ID: 936014824

View in Genome Browser
Species Human (GRCh38)
Location 2:108950077-108950099
Sequence CAGCCAGCAGGCCCCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 423}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936014824_936014829 2 Left 936014824 2:108950077-108950099 CCCCAGGAGGGGCCTGCTGGCTG 0: 1
1: 0
2: 5
3: 47
4: 423
Right 936014829 2:108950102-108950124 GAGTGAATGCAGCACACATAGGG 0: 1
1: 0
2: 0
3: 16
4: 210
936014824_936014830 22 Left 936014824 2:108950077-108950099 CCCCAGGAGGGGCCTGCTGGCTG 0: 1
1: 0
2: 5
3: 47
4: 423
Right 936014830 2:108950122-108950144 GGGACATGTTCAGCCCTACAAGG 0: 1
1: 0
2: 0
3: 9
4: 86
936014824_936014828 1 Left 936014824 2:108950077-108950099 CCCCAGGAGGGGCCTGCTGGCTG 0: 1
1: 0
2: 5
3: 47
4: 423
Right 936014828 2:108950101-108950123 AGAGTGAATGCAGCACACATAGG 0: 1
1: 0
2: 0
3: 23
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936014824 Original CRISPR CAGCCAGCAGGCCCCTCCTG GGG (reversed) Intronic
900158821 1:1213893-1213915 CAGCCAGGAGGCTGGTCCTGGGG - Intronic
900409273 1:2505401-2505423 CAGCCTCGAAGCCCCTCCTGTGG - Exonic
900886442 1:5418741-5418763 CAGCAAGAAGGACCCCCCTGCGG + Intergenic
901199689 1:7459644-7459666 CAGGCTGCAGGCCCCTGCTCAGG + Intronic
901428821 1:9199928-9199950 CAACCAGCAGGCCTCTCCCTTGG + Intergenic
901475581 1:9487056-9487078 CAGGCAGCAGTCTCCTCTTGCGG - Intergenic
902195327 1:14793937-14793959 CAGCCCGCAGCCTCCACCTGAGG + Intronic
902336864 1:15758973-15758995 CCACCCGCAGGCCCCTCCAGGGG - Intronic
902677238 1:18017290-18017312 AGGCCAGCAGGGCCCTCCTCAGG - Intergenic
903121441 1:21219156-21219178 TAGCCATCAGTCCCCTGCTGTGG + Intronic
903648430 1:24908821-24908843 AAGCCTGCAGTCCCCTCCTGGGG - Intronic
903811898 1:26039250-26039272 CAGCCAGCAGCCGCCTCCAAGGG - Exonic
903849279 1:26296548-26296570 CAGCCATGAGGCCCTTCCTCTGG - Intronic
904619510 1:31766831-31766853 CTCCCTGGAGGCCCCTCCTGGGG - Intergenic
904807965 1:33145094-33145116 CAGGCAGCAGGCAGCTCATGGGG - Intergenic
905124674 1:35708238-35708260 AGGCCTGGAGGCCCCTCCTGGGG + Intergenic
906223615 1:44103267-44103289 CTCCCAGCCTGCCCCTCCTGCGG - Intergenic
907351851 1:53838338-53838360 GACCCAGCAGGGTCCTCCTGGGG - Exonic
907448096 1:54522488-54522510 CAGCCACCATGCCCATCCTATGG - Intergenic
908527392 1:65001330-65001352 CCGCCAGCAGAGGCCTCCTGCGG + Intergenic
910238579 1:85061932-85061954 CAGCGAGCTGGGCCCTCCTAGGG - Intronic
911194097 1:94976406-94976428 CAGCCACCATGCCCGTTCTGGGG - Exonic
912812744 1:112806233-112806255 TATTCAGCTGGCCCCTCCTGAGG - Intergenic
913442896 1:118917864-118917886 GAGCCAGCAGGCCCTTACTCTGG + Intronic
915490962 1:156249872-156249894 CAGGGAGCAGGCCCCACCTAGGG - Exonic
915536968 1:156542472-156542494 GAGCCACCAGGCCCGGCCTGGGG + Intronic
916174123 1:162023724-162023746 CAGCCACCTGAGCCCTCCTGCGG - Exonic
916758965 1:167799797-167799819 CAGCCACCAGACCACTGCTGTGG - Intergenic
917972545 1:180218180-180218202 CAGCCAGCTGGGCCCTCCTCTGG - Intergenic
918041558 1:180916901-180916923 CACCCAGCAGGGCCGTCCTGGGG - Exonic
918080451 1:181203944-181203966 CTGCCAGCAGCCCCCAGCTGAGG + Intergenic
919957787 1:202436565-202436587 AAGCCAACAGACCCTTCCTGAGG - Intronic
920275098 1:204798693-204798715 CAGCCAGCAGGGCCTGCCAGAGG + Intergenic
920445054 1:206010165-206010187 CAGACACAAGGCCCCTCCTTAGG + Exonic
920491684 1:206420568-206420590 CTGCCACCAGGCCACTCCTGAGG - Intronic
920944679 1:210517077-210517099 CAGCCAGTAGGCTTCTTCTGAGG - Intronic
921387188 1:214582021-214582043 CATCTTGCAGGCCCCACCTGGGG + Intergenic
922568476 1:226617470-226617492 CAGCCAGCAGGCAAACCCTGAGG + Intergenic
922572875 1:226644215-226644237 CATCCAGCTGGCACCCCCTGTGG - Intronic
922709649 1:227816870-227816892 CAGCAGGCACGCCTCTCCTGTGG + Intronic
923030902 1:230248428-230248450 AGGCCAGCAGGCTCCACCTGCGG - Intronic
923097908 1:230790004-230790026 CAGCCTTCAGGACCCTGCTGTGG - Intronic
923615180 1:235531405-235531427 TAGCCAGCAGGCCCATCATGGGG + Intergenic
1063714458 10:8513643-8513665 CTCCCAGCCTGCCCCTCCTGCGG - Intergenic
1064032826 10:11894004-11894026 AGGCCAGATGGCCCCTCCTGTGG - Intergenic
1065740347 10:28791597-28791619 CAGCCAGCAGCCCACACCAGTGG + Intergenic
1067438988 10:46297673-46297695 CAGCCAGCAGCCCACTCTTAGGG - Intronic
1067581238 10:47447404-47447426 CAGCCAGCAGCCCACTCTTGGGG - Intergenic
