ID: 936017645

View in Genome Browser
Species Human (GRCh38)
Location 2:108971922-108971944
Sequence GCTGCTGCTCAGTCACATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936017638_936017645 16 Left 936017638 2:108971883-108971905 CCAGGTCACCAAAGGCACTGAGC 0: 1
1: 0
2: 0
3: 17
4: 153
Right 936017645 2:108971922-108971944 GCTGCTGCTCAGTCACATAGGGG 0: 1
1: 0
2: 0
3: 11
4: 150
936017639_936017645 8 Left 936017639 2:108971891-108971913 CCAAAGGCACTGAGCTTCCTGCT 0: 1
1: 0
2: 2
3: 30
4: 238
Right 936017645 2:108971922-108971944 GCTGCTGCTCAGTCACATAGGGG 0: 1
1: 0
2: 0
3: 11
4: 150
936017641_936017645 -9 Left 936017641 2:108971908-108971930 CCTGCTGTGCCGTGGCTGCTGCT 0: 1
1: 0
2: 6
3: 34
4: 305
Right 936017645 2:108971922-108971944 GCTGCTGCTCAGTCACATAGGGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936017645 Original CRISPR GCTGCTGCTCAGTCACATAG GGG Intronic
900411139 1:2513252-2513274 CCCACTGCTCAGTCACATGGGGG - Intronic
900632822 1:3646189-3646211 GCTGCTACTGAGTCAGATAAGGG - Intronic
902175023 1:14642984-14643006 GCAGCTGCTGAGTCACATGGTGG - Intronic
902447932 1:16478836-16478858 CCTGCTACACAGTCACATGGTGG + Intergenic
905928427 1:41768738-41768760 GCTTCTGGTCATTCACAGAGAGG + Intronic
908207834 1:61869534-61869556 CTTGCTGCTTAGTCACATAAGGG + Intronic
910347366 1:86255402-86255424 GATGCTTCTGAGTCACAGAGGGG + Intergenic
915981853 1:160425368-160425390 GCTGTTGCACAGTCACACTGAGG - Exonic
917341573 1:173984604-173984626 GCTGCTGCTCAGGGACCTGGAGG + Exonic
919197505 1:194307118-194307140 GCTGCTGCTCAGAGATATGGGGG - Intergenic
920179342 1:204122906-204122928 GCTGCTGCACAGCCACAGTGGGG + Exonic
1063362658 10:5470351-5470373 GCTGCTGCTCTGTCACCTCCAGG - Intergenic
1067309353 10:45097636-45097658 GCTGCTGCTATGTCACTGAGTGG + Intergenic
1069540993 10:69293769-69293791 ACTGGGGCTCATTCACATAGTGG + Intronic
1071208507 10:83311862-83311884 GATGGTGCTCAGTCACATTGAGG - Intergenic
1071978541 10:90979322-90979344 GCTGCTGCACATTTCCATAGAGG - Intergenic
1076305267 10:129461637-129461659 GCTGCTGATCAGACAGATGGAGG + Intergenic
1076430420 10:130398212-130398234 CCTGCTGCTCAAACCCATAGGGG + Intergenic
1076651614 10:131993207-131993229 GATGCTGCTCAGCCATAAAGAGG - Intergenic
1078447711 11:11416978-11417000 GCTGCAGAGGAGTCACATAGAGG - Intronic
1084561736 11:69909457-69909479 GCTGCTGGTCAGTGACAGAGTGG + Intergenic
1085651229 11:78270408-78270430 GCTGCTTCTAAGTCACAAAACGG - Intronic
1086052988 11:82616063-82616085 ACTGCCTCTCAGTCACATTGTGG + Intergenic
1086667352 11:89499235-89499257 GCTGCAGCTCAGTGAACTAGAGG + Intergenic
1087239248 11:95757068-95757090 GCTGCTGCCCAATCAGACAGTGG - Intergenic
1087370580 11:97279190-97279212 GCTGCTGCTGAGGGACATGGGGG - Intergenic
1087408175 11:97755169-97755191 GATGCTGCTCACCCACAGAGAGG + Intergenic
1087524911 11:99297296-99297318 GCTGCTTCTCAGTAGCAAAGGGG + Intronic
1089660142 11:119980389-119980411 GCCGCCGCTCAGACACAGAGGGG - Intergenic
1096871290 12:54594012-54594034 TCTGCTCCCCAGTCACCTAGAGG - Intergenic
1101001626 12:100363119-100363141 ACTGCTGCTCAGTCACTTTGGGG - Intronic
