ID: 936013879

View in Genome Browser
Species Human (GRCh38)
Location 2:108943302-108943324
Sequence GCCTCCCCTCTGTTTCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936013879_936013885 26 Left 936013879 2:108943302-108943324 CCTGGGAGAAACAGAGGGGAGGC 0: 1
1: 0
2: 8
3: 45
4: 341
Right 936013885 2:108943351-108943373 AGAGTAAAACCTTTCATTTCTGG 0: 1
1: 1
2: 8
3: 34
4: 349
936013879_936013881 -1 Left 936013879 2:108943302-108943324 CCTGGGAGAAACAGAGGGGAGGC 0: 1
1: 0
2: 8
3: 45
4: 341
Right 936013881 2:108943324-108943346 CTTTCTATCCCTCAGAGCTTGGG 0: 1
1: 1
2: 0
3: 15
4: 219
936013879_936013882 0 Left 936013879 2:108943302-108943324 CCTGGGAGAAACAGAGGGGAGGC 0: 1
1: 0
2: 8
3: 45
4: 341
Right 936013882 2:108943325-108943347 TTTCTATCCCTCAGAGCTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 159
936013879_936013880 -2 Left 936013879 2:108943302-108943324 CCTGGGAGAAACAGAGGGGAGGC 0: 1
1: 0
2: 8
3: 45
4: 341
Right 936013880 2:108943323-108943345 GCTTTCTATCCCTCAGAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936013879 Original CRISPR GCCTCCCCTCTGTTTCTCCC AGG (reversed) Intronic
900144020 1:1150300-1150322 GCCTGCCCTGTGTTCCTTCCTGG + Intergenic
900609501 1:3538516-3538538 GGCTCCCCCCTGTTTCTGCCTGG - Intronic
900925022 1:5699585-5699607 GCCTCCTCTCCCTCTCTCCCTGG + Intergenic
901273305 1:7970601-7970623 CCCTCCCATTTCTTTCTCCCTGG + Intronic
901769679 1:11523990-11524012 GCCTCGCCTCTTCTTCTCCAGGG - Exonic
901772809 1:11539153-11539175 CCCTCCCCTCTGCTCCTACCGGG - Intergenic
901780410 1:11590544-11590566 CCCTCCCCTCTCCTTCTCCTGGG + Intergenic
902188879 1:14746589-14746611 GCCTCCCCTCTGCTTGTCAATGG - Intronic
902691748 1:18114158-18114180 GCCTGCCCTCTGTCTTTCCCTGG + Intronic
903167410 1:21530612-21530634 TTCTCCTCACTGTTTCTCCCTGG - Intronic
903468595 1:23569022-23569044 GCCTCCCCACAGCTCCTCCCTGG - Intergenic
903599235 1:24522681-24522703 GCCTTGCCTCTGCTTCTCCAAGG + Intronic
904045823 1:27607551-27607573 GCTCCCCCTCTGTCTCCCCCAGG - Intergenic
904048473 1:27623631-27623653 TTCTTCCCTCAGTTTCTCCCAGG + Intronic
904265033 1:29313244-29313266 GCCTGCCCTCTGTCTCCCCCTGG + Intronic
904450719 1:30609627-30609649 AGCTCCCCTCTCTTCCTCCCTGG - Intergenic
904484509 1:30815952-30815974 CTCTTCACTCTGTTTCTCCCTGG - Intergenic
904586005 1:31581032-31581054 GCCTCTCCTATCCTTCTCCCTGG - Intronic
906553308 1:46685099-46685121 ATCTTTCCTCTGTTTCTCCCTGG + Intronic
907419437 1:54336924-54336946 ACCTCCCCTCTGTCACACCCTGG - Intronic
909094588 1:71271288-71271310 GCCTCCCATCTGCTTTTCTCAGG + Intergenic
912731963 1:112115023-112115045 GCCTTCCCTCTCTTTTGCCCTGG - Intergenic
912800429 1:112716447-112716469 GCCTGGCCTCTGTCTCCCCCTGG - Intergenic
913440265 1:118889522-118889544 TCCTCCCCTCTGTACCTGCCAGG + Intronic
915312589 1:155011828-155011850 GCCTCCCCCTTCTTTCTGCCAGG - Intronic
915606116 1:156952240-156952262 GTCTCTCCTCTGTTCCTCCTAGG - Intronic
917685464 1:177411484-177411506 GCTTCTCCTCTGTTACTCACTGG + Intergenic
919743548 1:200994734-200994756 GCGTCCCCACTCTGTCTCCCTGG - Intronic
919838764 1:201594331-201594353 TCCTCCCCTCCCTTTCTCCTGGG - Intergenic
919927908 1:202202013-202202035 ACCTCACCTCTGGTCCTCCCTGG - Intronic
919991612 1:202711236-202711258 GCCACCCTTCTCTTTCTCCCAGG - Intergenic
920149491 1:203893055-203893077 GACTCCCCTGTGTTCCACCCAGG - Intergenic
920186682 1:204163692-204163714 GCCTCAGCTCTGTTTTTCCTTGG + Intronic
920209212 1:204315804-204315826 GCCTCCCCTGGGCATCTCCCCGG - Intronic
920368603 1:205462533-205462555 GCCATTCCTCTGTCTCTCCCTGG + Intergenic
920380617 1:205532587-205532609 GGCTCCCCTCTGTATCCCCCAGG + Intronic
