGG - Intronic