1069362898 10:67663552-67663574 CTCCCAGCCTGCCCCTCCTGCGG - Intronic
1069824507 10:71246837-71246859 CAGCCGGCAGGCTCCCTCTGGGG + Intronic
1069826316 10:71257144-71257166 GAGCCAGCAGGTGCTTCCTGGGG + Intronic
1069947537 10:71998371-71998393 GAGCCAGCAGACTCCTCCCGGGG + Intronic
1072971779 10:100023619-100023641 CAGCCACCATGCCCAGCCTGGGG - Intergenic
1073767487 10:106699162-106699184 CAGCCAGCTGGGCACTGCTGTGG + Intronic
1073863154 10:107770531-107770553 CAGTCTGCTGGCCTCTCCTGGGG + Intergenic
1074489118 10:113923107-113923129 CTGGCAGCCTGCCCCTCCTGGGG - Intergenic
1074760416 10:116663465-116663487 CTGCCAACTGGACCCTCCTGGGG + Intergenic
1075398510 10:122144517-122144539 CAGCCAGCAGGAGCTCCCTGAGG - Intronic
1075991030 10:126839140-126839162 CACCCACCAGGGCCCTCCAGAGG - Intergenic
1076189701 10:128474371-128474393 CACTCAGCAGGGCCCACCTGGGG + Intergenic
1076352032 10:129823474-129823496 GAGCCACCACGCCCATCCTGTGG + Intergenic
1076737738 10:132466253-132466275 CCCCCACCGGGCCCCTCCTGTGG + Intergenic
1076741632 10:132488562-132488584 CCGCCTCCAGGGCCCTCCTGAGG - Intergenic
1076742590 10:132494167-132494189 CAGGCAGGAGGTGCCTCCTGGGG - Intergenic
1076777276 10:132704758-132704780 CAGGCAGCAGGCAGCTCCTCTGG + Intronic
1076777299 10:132704864-132704886 CAGGCAGCAGGCAGCTCCTCTGG + Intronic
1076885395 10:133259890-133259912 CGGTCAGCAGGCCTCTCCTGTGG + Intergenic
1077051169 11:567759-567781 CAGCCAACAGGACCATCCTCCGG - Intergenic
1077358677 11:2130196-2130218 CAGCCAGGAGCCCCCTCCTGTGG + Intronic
1077404194 11:2375537-2375559 CAGGCAGCAGACCCCTCCCCTGG - Intergenic
1077409573 11:2397215-2397237 CACCCAGCCCGCCCGTCCTGTGG + Exonic
1077416134 11:2425120-2425142 CAGCCTCCAGCCCCCACCTGGGG - Intergenic
1077730251 11:4722696-4722718 CTCCCAGCCTGCCCCTCCTGCGG - Intronic
1077998845 11:7476618-7476640 CAGGCAGCTGTCCCATCCTGGGG + Intergenic
1078059770 11:8035625-8035647 CAACCTGCAGGCCCTCCCTGAGG - Intronic
1078191608 11:9095962-9095984 CTACCAGCCTGCCCCTCCTGCGG + Intronic
1078196305 11:9139817-9139839 CAGCCAGCAGGGCAATCCAGTGG + Exonic
1078632154 11:13012474-13012496 CGGCCAGCAGGCTCCTTCCGCGG - Intergenic
1079752145 11:24212890-24212912 CACCAAGCAGGCCCCACTTGTGG + Intergenic
1080379593 11:31754584-31754606 GAGCCAGCATGCCCAGCCTGGGG - Intronic
1080787894 11:35492781-35492803 CAACCAGCAGGCCACACCAGAGG + Intronic
1082184760 11:49165434-49165456 CAACCACCAGCCCCCTCCTGAGG - Intronic
1083958777 11:66002518-66002540 CCGCCACCCGGCCGCTCCTGCGG - Exonic
1084321752 11:68377186-68377208 GTGCCAGCCAGCCCCTCCTGTGG - Intronic
1084428983 11:69100997-69101019 CAGCCAGCAGGCCTCCTCTGAGG - Intergenic
1084477199 11:69395755-69395777 GAGCCAGCAGGCCCAGCCAGGGG - Intergenic
1085512544 11:77095660-77095682 CAGACAGATGGCCTCTCCTGGGG - Intronic
1086681580 11:89679925-89679947 CAACCACCAGCCCCCTCCTGAGG + Intergenic
1089189459 11:116643675-116643697 CAGCCCGCAGGAGCCTCCGGTGG + Intergenic
1089253575 11:117181744-117181766 CAGCCGGCCTGCCCCTCCAGAGG - Intronic
1089599143 11:119602821-119602843 CTCCCAGCCTGCCCCTCCTGCGG - Intergenic
1089700643 11:120241924-120241946 CAGCCAGGAGCTCACTCCTGGGG - Intronic
1090009533 11:123034005-123034027 CAGCTCGCAGGGCCCTCCCGCGG - Intergenic
1091702661 12:2674248-2674270 CAGCCAGGGGGCCCCTCCACCGG - Intronic
1094783386 12:33818511-33818533 CTGTCTGCTGGCCCCTCCTGGGG - Intergenic
1095874843 12:47068895-47068917 CATCCACCCGTCCCCTCCTGGGG - Intergenic
1095960735 12:47832881-47832903 CCCCCAGCAGGGCCCTCCTCTGG - Intronic
1096529269 12:52233130-52233152 CTGCTGCCAGGCCCCTCCTGGGG - Exonic
1097193753 12:57232745-57232767 CAGCCACCAGGCCACTGATGTGG - Exonic
1097776440 12:63652048-63652070 CATCATGCAGGCCCCACCTGTGG + Intronic
1098347815 12:69524503-69524525 CAGCCCCCAGGTACCTCCTGGGG - Intronic
1098370336 12:69752562-69752584 GACCCAGCATGCCACTCCTGGGG - Intronic
1099576541 12:84390662-84390684 GGGCCAGCAGGCCACTCCAGGGG + Intergenic
1102011900 12:109624108-109624130 CAGCCCTCAGCCCCCTTCTGTGG - Intergenic
1102487872 12:113270398-113270420 CAGCCAGAAGGCACCACCTATGG - Intronic
1103468989 12:121165063-121165085 CTCCCACCAGGCCCCTCCTCTGG + Intronic
1104271226 12:127284246-127284268 CAGCCAGCAGTCCCTCCATGGGG + Intergenic
1104623650 12:130336951-130336973 CAGCCGGCGGGGCCCACCTGTGG + Intergenic