920415716 1:205798092-205798114 CCCTACCCTAAGTTTCTCCCTGG + Intronic
920554406 1:206894143-206894165 GTCTCCCCACTGTTTCCACCTGG + Intergenic
921590238 1:216994605-216994627 GACTCCTCTCTGTATCGCCCAGG + Intronic
922024828 1:221740623-221740645 TCCTCCCCTCTTCATCTCCCTGG + Intronic
922610606 1:226924382-226924404 TCCTATCCTCTGTTCCTCCCTGG + Intronic
922958999 1:229628985-229629007 GCCTCCCCTTTGTTTCACCCTGG - Intronic
1062902363 10:1156066-1156088 GCCTCCCCTCTGATCCTGTCAGG + Intergenic
1063495408 10:6503040-6503062 TTCTCCCCTCTCATTCTCCCCGG - Intronic
1064014403 10:11761435-11761457 GCCTCCCCTGTGTGTGTCTCCGG + Intronic
1065197965 10:23285138-23285160 TCCTCCTTCCTGTTTCTCCCAGG - Intronic
1065878370 10:30017476-30017498 TGCTCCCCTCTGTGTCTCCATGG - Exonic
1066233023 10:33456069-33456091 GGATCCCCTCTTTTCCTCCCTGG - Intergenic
1067148552 10:43711102-43711124 GCTTCTCCCCTGTTTCCCCCTGG - Intergenic
1067348659 10:45456303-45456325 GCCTCTCCTTTCTGTCTCCCAGG - Exonic
1068071997 10:52207188-52207210 GCCTTCCCACTGTTTTTCCAGGG - Intronic
1069620664 10:69835449-69835471 GCCTCTCCCCTGTTACTCCCTGG + Intronic
1069640266 10:69950443-69950465 GCCAACCCTCTGTTACCCCCGGG + Intronic
1070464262 10:76703776-76703798 GGCTCCCCTCTGACCCTCCCAGG - Intergenic
1070940390 10:80340143-80340165 CTCTCCCCTCTGCTGCTCCCTGG - Intronic
1072009776 10:91292625-91292647 GCTTCCCCTCTTCTTCACCCTGG + Intergenic
1072733557 10:97864362-97864384 GCCTCCACTCAGGTTTTCCCAGG + Intronic
1073003054 10:100299546-100299568 CCCTCCCCTCTCTTTCTCAATGG - Intronic
1073292145 10:102418723-102418745 GCCTCTCCTCTGTCTCTCCTCGG - Exonic
1073339286 10:102732826-102732848 CCCTCCCCTCAGCTTCTCCCTGG + Intronic
1073486297 10:103820883-103820905 GGCTTCCCTGTGTTTCTCCCCGG - Intronic
1074813187 10:117125671-117125693 CTCTCCCCTCCGTTTCTCCCTGG + Intronic
1074930618 10:118121904-118121926 GAGTCCTCTCTGTTGCTCCCTGG - Intergenic
1075054513 10:119207548-119207570 GCCTCCCCTCAGTCCCTCCCGGG - Intergenic
1075159251 10:120008962-120008984 GTCCTCCCTCTGTTTCTTCCAGG - Intergenic
1076004253 10:126935425-126935447 GCCTCCAATCTGCATCTCCCAGG - Intronic
1076353130 10:129832401-129832423 GCCTGCCCTCACTTTGTCCCTGG + Intergenic
1077394709 11:2315264-2315286 TCCTCCCCTCTGTTTCTTGGAGG - Intronic
1077465303 11:2731089-2731111 GGCTGCCCTCTCTTTCCCCCAGG - Intronic
1078143275 11:8706888-8706910 TCCAGCCCTCTGTTCCTCCCAGG - Intronic
1081391021 11:42528933-42528955 GCCTCTCCTCTGTGTGTCTCAGG - Intergenic
1082124598 11:48416937-48416959 ATTTCCCCTCTTTTTCTCCCTGG - Intergenic
1082808469 11:57464346-57464368 TCCTTCCCTCTGTCTCTCCTGGG + Intronic
1083966416 11:66046587-66046609 TCCTCCCCTCTCTTACTCCTGGG - Intronic
1084013462 11:66365375-66365397 GGCTCACCTCTGCCTCTCCCAGG + Intronic
1084468721 11:69342782-69342804 GCCTGCCCCTTGTTTCTCCAGGG - Intronic
1084980243 11:72825030-72825052 GCCTCCTCTCTCTCCCTCCCCGG - Intronic
1086221671 11:84452639-84452661 GCCACTCCTCTTTTTCTCACAGG - Intronic
1087109537 11:94448519-94448541 CCCTCCCCACTGCTTCCCCCAGG - Intronic
1089048034 11:115520703-115520725 CCCTTCCTTCTGTTTTTCCCAGG + Intergenic
1089070496 11:115696033-115696055 GGCTCACCTCTGCTCCTCCCCGG + Intergenic
1091786292 12:3245125-3245147 GCATTCCCTCTGCTTCTCTCTGG + Intronic
1092916539 12:13194575-13194597 GCCTCCCCTCTGCTATTCCTTGG + Intergenic
1094500460 12:31016539-31016561 TCCTTCCCTCTCTTCCTCCCTGG - Intergenic
1095098440 12:38159969-38159991 GCATCCCCGCTTTTTTTCCCCGG - Intergenic
1096532740 12:52252215-52252237 GTGTCCCCTCAGTTTCCCCCAGG - Intronic
1096706542 12:53425552-53425574 GCCTGAGCTGTGTTTCTCCCAGG + Exonic