1104786079 12:131448636-131448658 CAGGGAGCAGCCCCCGCCTGAGG - Intergenic
1104920044 12:132285952-132285974 CAGTCAGGAGCCCCCACCTGTGG - Intronic
1104966352 12:132510256-132510278 CACCCTGCCGGCCTCTCCTGGGG + Intronic
1107525756 13:41229814-41229836 GAGCCACCATGCCCGTCCTGAGG - Intronic
1108342925 13:49515345-49515367 CAGCAAGCAGGCTCCTCCCTAGG + Intronic
1110364538 13:74667281-74667303 CAGCCCACACTCCCCTCCTGAGG + Intergenic
1110725394 13:78816929-78816951 CAGCCAACAGGCCCGTCCTGTGG - Intergenic
1111204037 13:84980319-84980341 CTCCTACCAGGCCCCTCCTGGGG + Intergenic
1112730158 13:102351741-102351763 CAGCCAGCTGTCACATCCTGAGG - Intronic
1113105575 13:106768603-106768625 CTGCCATCAGCCCCTTCCTGTGG + Intergenic
1113271959 13:108684196-108684218 CAGCCTGCACACCCCTCCTGTGG - Intronic
1113868599 13:113544687-113544709 CAGCCAGGAGGCACCATCTGTGG - Intronic
1113902047 13:113802892-113802914 CAGCCGGCCGGCCCCTGCGGTGG + Intronic
1114497132 14:23140608-23140630 CAGCCAGAAGTACTCTCCTGTGG + Exonic
1115537197 14:34384554-34384576 CAGCTGGTAGGTCCCTCCTGGGG - Intronic
1117980457 14:61337709-61337731 GAGCCACCATGCCCCACCTGGGG + Intronic
1118000320 14:61517165-61517187 CAGCCTGCACATCCCTCCTGAGG + Intronic
1118702541 14:68448083-68448105 CAGCCAGTTGGCCCATACTGAGG + Intronic
1119420210 14:74503734-74503756 CAGCCTGGAAGGCCCTCCTGGGG + Intronic
1119649696 14:76374939-76374961 CAGGCGGCTGGCCCCTCCTGGGG + Intronic
1119918649 14:78426055-78426077 AGGCCAGCAGGACCATCCTGGGG + Intronic
1122629442 14:103100561-103100583 CAGCCAGCAGGCATCCACTGGGG + Exonic
1122695678 14:103550998-103551020 CAGCCTGGAGGGCCCTCCTGGGG + Intergenic
1122982943 14:105199743-105199765 CAGCCGGCCAGCCCCTCCTCTGG + Intergenic
1123216537 14:106813606-106813628 CAGCCTTCAGGCCCTTCCTGGGG - Intergenic
1123978764 15:25579228-25579250 CAGCCTGCAGGCCTACCCTGTGG - Intergenic
1124631927 15:31342986-31343008 CAGCAAGCAGGCCCTGCCTGGGG - Intronic
1124640292 15:31392558-31392580 CACCCTGCAGGCCCCTTCAGGGG - Intronic
1125274974 15:37979818-37979840 CAGCCATCTCACCCCTCCTGGGG - Intergenic
1125755948 15:42065189-42065211 CAGCCTGTGGGCCCTTCCTGGGG - Intergenic
1127237478 15:57070801-57070823 CAGCCAGTATGACCCTGCTGAGG - Intronic
1127427311 15:58868902-58868924 CTCCCAGCAGGCCCCACCTCTGG - Intronic
1127973893 15:63983310-63983332 CAGCAAGCTTGCCCCTCCTTTGG + Intronic
1128086921 15:64893130-64893152 CAGCCATGAGGCCCAGCCTGGGG - Intronic
1129849053 15:78781357-78781379 CAGGCAGCAGGGCCCTCCCGAGG - Intronic
1130155164 15:81344145-81344167 CAGCCAGTGGGCCCCTCCAATGG + Intronic
1130325192 15:82873955-82873977 CAGTTAGCAGGCCTCTGCTGTGG + Intronic
1132204285 15:99975940-99975962 CAGCCAGAAAGCCCCTTCTTGGG - Intronic
1132461717 16:58743-58765 GAGCCAGCAGGACCCACCTGGGG + Exonic
1132472983 16:117179-117201 CAGCGGGCTGGCCCCTCCTGGGG - Intronic
1132481795 16:169982-170004 CAGCCGGCAGCCCACACCTGGGG + Intergenic
1132482663 16:174239-174261 CAGCCGGCAGCCCACACCTGGGG + Intergenic
1132693051 16:1190186-1190208 CAGCCAGCAGGCCCCCTCCCAGG + Intronic
1132870566 16:2114026-2114048 CAGCCAGCAGGACCTGCCCGGGG + Intronic
1132895690 16:2228457-2228479 CTGCCAGCGGGCCCCTCCGGAGG + Exonic
1132916763 16:2352304-2352326 CAGCCAGCAGATCCATCCTTAGG + Intergenic
1132930765 16:2458097-2458119 GAGCCAGCAGCCCACGCCTGGGG + Exonic
1132983587 16:2752104-2752126 CAGCCAGCGGGCACCCCCGGAGG - Intergenic
1133139303 16:3732499-3732521 CAGCCCACAGGCTCCTCCTCTGG + Intronic
1133139599 16:3734482-3734504 CAGGCAGGTGCCCCCTCCTGGGG + Intronic
1134521966 16:14922878-14922900 CAGCCAGCAGGACCTGCCCGGGG - Intronic
1134709636 16:16321529-16321551 CAGCCAGCAGGACCTGCCCGGGG - Intergenic
1134716849 16:16361558-16361580 CAGCCAGCAGGACCTGCCCGGGG - Intergenic
1134949967 16:18347116-18347138 CAGCCAGCAGGACCTGCCCGGGG + Intergenic
1134957903 16:18390601-18390623 CAGCCAGCAGGACCTGCCCGGGG + Intergenic
1135294019 16:21263827-21263849 AAGCCAGCAGGCCCTTCCGAAGG + Intronic
1136872867 16:33824473-33824495 CAGCCTTCAGGCCCTTCCTGGGG + Intergenic
1137492282 16:48943239-48943261 CATCCTGCAGTCCTCTCCTGAGG - Intergenic
1137768221 16:50994176-50994198 CAGCCAACAAGTCCCTCCTAGGG - Intergenic
1138343687 16:56307169-56307191 AAGGGAGCAGCCCCCTCCTGGGG - Intronic
1138418426 16:56884501-56884523 CAGCCTGCTGGCCCCTCTTGGGG - Intronic
1139952931 16:70680739-70680761 CAGCCTCCAGGCCCACCCTGGGG + Intronic
1141194899 16:81853044-81853066 GAGCCAGCGGGCCCAGCCTGGGG - Intronic
1141280094 16:82623553-82623575 CAGCCAGTAGCTGCCTCCTGTGG - Intergenic
1141557732 16:84846918-84846940 AACCCAGAAGTCCCCTCCTGGGG + Intronic
1141615497 16:85207389-85207411 CACCCAGCAGGTTCCTGCTGAGG + Intergenic
1141700629 16:85640462-85640484 CAGCCAGCAGACACCACCAGGGG - Intronic
1141788432 16:86217091-86217113 CAGGCACCGGGCCCCTCCTTCGG + Intergenic
1142023857 16:87801842-87801864 CACCCTGCAGGCTCCTCCTGTGG - Intergenic
1142280281 16:89144448-89144470 CAGCCACCAGCCCCTCCCTGTGG + Intronic
1203099304 16_KI270728v1_random:1291581-1291603 CAGCCTTCAGGCCCTTCCTGGGG - Intergenic
1143245989 17:5486210-5486232 CCGCCAGCAGGCCCCGGCGGCGG + Exonic
1144811034 17:17999079-17999101 CAGCTAGCTGGCTCTTCCTGAGG + Intronic
1144996337 17:19271876-19271898 AAGTCAGCAGGCCCTGCCTGAGG + Intronic
1145253821 17:21311924-21311946 CAGCCAGCAGGACCCAGCTCAGG - Intronic
1145282357 17:21477273-21477295 CAGCCAGGAGCCCTCTGCTGAGG - Intergenic
1146847076 17:36188896-36188918 CAGTCACCAGCCCCCTTCTGGGG + Intronic
1147573644 17:41586640-41586662 CAGCCCGCAGGCTCCCCCAGAGG + Exonic
1147577763 17:41612497-41612519 CAGCCCGCAGGCTCCCCCAGAGG + Exonic
1148731105 17:49837173-49837195 CAGAGGGCAGGACCCTCCTGTGG - Intergenic
1149194427 17:54102514-54102536 CTGCCAGCTGGCCTCTCCTAGGG + Intergenic
1149657493 17:58318065-58318087 CTGCCTGCAAGCCCCACCTGGGG - Intronic
1149727650 17:58912706-58912728 CAACCAGCACCCCCATCCTGAGG - Intronic
1150791162 17:68201035-68201057 CAGCCAGCAGGCAGCTTCTCTGG + Intergenic
1151564891 17:74892576-74892598 CAGCCACCTGGCCACTCATGGGG - Exonic
1151703476 17:75755186-75755208 AGGCCAGCAGCGCCCTCCTGGGG + Intronic
1152051776 17:77984680-77984702 CTCCCAGTAGGGCCCTCCTGTGG + Intergenic
1152215212 17:79027991-79028013 CAGACTGCAGGCCCCTCCCCGGG + Intronic
1152718809 17:81912508-81912530 CAGAGAGGAGGCCCCGCCTGGGG - Exonic
1153310334 18:3671423-3671445 CAGGCACCAGGCTGCTCCTGAGG - Intronic
1154148194 18:11884110-11884132 GGGCCACCAGGCCCTTCCTGGGG + Exonic
1155845087 18:30695605-30695627 CAGCCCCCAGGTACCTCCTGGGG - Intergenic
1156622710 18:38872195-38872217 CAGGCAGCAGTCCCCTCATTTGG - Intergenic
1160085530 18:75773797-75773819 TACCCAGCAGGGCCCTCATGTGG + Intergenic
1160149058 18:76385657-76385679 CAGCCAGCAGGGCGCTCCTGGGG - Intronic
1160246199 18:77162159-77162181 CAGCCAGAAGCCCCACCCTGTGG - Intergenic
1160533016 18:79576616-79576638 CAGCCAGCAGGCCCATGTGGAGG + Intergenic
1160810350 19:1010490-1010512 CAGCCCGCTGGGCCCTGCTGGGG - Exonic
1160894627 19:1396717-1396739 CAGCAGCCACGCCCCTCCTGGGG + Intergenic
1160970756 19:1766778-1766800 CAGCCTGCAAGACCCTGCTGCGG - Intronic
1160979367 19:1809876-1809898 CGGGCAGCAGGCACCACCTGGGG + Intronic
1161318722 19:3631379-3631401 CACCCAGCAGGCACCCCCCGGGG - Exonic
1161513559 19:4684542-4684564 CAGCCAGAAGTGCCCTTCTGCGG + Intronic
1162524703 19:11200679-11200701 CAGACACGAGACCCCTCCTGGGG + Intronic
1162618603 19:11821713-11821735 CAGCCAGCACGGCCCCTCTGTGG + Intronic
1162806595 19:13140578-13140600 GAGCCAGGGGGCACCTCCTGGGG - Exonic
1163156561 19:15442835-15442857 GAGCCAGCAGGGCCTTTCTGAGG - Intronic
1163199978 19:15760154-15760176 CAGCCAGCAGGGGGCTCTTGAGG - Intergenic
1163220229 19:15913632-15913654 CAGCCAGCATGGGGCTCCTGGGG - Exonic
1163265389 19:16217632-16217654 CAGTCTGCTGGCCTCTCCTGGGG - Intronic
1163314370 19:16532155-16532177 CAGCCATCAGGACCCTCCTTTGG - Intronic
1163354718 19:16802714-16802736 GAGCCAGCAGGCCCGGCCTCAGG - Intronic
1163674551 19:18648905-18648927 CAGCCAGCGGGACCCTCCTAAGG + Intronic
1163782165 19:19256347-19256369 CAGCCATCAGGCCCCTGATGGGG + Exonic
1164476427 19:28579291-28579313 CAGCTGGCAGCCCTCTCCTGAGG + Intergenic
1164478921 19:28596726-28596748 CAGAGAGCAGGCACCTGCTGGGG + Intergenic
1164526778 19:29018798-29018820 CAGGAAGCACCCCCCTCCTGAGG + Intergenic
1164551576 19:29216767-29216789 CTGCCTGCAGGTCCCTCCTCTGG - Intergenic
1164951129 19:32338164-32338186 CAGGCAGCAGGCCTCTGTTGAGG - Intergenic
1165331552 19:35143305-35143327 CATCCAGCAGCCCCCTGCTCCGG + Exonic
1165434587 19:35789058-35789080 CCTCCAGCAGGTCCATCCTGGGG + Intergenic
1165796812 19:38524430-38524452 CAGCCAGCAGCCCCCACCCCAGG + Intronic
1165906244 19:39196554-39196576 CAGGCACCAGCCCCCTCCTTAGG - Intergenic