1098467416 12:70803635-70803657 GACTTCCTTCTGTTTCTCCATGG - Intronic
1099021667 12:77413407-77413429 ACCTGCCTTCTGTTTCTCCCTGG + Intergenic
1100237353 12:92674128-92674150 TCCTCCCGTCTTTTTATCCCTGG + Intergenic
1100504549 12:95206665-95206687 GGGTCCCCTCTCTGTCTCCCAGG - Intronic
1101035441 12:100701415-100701437 GCCTTCCCTCTCTCTTTCCCTGG + Intergenic
1101994236 12:109513259-109513281 CCCTCCGCTCTGTTTCTCTGTGG + Intronic
1102245906 12:111355625-111355647 GCCTCCCCTCTGTCCCTCCCTGG - Intergenic
1102298720 12:111756311-111756333 CCCTCCACTCTGTGTCTGCCAGG + Exonic
1102521105 12:113477800-113477822 GCTTTCCTTCTGTCTCTCCCAGG - Intergenic
1102943261 12:116962466-116962488 GCCTCCCCACTGTGTCCCCTGGG + Intronic
1103242787 12:119428902-119428924 TCCTGCCCTCTGCTCCTCCCAGG - Intronic
1103646438 12:122397071-122397093 GCCTGGCCTCTTTTTCTTCCTGG + Intronic
1103886689 12:124207742-124207764 TCCTTCCCTCTGTTCCTTCCAGG - Intronic
1103889989 12:124231576-124231598 GACTCCCCGCTGCTTCTCTCTGG - Intronic
1105765556 13:23555143-23555165 GCCTCTCCTCTGTGCCTTCCTGG - Intergenic
1105898479 13:24738357-24738379 GCCTTCTCTCCATTTCTCCCAGG + Intergenic
1107402516 13:40083321-40083343 GTCTCTCTTCTCTTTCTCCCTGG + Intergenic
1107434832 13:40372981-40373003 GCATCCCCTGTGTCTCCCCCGGG - Intergenic
1108152728 13:47553215-47553237 CCTTCCCTTCAGTTTCTCCCTGG + Intergenic
1111203995 13:84979884-84979906 TCCTCCCCACTATTTCTTCCTGG + Intergenic
1111793976 13:92894415-92894437 CCCTGCCCTCTGTTTCTCACAGG + Intergenic
1113861786 13:113491344-113491366 CCCTCCCCTCTCTCCCTCCCCGG + Intronic
1113861821 13:113491427-113491449 GGCTCCCCTCTCTCCCTCCCCGG + Intronic
1113861868 13:113491543-113491565 ACCTCCCCTCTCTCTCTCCTCGG + Intronic
1114266341 14:21074670-21074692 GCCTCCCCTGAGTCTCCCCCAGG + Exonic
1115191388 14:30750871-30750893 GCCTCCCATCTGTGCATCCCAGG - Intergenic
1118780293 14:69003466-69003488 CTCTCCCATCTGTTTCTCCAGGG + Intergenic
1119327856 14:73772196-73772218 GACTCCCATCTGTTACTACCAGG - Intronic
1119668684 14:76502237-76502259 CCCTCCCCTCTGCTTCTCACTGG - Intergenic
1119706954 14:76788971-76788993 GCCCCCCTTCTGCCTCTCCCAGG + Exonic
1121447449 14:93987970-93987992 ACCTCCCTACTGTTTCTCCCTGG - Intergenic
1122504882 14:102226215-102226237 GGCTCCCCTGTGCTTCTGCCCGG + Intronic
1122693782 14:103543254-103543276 GCATCCCCTCTGTGTCCCCAGGG - Intergenic
1124502023 15:30236752-30236774 ACCTCCCCTCTTTCTCTCCGAGG - Intergenic
1124741541 15:32301900-32301922 ACCTCCCCTCTTTCTCTCCGAGG + Intergenic
1128379600 15:67102825-67102847 GCAGCCCCTCTGCTCCTCCCAGG + Intronic
1128552423 15:68607021-68607043 GTCTCCCCTGGTTTTCTCCCTGG + Intronic
1128870592 15:71152627-71152649 TCCTCTCCTCTGCTTCACCCTGG - Intronic
1129350285 15:74952073-74952095 GCCACCCCTCCCTTTATCCCAGG + Intergenic
1129739687 15:77984273-77984295 GCCTCCCCTCTGGCTGTGCCTGG - Intronic
1129975395 15:79817140-79817162 GCCTCTCTACTATTTCTCCCAGG + Intergenic
1130041205 15:80406177-80406199 ACCTCCCCTTTGTCTCTCCTTGG - Intronic
1130261323 15:82355876-82355898 GCCTCTCCGCTGTTTCTCGCGGG + Intergenic
1130279912 15:82513142-82513164 GCCTCTCCGCTGTTTCTCGCGGG - Intergenic
1130471287 15:84229328-84229350 GCCTCTCCGCTGTTTCTCGCGGG - Intergenic
1130478781 15:84343899-84343921 GCCTCTCCGCTGTTTCTCGCGGG - Intergenic
1130492989 15:84444232-84444254 GCCTCTCCGCTGTTTCTCGCGGG + Intergenic
1130593582 15:85233955-85233977 GCCTCTCCGCTGTTTCTCGCGGG - Intergenic
1131031903 15:89193504-89193526 GCCTCCCTCGTGTTCCTCCCAGG + Intronic
1131122042 15:89828783-89828805 GCCTCATCTCTGACTCTCCCAGG + Intergenic