1166789819 19:45392095-45392117 CATGGAGCAGGCCCCTGCTGTGG - Exonic
1166862783 19:45819430-45819452 CAGCCAGCAAGCACCTCCCTCGG + Intronic
1167793297 19:51693520-51693542 GAGCCAGCAGGGCCATCGTGTGG - Intergenic
1167851752 19:52207571-52207593 CAGCCAGCAGACACATCCTGGGG + Intronic
1167880245 19:52451516-52451538 CAGCCAGCGGGCCCAGCCCGCGG + Intronic
1168506666 19:56940937-56940959 CAGCCAGAATGCCCCTCAAGAGG - Intergenic
1168564328 19:57410971-57410993 AAGCCAGGAGGATCCTCCTGAGG - Intronic
925045199 2:767622-767644 CAACCAGAAGGCCCCTGCTGTGG - Intergenic
925254122 2:2467830-2467852 CAGCCCACAGGCCCCTCTGGTGG + Intergenic
925813409 2:7723715-7723737 CAGCCAGCAGGCTTAACCTGTGG - Intergenic
928490477 2:31778120-31778142 CAGCCCCCAGGTACCTCCTGGGG + Intergenic
929758685 2:44788529-44788551 CAGCCAACTGGCCTCTCCTTGGG - Intergenic
930737609 2:54795410-54795432 CCCCCACCAGGCCCCTCCTCTGG + Intronic
931691596 2:64838734-64838756 CACCCAGAAGGCCCCTTCTTGGG - Intergenic
932335950 2:70931530-70931552 CAGGCATCTGGCCCCTCCTCTGG + Intronic
932620275 2:73260908-73260930 AACCCAGCATGCTCCTCCTGTGG + Intronic
935686934 2:105692126-105692148 GAGCCAGCAGGCCTTCCCTGAGG - Intergenic
935934368 2:108165924-108165946 CAGCCAGCATGCACCAGCTGTGG - Intergenic
936014824 2:108950077-108950099 CAGCCAGCAGGCCCCTCCTGGGG - Intronic
936473724 2:112821877-112821899 CAGCCAGTAGGACCTTCCAGGGG + Intergenic
936981883 2:118272275-118272297 CAGCAAGCAGCCACCTCATGGGG - Intergenic
937279948 2:120710956-120710978 CACGCAGCAGGTCCCTGCTGAGG + Intergenic
937432359 2:121849631-121849653 CAGCCAGCATGACACTTCTGGGG + Intergenic
938262761 2:129907050-129907072 CAGCCTGCGGGCCCCTCCTGCGG - Intergenic
938405796 2:131032451-131032473 CAGCCATCAGGCTCCTCCCTGGG - Intronic
939254517 2:139724951-139724973 CTGCCACCAGGCCCCTCCCATGG + Intergenic
942558723 2:177198570-177198592 CTCCCAGCGTGCCCCTCCTGCGG + Intergenic
943027665 2:182649067-182649089 CAGGTAGCAGGCCCCTCTGGTGG + Intergenic
943064361 2:183071001-183071023 CTCCCAGCCTGCCCCTCCTGTGG - Intergenic
944526269 2:200623311-200623333 CAGACAGCATCCCCTTCCTGGGG - Intronic
945102517 2:206274988-206275010 CGGCGAGCAGGCCCCGCCCGCGG - Intronic
947503715 2:230690993-230691015 CAGCCAGCAGGCACTGCCTGGGG + Intergenic
947508128 2:230725450-230725472 CCGCCACCCGGCCACTCCTGCGG + Intronic
947632423 2:231662681-231662703 CAGCCGGCAGACCCTTCTTGAGG - Intergenic
948454242 2:238097375-238097397 CTGCCAGCAGGCCGCTGCTCGGG - Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
949045597 2:241871426-241871448 TAGCCCGCAGCCCCCTCATGTGG - Intronic
1168905160 20:1397363-1397385 CTGCCAGCAGACTCATCCTGGGG - Intergenic
1169065134 20:2690882-2690904 CCCCCAGCAAGCCACTCCTGGGG - Intergenic
1169444552 20:5660441-5660463 CAGCTAGCAGGCCCAAACTGAGG + Intergenic
1169745081 20:8935349-8935371 CAGCCAGCAGGCCTCTCTGTAGG - Intronic
1171187569 20:23133743-23133765 GAGCCAGCAGCCAGCTCCTGTGG + Intergenic
1171351742 20:24507765-24507787 CAGGCAGCAGGGGCCTCCTGCGG + Intronic
1171410397 20:24943288-24943310 GACCCAGCAGGACCCACCTGGGG + Intergenic
1172020504 20:31910476-31910498 CAGCCAGGAAGAGCCTCCTGTGG - Intronic
1172216293 20:33238056-33238078 CAGACAGCAGGCCATTGCTGAGG - Exonic
1172582727 20:36061176-36061198 CAGCCTGCAGGCCCACACTGTGG + Intergenic
1173521650 20:43704433-43704455 CAGCCAGCAGCCCTCACTTGCGG - Intronic
1173730585 20:45325583-45325605 CAGACAACAGGCCCCAGCTGGGG + Exonic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1175339457 20:58218887-58218909 CAGGCAGCAGGACCTCCCTGAGG - Intronic
1175621245 20:60449278-60449300 CTGCCTGCACGCCACTCCTGGGG + Intergenic
1175625145 20:60483659-60483681 CACCCAGCAGACCCCACTTGGGG - Intergenic
1175722943 20:61298355-61298377 CAATCAGCAGGCCCCTCCAAGGG + Intronic
1175787845 20:61723330-61723352 CACCGGGCAGGCCCCTCCCGGGG + Intronic
1175841761 20:62032484-62032506 CAGACAGCAGGCGCTGCCTGTGG - Intronic
1176104157 20:63377838-63377860 GAGACAGGACGCCCCTCCTGGGG + Intronic
1176135414 20:63520233-63520255 CGGGCAGCAGGCGCGTCCTGGGG + Intergenic
1176145076 20:63561894-63561916 CAGCCCGGAGGCCCCCCCCGTGG - Exonic
1176161580 20:63651441-63651463 CAGCCTCCAGGGCCCTCCAGGGG - Intronic
1176177587 20:63735989-63736011 CAGCAGGCCGGCCCCTCCTCGGG - Exonic