1131593470 15:93773356-93773378 GCCACCCCTGTGCTCCTCCCAGG + Intergenic
1134246952 16:12547281-12547303 GCTTCCTTGCTGTTTCTCCCAGG - Intronic
1136399662 16:30010589-30010611 GCCCCGCCTCTGTTTCTCGGAGG + Intronic
1136852222 16:33621217-33621239 TCCTCCCCTCTGAGCCTCCCAGG + Intergenic
1137572513 16:49576021-49576043 CCTGCCCCTCTGTCTCTCCCAGG - Intronic
1137960933 16:52881540-52881562 GCCTCCTCTCTGATTCTAACAGG + Intergenic
1138359997 16:56420112-56420134 CCTTCCTCTCTTTTTCTCCCAGG - Intronic
1139949766 16:70663213-70663235 GCCTTCTCTCTGCCTCTCCCAGG - Exonic
1140337191 16:74118700-74118722 TCCTCTCCTCTCTTTCTTCCTGG - Intergenic
1140454544 16:75097339-75097361 GCCGCCCCCCAGATTCTCCCTGG - Intronic
1141647978 16:85377696-85377718 GGCTCCCCTCTGTTGTTCCCGGG + Intergenic
1142133407 16:88441131-88441153 GCCTCCCGTCTGTTCCTCCTGGG - Intergenic
1142155185 16:88529788-88529810 GCCTCCTCTCTGACCCTCCCTGG - Intronic
1142559800 17:803189-803211 GCTCCCCGTCTGTTTCACCCAGG - Intronic
1144116578 17:12099056-12099078 CCCTCCCTTCTGTGTCTCCAAGG + Intronic
1144649457 17:16998110-16998132 GCCTCCCCTCTGACTCTCAGAGG + Intergenic
1144708364 17:17384592-17384614 GCCTCCCCACTGGTGCTCCCAGG - Intergenic
1146539270 17:33680450-33680472 GGCTGCCCTCTGCTCCTCCCTGG - Intronic
1146608964 17:34287977-34287999 CCCTCTCCTCTCTTCCTCCCTGG + Exonic
1146755384 17:35427322-35427344 GCTTCAACTCTGTTTCTCCATGG - Intronic
1149581635 17:57754686-57754708 GCCTCCCCTCTTCTCCTCCCAGG - Intergenic
1149865155 17:60147515-60147537 GCCTCCCTTCTGTTCCTGACAGG + Intergenic
1151062475 17:71112101-71112123 GCCTTTCCTCTTTTTCTCCGAGG + Intergenic
1151296428 17:73189776-73189798 GCCTTTCCTCTGTATTTCCCTGG - Intergenic
1151391513 17:73790600-73790622 GCCTTCCCTCTGATATTCCCTGG + Intergenic
1152518001 17:80837337-80837359 GCCTCCCCCCTGCTGCTCCCTGG - Intronic
1152543615 17:80989679-80989701 GCCAACCCTTTGTTTCACCCTGG - Intergenic
1152581399 17:81166887-81166909 CCTTCCCCTATGTTTCTCCCAGG + Intergenic
1152908779 17:82985015-82985037 GCCTCCCCTTTGGGCCTCCCTGG + Intronic
1153661901 18:7332934-7332956 GCCCCCACTCTAATTCTCCCTGG - Intergenic
1154085708 18:11303228-11303250 GCCTCACCGCTTTTTTTCCCCGG + Intergenic
1154434891 18:14335626-14335648 GCCTCCCCACTGGCTGTCCCTGG - Intergenic
1156546800 18:37971787-37971809 GTCACCCCTCTTTTTCTACCTGG + Intergenic
1157426540 18:47589041-47589063 CCTTCCCCTCTTTGTCTCCCAGG - Intergenic
1157597412 18:48872184-48872206 GTCTTCCTTCTGTATCTCCCAGG - Intergenic
1159252729 18:65901857-65901879 GCCTCACCTCTTTTTCTTCTAGG - Intergenic
1160135091 18:76264868-76264890 TCCTCACCTTTGTTTCTCCTGGG - Intergenic
1161076341 19:2287629-2287651 GCTTTCTCTCTGTTTCTCTCTGG + Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1163082379 19:14953294-14953316 GCCTCCTCTCTCTCTCTCCCAGG + Intronic
1163345996 19:16742585-16742607 GCTTCACCTCTGATTCTCCCTGG + Intronic
1163513914 19:17751625-17751647 GCCTCCCCTCTGTTCCTGAGGGG - Intronic
1163792728 19:19317421-19317443 GCCTCACCTCTGCCTGTCCCTGG - Intronic
1164080602 19:21858708-21858730 GCCTCTCCTCTGTTTCTACCAGG - Intergenic
1165169053 19:33878233-33878255 GCCTCCCGTCTGCTGCTGCCTGG + Intergenic
1166217438 19:41344707-41344729 GTCCCACCCCTGTTTCTCCCTGG - Intronic
1166305356 19:41934492-41934514 GCCTCCTCTCTCTTCCTCCCAGG - Intergenic
1167891505 19:52543496-52543518 GCCTGCCCTCAGTTCCTCTCAGG + Intronic
925182023 2:1823558-1823580 GCCTCGTCACTGCTTCTCCCAGG - Intronic
925383243 2:3443300-3443322 TCCTCCCCACTGGTTTTCCCGGG + Intronic
926097073 2:10088468-10088490 ACATCCCCTCTCTTTGTCCCTGG - Intergenic
927453906 2:23232818-23232840 GTCACCCCTCTGTTTGTCCCTGG - Intergenic
928123922 2:28603137-28603159 CCCTCCCCTCTGTGGCTGCCTGG - Intronic
929816450 2:45236696-45236718 GTCTTCCCTCCCTTTCTCCCTGG - Intergenic
930028242 2:47042946-47042968 GCCTCCCCCCAGCTTCCCCCAGG + Intronic
930035872 2:47084655-47084677 GTCTCCCCTCTGCCTCTCTCAGG - Intronic
930035886 2:47084715-47084737 GTCTCCCCTCTGCCTCTCTCAGG - Intronic
930035896 2:47084839-47084861 GTCTCCCCTCTGCCTCTCTCAGG - Intronic
930035909 2:47084897-47084919 GTCTCCCCTCTGCCTCTCTCAGG - Intronic
930035916 2:47084927-47084949 GTCTCCCCTCTGCCTCTCTCAGG - Intronic
932497270 2:72152256-72152278 GCCTACCTTCTGTATTTCCCAGG - Intergenic
933194416 2:79372100-79372122 GCCTCACCTCAGGTTCACCCCGG - Intronic
935958252 2:108399765-108399787 GCCACCTCTCTGTTTCTTTCAGG + Intergenic
936013879 2:108943302-108943324 GCCTCCCCTCTGTTTCTCCCAGG - Intronic
937136119 2:119555025-119555047 GGCTCCCTTCTGTGTCTCCTTGG - Intronic
938291853 2:130154807-130154829 GTGACCCCGCTGTTTCTCCCTGG - Intronic
938587209 2:132702783-132702805 ACCTCCCATCACTTTCTCCCAGG + Intronic
939878125 2:147600528-147600550 CCCTCCTCTCTGTTTCCCCTTGG + Intergenic
940650730 2:156437525-156437547 AACCCCCCTCTGTTTCTCACAGG + Intronic
941174883 2:162184539-162184561 TCTTCCCATCTGTTTGTCCCGGG - Intronic
943704455 2:191020526-191020548 TCCTCCCAACGGTTTCTCCCTGG + Intronic
945133035 2:206595391-206595413 GTCTCCTCCCTGTTTCTCCAGGG - Intronic
946053682 2:216883668-216883690 GCCTCCCGGATGTTTTTCCCAGG + Intergenic
946162444 2:217843949-217843971 GCCTTCCATATGTCTCTCCCTGG + Intronic
947257519 2:228181975-228181997 GTCTCCCCTCCCTTTCTCGCTGG + Intergenic
948571696 2:238921810-238921832 GGCTCCCCTGTGTGCCTCCCAGG - Intergenic
948900757 2:240955867-240955889 GGCTCCGCTCTGTTTCTTTCAGG - Intronic
1169498243 20:6134843-6134865 GCCTGCCCTCATGTTCTCCCTGG + Intergenic
1170764486 20:19278448-19278470 GCATCCCCTCTGTTTCAGGCTGG - Intronic
1170909172 20:20546781-20546803 TCCACCCCGCTTTTTCTCCCTGG - Exonic
1170940490 20:20844473-20844495 GCCTCCCATCTCCCTCTCCCTGG - Intergenic
1171035967 20:21713294-21713316 GCGGCCCCTCTGCTTTTCCCTGG - Intronic
1171136479 20:22699479-22699501 GGCTCCCCTCTGTGCCTCACAGG + Intergenic
1171409530 20:24936700-24936722 TCCTCCCCTGTGTGTCTCCTGGG - Intergenic
1171545713 20:25998930-25998952 GCCTCCCCTCCTTTTCACTCAGG + Intergenic
1172090859 20:32431498-32431520 GCCTCCCCTTTGCCTCTCTCTGG + Intronic
1172764834 20:37345938-37345960 GCCGCCCCTGGGTCTCTCCCGGG + Intronic
1173997868 20:47353231-47353253 GTCTCCCCACTGGTTCTCCCAGG + Intronic
1174450930 20:50619915-50619937 GCCTCCTCTCTGTCTCTTCCTGG - Intronic
1174858088 20:54065736-54065758 GGCTCCCCTCTGGCTCACCCTGG + Intronic
1175163355 20:57025044-57025066 GCCTCCCATCTGTTGCCCTCGGG + Intergenic
1175291557 20:57879313-57879335 CCCTCCCCTGTGTTTCTCCCAGG + Intergenic
1175895768 20:62334962-62334984 GCCTCCCCTCGGTTTATGCTGGG - Intronic
1176073249 20:63237509-63237531 GCCTCCCTTCTTCTTCTCACTGG + Intronic
1178432054 21:32525760-32525782 TCCTCCCCTCTGACTTTCCCAGG + Intergenic
1178615489 21:34129372-34129394 GCCTCTGCTCTGTTTCTACCGGG + Intronic
1179713997 21:43278517-43278539 GCCTCCCCTTTGGTGCTCTCAGG + Intergenic
1179786527 21:43733458-43733480 GCCTCCTTCCTGTATCTCCCAGG - Intronic
1179989486 21:44939848-44939870 TCCTCCGGTCTGTTTCTCCCAGG + Intronic
1180622107 22:17169102-17169124 GCCTTCCCTCTGCCTATCCCTGG - Intergenic
1181988096 22:26815649-26815671 GCCTCCTCCCTGTTTCTCCATGG - Intergenic
1184177068 22:42794498-42794520 GCCTCCCCTCTGACTGCCCCTGG + Intergenic
1184815047 22:46862726-46862748 GCCTCCTCTCTGCTTCTCTATGG - Intronic