1176267836 20:64220020-64220042 CAGCCAGCTTGCCCTGCCTGAGG + Intronic
1178285547 21:31322595-31322617 CAACAACCTGGCCCCTCCTGTGG + Intronic
1178908285 21:36653964-36653986 CACCCAGCAGGCCCAGGCTGGGG - Intergenic
1180229843 21:46420654-46420676 CAGCCAGCAGGTGCCGCCAGCGG - Intronic
1180854423 22:19037121-19037143 CAGCCAGTAGGGGACTCCTGTGG + Exonic
1181006853 22:20017533-20017555 CACCCTGCAGGCCCCCCATGGGG + Intronic
1181052893 22:20246090-20246112 CAGCCAGCAGGGCCATCCTCCGG - Intronic
1181929051 22:26384671-26384693 CAGAGAGCAGCCCACTCCTGAGG + Intergenic
1182349717 22:29692500-29692522 CAGCCAGCATGCTCCTCGGGTGG + Intronic
1182484159 22:30629290-30629312 CAGCCAGCAGGACTCTCAAGAGG - Intergenic
1183063129 22:35347480-35347502 CAGCCAGCCAGCCTGTCCTGGGG - Exonic
1183079475 22:35447295-35447317 CAGGCAGCAGAACCCTCATGTGG - Intergenic
1183367758 22:37416333-37416355 CACCCAGCAGGCACGTTCTGGGG - Intronic
1183453893 22:37911116-37911138 CAGCCAGCTGTCCCGTGCTGGGG + Intronic
1183605857 22:38866454-38866476 CAGCAAGCGGGCACCGCCTGAGG - Exonic
1183737279 22:39650962-39650984 CAGTCCACAGGCCCCACCTGGGG + Intronic
1183742759 22:39677865-39677887 CAGTCTGCAGGCCCCTCCTAGGG + Intronic
1184034993 22:41914025-41914047 CTCCCAGCAGGCCCCTTCTCTGG - Intronic
1184100661 22:42340365-42340387 CAACCAGCAGTCCCTTCCCGCGG + Intronic
1184450051 22:44577392-44577414 CAGGCAGTAAGCCCCTCATGGGG - Intergenic
1184784707 22:46666037-46666059 CAGCCAGCAGGAACCTTCCGGGG - Intronic
1184855567 22:47144680-47144702 CAGCCAGCAGGCACCTTCACGGG - Intronic
1184855577 22:47144724-47144746 CAGCCAGCAGGCACCTTCACGGG - Intronic
1184855587 22:47144768-47144790 CAGCCAGCAGGCACCTTCACGGG - Intronic
1184855597 22:47144812-47144834 CAGCCAGCAGGCACCTTCACGGG - Intronic
1184855607 22:47144856-47144878 CAGCCAGCAGGCACCTTCACGGG - Intronic
1184855617 22:47144900-47144922 CAGCCAGCAGGCACCTTCACGGG - Intronic
1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG + Intronic
1185337775 22:50278438-50278460 CAGCCAGCAGGACCTGCCTGGGG - Exonic
950486648 3:13277938-13277960 CTCCCGGCAGGACCCTCCTGAGG + Intergenic
950520439 3:13494842-13494864 AAGCCATGAGGCCCCTGCTGGGG + Intronic
951745754 3:25975376-25975398 GAGGCAGCAGGTCCCTGCTGTGG - Intergenic
952115283 3:30171791-30171813 TAGTCAGCAGGCTGCTCCTGTGG - Intergenic
953431811 3:42846227-42846249 CATCCAGGAAGCCCTTCCTGAGG - Intronic
954150847 3:48656349-48656371 CAGCTCGCAGTCCTCTCCTGGGG + Exonic
954394719 3:50287448-50287470 CAGCCTCCTGGCTCCTCCTGTGG + Exonic
954419464 3:50411013-50411035 CATCCAGAACTCCCCTCCTGAGG + Intronic
954619213 3:51986179-51986201 CAGCCTGCTGGCCCTGCCTGTGG + Intronic
954700200 3:52446875-52446897 CAGCCTGCCAGCCCATCCTGGGG + Intergenic
957314821 3:78563729-78563751 TAGCCAGCAAGGCCCTCCTAGGG + Intergenic
960958277 3:123050598-123050620 TAGCAAGCAGGCCCCTCCCCTGG + Intergenic
961450349 3:126999705-126999727 CAGCCAGCAGGGCCAGCCTGGGG + Intronic
961814636 3:129543182-129543204 CAGCCAGCAGACCCCTCACCCGG - Intergenic
962712740 3:138101439-138101461 CTCCCAGCCTGCCCCTCCTGCGG - Intronic
962753716 3:138452609-138452631 CATCCAGCAGGAGCCTCCTTGGG - Intronic
963341142 3:144035273-144035295 CAGCCAGCAGGCCCAACTTGAGG - Intronic
965319788 3:167239092-167239114 CAGCCTGCAGGCCAGCCCTGTGG - Intergenic
965711831 3:171563453-171563475 CAGCCTGGAGGCTCCCCCTGGGG + Intergenic
966015349 3:175132451-175132473 CAGCCAGCCGCCCCGTCCGGAGG - Intronic
967877691 3:194277941-194277963 CAGGCAGCCGGCCCCCCATGAGG + Intergenic
968438714 4:610508-610530 CAGCCTGGAGGCCTTTCCTGGGG - Intergenic
968490641 4:889019-889041 CAGCCAGCAACCCGCACCTGGGG - Intronic
968577840 4:1376220-1376242 GAGCCGGCAGCCCCCTCCTCAGG - Intronic
968592648 4:1466551-1466573 CAGACCCCAGGCCCCACCTGGGG + Intergenic
968620827 4:1602810-1602832 CTGCCCTCAGACCCCTCCTGGGG - Intergenic
969235405 4:5862042-5862064 CAGCAAGCAGGTCCCAGCTGGGG + Intronic
969586245 4:8095678-8095700 CAGCCAGCATGATCTTCCTGAGG + Intronic
969683448 4:8656034-8656056 CAAGCAGCAGGCCCGTCCTGGGG - Intergenic
969703502 4:8780318-8780340 CAGCCAGCTGGGTCCTGCTGCGG + Intergenic
975510994 4:75193761-75193783 CAGCCTCCAGGTGCCTCCTGAGG + Intergenic
977696449 4:99971570-99971592 CAGCCCCCAGGTACCTCCTGGGG + Intergenic
977975922 4:103267131-103267153 GAGCCACCAGGCCCAGCCTGGGG - Intergenic