1185217433 22:49609473-49609495 GCCTCCCCTCTGCTCTCCCCTGG - Intronic
949461884 3:4303097-4303119 GCCCCCTCTCTGATGCTCCCAGG + Intronic
950457561 3:13101713-13101735 GCCTCCTCCATGTTTCTACCTGG - Intergenic
953361325 3:42299919-42299941 GACTACCCTCTGTTTCTTGCTGG + Intergenic
953450231 3:42999427-42999449 GCCTCCCTGCTGTTTCTCCCAGG + Intronic
954149016 3:48648000-48648022 GCCTCCCCTTTCTTTCTCCTGGG - Intronic
954582525 3:51710790-51710812 GACACCCCTCTGCTGCTCCCAGG + Intronic
954678345 3:52327672-52327694 GCCTCTCCACTGCTGCTCCCAGG - Intronic
954853243 3:53620866-53620888 CCTTCCTCTCTGTTTCCCCCAGG - Intronic
959289519 3:104456018-104456040 TCCTCCCCTCTCAGTCTCCCTGG - Intergenic
960696539 3:120401980-120402002 GCCTCCACTCTGAATATCCCTGG + Intronic
960988516 3:123295745-123295767 ACCTCCCCTCTGTCCCTGCCTGG + Intronic
961726657 3:128935147-128935169 GCCTCCGCTCAGTGTCTCGCAGG + Exonic
962226622 3:133616419-133616441 GCCTCCACACTGTTTCTAACTGG + Intronic
962527017 3:136246122-136246144 GTCTCCCCACTTTTTCTCACAGG + Intergenic
963008159 3:140745633-140745655 GCCTCCCTTCTCATTCTCACAGG - Intergenic
963738558 3:149051004-149051026 GCTTCCCAGCTGTGTCTCCCTGG - Intronic
964041798 3:152269374-152269396 CTCGCCCCCCTGTTTCTCCCTGG - Intronic
964942424 3:162175423-162175445 GCTCTCCCTCTCTTTCTCCCTGG - Intergenic
965267589 3:166565069-166565091 CTATCCCCTCTGCTTCTCCCTGG + Intergenic
968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG + Intronic
968530891 4:1091007-1091029 GCCTCCCCTGTGTTTGCCCTTGG - Intronic
968969510 4:3786274-3786296 GCGTGGCCTCTGCTTCTCCCGGG - Intergenic
969119988 4:4901045-4901067 TCCTGCCCTCTGTGTCTCCAGGG + Intergenic
969350762 4:6596749-6596771 TCTTCCCCTCTGGGTCTCCCAGG + Intronic
969572661 4:8018986-8019008 GTCTCCCCTCTCTTTCCTCCTGG - Intronic
969672092 4:8595452-8595474 GCCCACCCTCTGCCTCTCCCAGG - Intronic
969847438 4:9930345-9930367 TCCTACCCTCTTTTTCACCCTGG - Intronic
970503039 4:16697529-16697551 GCCACCTCTCTGTGTCTCCTTGG + Intronic
972292215 4:37699683-37699705 TCCTCTCTTCTCTTTCTCCCAGG + Intergenic
978775887 4:112506520-112506542 GCCTCCCCTATGTTTCCCAGTGG - Intergenic
978833342 4:113116345-113116367 AGCTCCCCGCTCTTTCTCCCAGG + Intronic
978927610 4:114268090-114268112 GCCTCTCCTCTTCTTCTCCCTGG + Intergenic
979343536 4:119557330-119557352 TCCTTCCCTCTGGTTCTCACAGG + Intronic
979720708 4:123896838-123896860 TCTTCCCCTCTTTTTCTGCCAGG - Intergenic
980277379 4:130671555-130671577 GCATCCCTTCTCTTTCTACCAGG + Intergenic
985983016 5:3488124-3488146 TCCTCCCCTCTCTGCCTCCCTGG - Intergenic
986142934 5:5048765-5048787 GCCTCTCTTCTGATCCTCCCTGG + Intergenic
986445731 5:7819652-7819674 CCCGACCCTCTGTCTCTCCCAGG + Intronic
986702227 5:10421755-10421777 GCCTCCCTGCTTTTTCTCACAGG - Intronic
987239482 5:15979885-15979907 AACTCCTCTCTGTTTCTCTCTGG + Intergenic
988849279 5:35162770-35162792 GCCTCGTCCCTGTGTCTCCCGGG + Intronic
989981915 5:50655641-50655663 TCCTCCCCTCTCTCGCTCCCTGG + Intergenic
990484814 5:56247821-56247843 TCCTCCCCTCTGCTCCTTCCTGG + Intergenic
992258979 5:74951073-74951095 GCCTGTCCTCTGTTTCTTCATGG + Intergenic
995859477 5:116626548-116626570 GCCTCTCATCTTTTACTCCCAGG + Intergenic
995949720 5:117695869-117695891 ACCTCCCCTCTTTTGCTCCTGGG - Intergenic
997509917 5:134447009-134447031 CCCTCCCCTCTGTGTCCCCAGGG - Intergenic
999429012 5:151510174-151510196 ACCTCCCTTCTTTTTCTCCTAGG - Exonic
999929078 5:156410869-156410891 TCCTCCCTTCTTCTTCTCCCTGG + Intronic
1000180095 5:158800722-158800744 GTCTCCCCTCTGTTTCTCTCTGG - Intronic
1001233708 5:170011808-170011830 CCCTCCCCTCTCTTTCTTTCTGG + Intronic
1001564528 5:172690840-172690862 ACCTCCTCACTGTGTCTCCCTGG - Exonic
1001827884 5:174760662-174760684 GCCACCCCTCTGTCCCTCTCAGG - Intergenic
1002639468 5:180623885-180623907 TCCTCCCTTCTCCTTCTCCCTGG + Intronic
1003279008 6:4675983-4676005 GCTTCCCCTCTGCATCTCCTTGG + Intergenic
1003551676 6:7107201-7107223 GCCGCCCCTCTGGGTCTCCGAGG - Intergenic
1003867942 6:10380721-10380743 CCCTCCCCTCCGCTTCTCCCAGG + Intergenic
1004182863 6:13395937-13395959 GCCTGCCCTCTGCTCATCCCAGG - Intronic
1004360427 6:14966027-14966049 GCCTGGCCTCTGTTTCTCCGTGG - Intergenic
1005788404 6:29270943-29270965 GCCACCCCTTTCTTTCTTCCAGG - Intergenic
1006800833 6:36758741-36758763 GCCTTCCTTCTGTGTCTACCTGG - Intronic
1007061475 6:38944902-38944924 TCCCCCCCTCTTTTTATCCCTGG + Intronic
1007518111 6:42429454-42429476 GCCTCCTCTCACTTTCTCCGGGG + Intronic
1007762319 6:44140230-44140252 GTATCCTCTCTGCTTCTCCCAGG + Exonic
1010018631 6:71134734-71134756 GCCACCCCTCTTTCACTCCCTGG + Intergenic
1011913096 6:92466687-92466709 TCCTCCCCTCCCTTTCCCCCTGG - Intergenic
1015011379 6:128352655-128352677 CTCTCCCCTCTGTCTCTGCCTGG + Intronic
1016505628 6:144775894-144775916 GCGTCCCTTCTGTTCCTCTCAGG - Intronic
1017646405 6:156543465-156543487 ACCTCCTCTCTCTCTCTCCCTGG + Intergenic
1018246392 6:161828574-161828596 CCCGCCCCTCTGTTTCTCACTGG + Intronic
1018387879 6:163321593-163321615 GCCTCACCTCTATTTCCACCAGG + Intergenic
1019451609 7:1101577-1101599 GCCTCCTGTCTGATTCTCGCCGG + Intronic
1019488959 7:1302172-1302194 GCCTCCACGTGGTTTCTCCCAGG - Intergenic
1019505595 7:1388953-1388975 CCCTCTCCTCTGTCTCTACCCGG - Intergenic
1019536506 7:1532112-1532134 CCCACCCCTCTGATTCTCCAGGG + Intronic
1019709163 7:2510557-2510579 GCCGCCCCTCTGTGTCTGCCTGG - Intergenic
1019789435 7:3001349-3001371 GCCTCCCCTTTCTTTCCCCATGG - Intronic
1019928512 7:4208540-4208562 TCCTCCCCTCTGAATCTCCAGGG - Intronic
1022155973 7:27662487-27662509 GCCTTCCCTCCCTTTCTCCCGGG - Intronic
1022196566 7:28073383-28073405 GCCTCCCCTCCCTTTCTCTCAGG + Intronic
1023017926 7:35984709-35984731 TCATCCCCTGTGCTTCTCCCTGG - Intergenic
1023018342 7:35987375-35987397 GCCTCCCCTCTGCATCTGGCGGG - Intergenic
1023283504 7:38595106-38595128 AACTCCCCTCTGTCCCTCCCTGG - Intronic
1023462726 7:40418318-40418340 ACCTGCCCTCTGCTTCTCCTTGG + Intronic
1024006732 7:45229781-45229803 CCCTCCACTCTCTATCTCCCAGG - Intergenic
1024133596 7:46383655-46383677 GCCTCACCTCTCTTTGGCCCTGG - Intergenic
1026305112 7:69133928-69133950 GTCTCACCTTTGTTTTTCCCTGG + Intergenic
1026788746 7:73318533-73318555 GACTTTCCTCTGTTTTTCCCAGG + Intronic
1028966853 7:96811750-96811772 GCCACAGCTGTGTTTCTCCCTGG + Intergenic
1029422076 7:100477052-100477074 GCACCCTCTCTCTTTCTCCCTGG - Intronic
1029550897 7:101236595-101236617 GCCGCCCCATTGTTTCTCCGGGG - Intronic
1032467160 7:132153355-132153377 CCCTCCCCGCTCTGTCTCCCTGG - Intronic
1032488257 7:132304813-132304835 GCAACCCCTTTGTGTCTCCCAGG + Intronic
1032632192 7:133665682-133665704 TCCTGCCCTCTGAATCTCCCTGG + Intronic
1032730551 7:134637985-134638007 GTCTCTCCACTGTTTCTTCCAGG + Intergenic
1033599089 7:142876324-142876346 CGTTCACCTCTGTTTCTCCCAGG + Intronic
1033605918 7:142928607-142928629 CCTTCACCTCTATTTCTCCCAGG + Intronic
1034227200 7:149493446-149493468 GCCTGGACTCTGTTTCTTCCTGG - Intronic
1034242387 7:149620514-149620536 GCCTGGACTCTGTTTCTTCCCGG - Intergenic
1034261804 7:149761539-149761561 GCCTTCTCTCTCCTTCTCCCCGG + Intergenic
1034959842 7:155358366-155358388 GCACCCCCTCTGTGCCTCCCTGG + Exonic
1035785214 8:2254490-2254512 GCTTCCCCGCCGCTTCTCCCTGG + Intergenic
1035807594 8:2467226-2467248 GCTTCCCCGCCGCTTCTCCCTGG - Intergenic