978596138 4:110379420-110379442 CAGTCTGCTGGCCTCTCCTGAGG + Intronic
982435715 4:155382262-155382284 CAGCAAGCGGGTCCCTTCTGAGG - Intergenic
985818126 5:2141789-2141811 CACCCAGGTGCCCCCTCCTGGGG - Intergenic
992615630 5:78543587-78543609 CAGCCAGAAGGCCAGGCCTGGGG - Intronic
994079115 5:95686683-95686705 GAGACTGCAGGACCCTCCTGGGG + Intronic
995312181 5:110726441-110726463 CAGATAGCAGGCCCAGCCTGGGG + Intronic
997358799 5:133281276-133281298 CAGTCAGCAGGGACCTTCTGAGG - Intronic
997359518 5:133285823-133285845 TAGCCTGCAGGCCCATCCTGAGG - Intronic
997461931 5:134058764-134058786 GAGCAAGCAGGGCCTTCCTGAGG + Intergenic
999785462 5:154886050-154886072 CAGGCAGCAGCACCCTTCTGCGG + Intergenic
1000518388 5:162269026-162269048 CAGCCAGCAGGGGCAACCTGCGG + Intergenic
1000811544 5:165869013-165869035 CTGCCAGCAGTCCCCTCATGTGG - Intergenic
1001579501 5:172789292-172789314 TAGCCACCAGGCCCCGCCTCTGG + Intergenic
1001596365 5:172901359-172901381 CAGGGAGCAGGCCCCTCCTCAGG + Intronic
1001695208 5:173664727-173664749 CAGACATTAGGCCACTCCTGTGG + Intergenic
1002201405 5:177530799-177530821 CTGCCAGGAGGGCCCTCCTGAGG + Intronic
1002660048 5:180785670-180785692 CGTCCTGCAGGCCCCTCCTCAGG + Intergenic
1002885484 6:1290092-1290114 CCCCCAGCACGCCCCTCCTTTGG + Intergenic
1003004555 6:2368965-2368987 CAGTGAGCAAGACCCTCCTGAGG - Intergenic
1003384335 6:5653585-5653607 GAACAAGCAGGCCCCTCCTGGGG + Intronic
1004671878 6:17804854-17804876 CAGCAAACAGGCCCCTCCCATGG - Intronic
1006229072 6:32566781-32566803 CTGCCAGCAGACTCATCCTGGGG + Intronic
1006346275 6:33485704-33485726 CAGCCAGCCGCCCCGTCCGGGGG - Intergenic
1006364709 6:33608554-33608576 CACACAGCAGGCCCCCACTGAGG + Intergenic
1007176130 6:39898907-39898929 CCGCTCTCAGGCCCCTCCTGAGG - Exonic
1007375020 6:41450721-41450743 CTCCCACCAGGCCCTTCCTGCGG - Intergenic
1008534358 6:52495896-52495918 AAGCCAGCAGGCCATTTCTGTGG + Intergenic
1008716532 6:54295813-54295835 CTGTCTGCTGGCCCCTCCTGGGG - Intergenic
1013491500 6:110650806-110650828 CAGCAAGCAAGCCCTTCCTTGGG - Intronic
1013605029 6:111739473-111739495 CAGGCAGCAGGCAGCTCCAGTGG - Intronic
1016071233 6:139741595-139741617 AAGCCACCAGTCCCATCCTGGGG + Intergenic
1017587265 6:155940831-155940853 CTCTCACCAGGCCCCTCCTGGGG - Intergenic
1017772437 6:157653565-157653587 CAGCCAGCAGCACCCTCCAATGG + Exonic
1018188284 6:161286899-161286921 CAGCCAGCATGCTCCTGCTGCGG - Intergenic
1018907200 6:168082467-168082489 CGGACAGCAGGGACCTCCTGGGG - Intergenic
1019039740 6:169093978-169094000 GAGCCAGCAGCCCCTCCCTGGGG - Intergenic
1019101647 6:169635444-169635466 GACCCAGCGGCCCCCTCCTGCGG - Intronic
1019267012 7:123387-123409 CAGCCAGCATTCCCCTGCTGGGG + Intergenic
1020101241 7:5395324-5395346 CAGACAGCAGGCCCCACCCCGGG + Intronic
1021515595 7:21481233-21481255 CAGACATCTTGCCCCTCCTGGGG + Intronic
1022935351 7:35169645-35169667 CATCATGCAGGCCCCACCTGTGG + Intergenic
1023027302 7:36062297-36062319 CAGCAAGCTGGCTCCTGCTGCGG + Intergenic
1023289728 7:38656630-38656652 CTCCCAGCCTGCCCCTCCTGTGG + Intergenic
1023583495 7:41705586-41705608 GAGCCAGCCGGCCCCTCCGCAGG - Intergenic
1024012243 7:45278851-45278873 CAACCAACAGGTCCCTCCAGTGG - Intergenic
1025007670 7:55366589-55366611 CAGCCTCCAGGCCACTTCTGAGG - Intronic
1025212166 7:57026004-57026026 GAGACAGCAGCCACCTCCTGGGG - Intergenic
1025659788 7:63550824-63550846 GAGACAGCAGCCACCTCCTGGGG + Intergenic
1025811798 7:64880395-64880417 TCGCCAGGAAGCCCCTCCTGGGG - Intronic
1026263850 7:68779139-68779161 GAGCCACCAGGCCCCGCCAGAGG + Intergenic
1026506653 7:70990258-70990280 TAGCGTGCAGGCCCCTCCTCTGG - Intergenic
1026712234 7:72752221-72752243 CAGCCTGCAGCCCCCTCAAGTGG - Intronic
1028918679 7:96287546-96287568 CAGCCAGCAGGACTATACTGGGG - Intronic
1029253163 7:99251200-99251222 CAGCCAGGGGGCCTCTCATGTGG - Intergenic
1029473673 7:100770111-100770133 CAGCCAGCAGTCACCTTCTTGGG + Intronic
1029831305 7:103262421-103262443 CATCATGCAGGCCCCACCTGTGG + Intergenic
1033821101 7:145134758-145134780 ATGCCAGGATGCCCCTCCTGTGG + Intergenic
1034267547 7:149788561-149788583 CTCCAAGCAGGCTCCTCCTGAGG - Intergenic
1034366243 7:150551123-150551145 CAGCCCTCAGGTACCTCCTGGGG + Intergenic
1034531079 7:151696893-151696915 CAGACAGAAGGCCGCTCCTTAGG + Intronic
1035259579 7:157652971-157652993 GGGCCAGGAGGCCCTTCCTGTGG + Intronic