1036222017 8:6929140-6929162 GCCTTGCCTCTGTCTCCCCCAGG + Intergenic
1036406656 8:8461326-8461348 GCCTCACTTCTGGCTCTCCCTGG + Intergenic
1036503848 8:9337336-9337358 CCCTCTGCTCTGCTTCTCCCTGG - Intergenic
1036637208 8:10559552-10559574 GCCTCCCCTCTAATTCTGCTGGG - Intergenic
1037795838 8:21993975-21993997 CCCTCCCCTCCTTTCCTCCCTGG + Intronic
1040106673 8:43545778-43545800 GCCTCACCCCTTTTTTTCCCTGG + Intergenic
1040110100 8:43563423-43563445 GCCTCGCCGCTTTTTATCCCTGG + Intergenic
1040471454 8:47738317-47738339 GCCCCCTCTCAGTTCCTCCCCGG + Exonic
1041487296 8:58393007-58393029 ACTTCACCTCTGCTTCTCCCTGG + Intergenic
1041757964 8:61334672-61334694 GCCTCTCCTCTGTATCACCATGG - Intronic
1042215329 8:66425382-66425404 CCCTCCCCTCTTTTTCTCCCAGG - Intergenic
1042397003 8:68304566-68304588 GCCTACCCTCTGTTTCTATGTGG - Exonic
1042651350 8:71045576-71045598 GCCTCCCATCCTCTTCTCCCCGG - Intergenic
1044110774 8:88270344-88270366 TTCTCCTTTCTGTTTCTCCCTGG - Intronic
1044702231 8:94975172-94975194 ACCTGCCCTCTGTCTCTACCTGG - Intronic
1047470322 8:125165084-125165106 GCCTCCTCCTTGTTCCTCCCTGG + Intronic
1048833278 8:138496686-138496708 GGCTCCCCTCTCTCTCCCCCGGG + Exonic
1049208038 8:141372385-141372407 GCTTCCCCTCTCCCTCTCCCTGG - Intergenic
1050183136 9:2942024-2942046 TCCCCCCTTCTGTTTCTCACTGG - Intergenic
1051761993 9:20477726-20477748 GCACCCTCTCTGTATCTCCCTGG - Intronic
1055364286 9:75526843-75526865 GACTCCACTCAATTTCTCCCAGG + Intergenic
1055764956 9:79652515-79652537 GCCTCCTTTCTGTTTCTCTTGGG + Intronic
1056178916 9:84062621-84062643 CCCTCCCCTCTATTCCTCCAAGG - Intergenic
1056567048 9:87782876-87782898 GTCTCCACTCTGTTCCACCCAGG + Intergenic
1056763104 9:89428434-89428456 GCCTCCCCTCTGCTGCCGCCTGG - Intronic
1057036582 9:91816147-91816169 GTGTCCCCTGTCTTTCTCCCTGG + Intronic
1057202875 9:93152255-93152277 ATCTCCTCCCTGTTTCTCCCTGG - Intergenic
1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG + Intronic
1058052436 9:100420453-100420475 TCCTCCCCTCATTTGCTCCCTGG + Intergenic
1059459002 9:114417990-114418012 TACTCCACTCTGTCTCTCCCAGG - Intronic
1060110713 9:120904590-120904612 GCCTGCTCTCTTTTTCTCCAGGG - Exonic
1060723922 9:125995217-125995239 GACTTCCCTCTGCTTCTCCGTGG - Intergenic
1060987817 9:127829827-127829849 GTCTCTCCTCTGTGTCCCCCAGG - Exonic
1061011906 9:127960866-127960888 GCCTCCCTCCTGTTTCTACAGGG + Intronic
1061050373 9:128191534-128191556 GCCTCCCCGCTGCTACTCCGGGG + Exonic
1061841279 9:133359788-133359810 GCCTCAGCTCTGTTCCTACCAGG - Intronic
1061874717 9:133537884-133537906 GCCAGTCCTCTGCTTCTCCCGGG - Intronic
1061997259 9:134192825-134192847 GGAGCCCCTCTGTTTCCCCCAGG + Intergenic
1062339833 9:136089143-136089165 GCCGCCCCGCTGGTTCTCCCGGG - Intronic
1062447016 9:136599365-136599387 ACCTCCCCTGTGGGTCTCCCAGG - Intergenic
1187403925 X:18985006-18985028 GCCTTCCCCCTTTTTCTTCCGGG - Intergenic
1190001721 X:46695434-46695456 TATTCCCCTCTGTTTCTTCCAGG - Intronic
1191253067 X:58268464-58268486 GCCTCGCCACTTTTTTTCCCGGG + Intergenic
1191955943 X:66642477-66642499 GCCTCCACTCTGCTTATCTCTGG + Intergenic
1192759876 X:74085957-74085979 GCCTCCCCCCTTTTCCTCCTTGG - Intergenic
1194403068 X:93461717-93461739 CCCTACCCCCTGTTGCTCCCGGG - Intergenic
1195679432 X:107532959-107532981 GGCTTCCATCTGTTGCTCCCTGG + Intronic
1200094269 X:153649937-153649959 GCCTGCCCTCCGGGTCTCCCGGG + Intronic
1200971385 Y:9156094-9156116 GTCTCCCCTCTGTTTCTAGATGG + Intergenic
1201764207 Y:17564073-17564095 GCCTCGCCGCTGTTTTCCCCAGG + Intergenic
1201837346 Y:18341917-18341939 GCCTCGCCGCTGTTTTCCCCAGG - Intergenic