1035609091 8:948472-948494 CACCCAGCAGGCGCCTGGTGTGG - Intergenic
1035609350 8:949591-949613 CAGCGGGGAGGCCCGTCCTGGGG - Intergenic
1035733814 8:1873190-1873212 CATCCCACAGGGCCCTCCTGCGG - Intronic
1035992865 8:4511339-4511361 AAGCCTGCATGCCCCTCCTCTGG - Intronic
1037636598 8:20705795-20705817 CAGACAGGAGGCCCCTCCATAGG + Intergenic
1037856383 8:22374209-22374231 CAGCCAACAGGCCCCTCGCCAGG - Intronic
1037892770 8:22632349-22632371 CAGCCCGGAGCACCCTCCTGGGG + Intronic
1038488440 8:27952559-27952581 CAGCCAGCAAGACCTTCCTGTGG + Intronic
1038955965 8:32469126-32469148 CAGCCAACATCCCCCTCCTTTGG + Intronic
1042727144 8:71890396-71890418 GAGCCACTGGGCCCCTCCTGAGG + Intronic
1045402624 8:101834315-101834337 CAGCTTGCAGGCCATTCCTGGGG - Intronic
1046383004 8:113474737-113474759 CAGCCAGCTTGGCCATCCTGTGG + Intergenic
1047180699 8:122585017-122585039 CAGCCAGCAGGGCCCTAGAGAGG - Intergenic
1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG + Intronic
1047496964 8:125415370-125415392 AAGCCAGCACTCCCCTCCAGCGG - Intergenic
1047501906 8:125448252-125448274 CAGCGAGAAGGCCTCTTCTGAGG + Intergenic
1047961570 8:130015711-130015733 CAGCCTGCAGGGCTTTCCTGGGG - Intronic
1048325246 8:133434192-133434214 CTGCCAGGCAGCCCCTCCTGGGG - Intergenic
1049014856 8:139913053-139913075 CAGCCAGCAGGCAGCTCCCTGGG + Intronic
1049230707 8:141479841-141479863 CAGCCATCAGGCTCAGCCTGTGG + Intergenic
1049296450 8:141842944-141842966 CAGACAGCTGGCTCCTCCAGGGG - Intergenic
1049319710 8:141989581-141989603 CAGCCAGCAGCCCCTTCCTTGGG + Intergenic
1049425511 8:142536281-142536303 GGGCCAGCAGCCACCTCCTGTGG - Intronic
1049462052 8:142734817-142734839 CAGGCTCCAGGCCACTCCTGAGG - Intronic
1049991520 9:996126-996148 CAGCCAGCAGGCTGCTAGTGAGG - Intergenic
1051059314 9:13027793-13027815 GAGCCTGCAGAACCCTCCTGTGG + Intergenic
1053542995 9:38993923-38993945 CAGTCTGCTCGCCCCTCCTGGGG - Intergenic
1054965870 9:71026332-71026354 CAGCCACCTGGTACCTCCTGGGG + Intronic
1055597455 9:77880146-77880168 CTCACAGCAGGTCCCTCCTGGGG - Intronic
1056788019 9:89606234-89606256 CCGCCACCGGGCCCCTCCTCGGG - Exonic
1057214542 9:93220639-93220661 CAGCCCCCAGCCCCCTCCTCAGG - Intronic
1057299068 9:93865965-93865987 CAGACAGCGGGACCCTCATGGGG + Intergenic
1057905032 9:98976680-98976702 CAGCCAGCAAACACTTCCTGAGG + Intronic
1057907733 9:98995271-98995293 CAGACAGCAGGCACCTCCCCAGG - Intronic
1058890579 9:109357325-109357347 CAGCCAGCAGGAGCTTGCTGTGG - Intergenic
1060976183 9:127766512-127766534 CTCCCACCATGCCCCTCCTGGGG + Intronic
1061057480 9:128232229-128232251 CAGCCACCAGGCCTCCTCTGAGG - Intronic
1061588612 9:131584040-131584062 CACCCAGCAGGCCCATCCCTGGG - Intronic
1061791959 9:133063708-133063730 CAACCTCCAGGCCCCTCGTGGGG + Intronic
1061952548 9:133944406-133944428 TAGCCAGCAGGCCTCAGCTGGGG + Intronic
1061964452 9:134005124-134005146 AAGCCAGCAGGTCCCTCCTGGGG - Intergenic
1062012885 9:134276281-134276303 CAGCCAGTGGGCACCTCCTGGGG - Intergenic
1062275467 9:135728411-135728433 CCACCCGCAGGCCCCTCCTTGGG + Intronic
1062346113 9:136116066-136116088 CAGCCAGGAGGGCCCCCCTCCGG + Exonic
1062374030 9:136253989-136254011 GACCCTGCAGGCTCCTCCTGGGG - Intergenic
1062461127 9:136662988-136663010 CCGCCTGGAGGCACCTCCTGAGG - Intronic
1062520028 9:136953945-136953967 CACCCAGCAGGCTGATCCTGAGG - Exonic
1062578130 9:137217965-137217987 CAGCCAGTGAGCCCCTGCTGGGG + Intergenic
1062623681 9:137433714-137433736 CACCCAGGAGGCCCCCTCTGAGG + Intronic
1062657493 9:137611840-137611862 TCCCCAGCAGGCCCCACCTGTGG - Intronic
1186703617 X:12118425-12118447 CAGCCAGCAGTCGCCTGCTGCGG - Intergenic
1189893699 X:45632248-45632270 CTCCCAGCCTGCCCCTCCTGCGG - Intergenic
1190110096 X:47583707-47583729 CAGCCAGCATGCAGATCCTGTGG - Intronic
1191220841 X:57986150-57986172 CTCCCAGCCTGCCCCTCCTGCGG + Intergenic
1192053017 X:67744595-67744617 CAGGGAGCTGGGCCCTCCTGTGG - Intergenic
1192766600 X:74146454-74146476 CAGCCCCCAGGTACCTCCTGGGG + Intergenic
1195210771 X:102651280-102651302 CAACCCGCAGGCCCCGGCTGGGG + Intergenic
1195544586 X:106100682-106100704 CAGCCTCCAGGTACCTCCTGAGG - Intergenic
1197610930 X:128637411-128637433 CAGCAAGAAGGCACCACCTGTGG - Intergenic
1197772219 X:130096466-130096488 CAGCCACCATGCCCTGCCTGGGG + Intronic
1199136994 X:144265685-144265707 CAGTCTGCTGGCCCATCCTGGGG + Intergenic