1101194084 12:102364945-102364967 GATACTGGTCAGTCACATGGTGG + Intergenic
1102282650 12:111630518-111630540 GATGCTGCAGAGTCACATTGTGG + Intergenic
1103143843 12:118576767-118576789 GCTGCTCCTCTATCACAAAGTGG - Intergenic
1104070067 12:125336843-125336865 GCTGCTTCCCAATCACACAGTGG + Intronic
1104681007 12:130751899-130751921 GATGCTGCTCAGACACATTGGGG - Intergenic
1104877572 12:132046644-132046666 GCGGCTGGTCAGTAACATACAGG + Intronic
1107977392 13:45703470-45703492 ACTGCTGCTATGTCACAAAGGGG + Intronic
1110380542 13:74845082-74845104 GATGGTGCTCATTCACATTGAGG + Intergenic
1110486055 13:76044067-76044089 ACTGCTGCTCACTCACAAAGAGG - Intergenic
1119293175 14:73512139-73512161 ACTGCGGCTCAGTCATAGAGTGG - Exonic
1121556327 14:94840492-94840514 ACTGCTGCTCAGACCCTTAGAGG - Intergenic
1121634953 14:95447643-95447665 GCTTGTGTTCAGTCACACAGAGG + Intronic
1121775236 14:96586203-96586225 GCTGCTGCTCAGTCTGAGAGAGG + Intergenic
1122987332 14:105218523-105218545 TCTCCTGCTCAGTCACTCAGAGG + Intronic
1125726822 15:41872363-41872385 GCTGCTGCTCAGGGACTTCGGGG + Exonic
1126717944 15:51541818-51541840 AATACTTCTCAGTCACATAGGGG + Intronic
1132212651 15:100035928-100035950 GCTACTGCTCAGAGACATAGGGG + Intronic
1132384142 15:101387961-101387983 GCTCCTCCTCAGACACATACAGG - Intronic
1137489842 16:48923228-48923250 CCTGCTCCTCTGTCACACAGCGG - Intergenic
1137621898 16:49881686-49881708 TCTGCTTCCCAGGCACATAGCGG - Intergenic
1139581936 16:67878959-67878981 GCAGCAGCTCCATCACATAGAGG - Exonic
1140016891 16:71196317-71196339 GATGCTGCTCACTCATATTGGGG - Intronic
1142218080 16:88839640-88839662 GCGGCTGCTCAGTCAGGTGGGGG - Intronic
1143132904 17:4691749-4691771 GGTGCTGCCCAGACATATAGAGG - Intronic
1145217887 17:21065967-21065989 CCTGCTGCTCTGCCACACAGTGG + Intergenic
1147684941 17:42281591-42281613 GCTGGTGCTTTGTCACATGGAGG + Intergenic
1147741541 17:42673398-42673420 GCTACTGCTCAGGGACATACAGG - Exonic
1147745627 17:42692710-42692732 GTTGCTGCTTACCCACATAGAGG - Exonic
1148331224 17:46815043-46815065 ACTGGTCCTCAGTCACACAGCGG + Intronic
1150294193 17:63999011-63999033 GCTGCTGCTGAGTCGCCTGGTGG + Exonic
1152298110 17:79480160-79480182 GCTGCTTCTCTGTCCCATACAGG + Intronic
1152434742 17:80269167-80269189 GATGCTGCCCACCCACATAGAGG + Intronic
1152493116 17:80651194-80651216 GCTGCTTCTAAGTCAGAAAGTGG + Intronic
1154389409 18:13923563-13923585 GCCACTGCTCAGTGACACAGGGG - Intergenic
1157929812 18:51809286-51809308 GCTGCTGCTGAGTCACAATAAGG - Intergenic
1158449726 18:57553406-57553428 CCTGCTGCCCAGTCCCAGAGAGG + Intronic
1159359548 18:67382078-67382100 GCCGCTGCTCAGACACACACGGG - Intergenic
1159456369 18:68664202-68664224 GCTGCTTCTCAGTCAGATTTTGG + Intergenic
1160221041 18:76978040-76978062 GCTGCTGCTGAGACACGGAGGGG + Intergenic
1160505879 18:79426669-79426691 GCTGCAGCTGAGTCACAGGGGGG - Intronic
1162418567 19:10552892-10552914 GCTCCTCCTCAGCCACAGAGCGG + Exonic
1163817345 19:19474988-19475010 TGTGCTAGTCAGTCACATAGCGG + Intronic
1165121920 19:33565388-33565410 GATGCAGCTCACTCACACAGTGG + Intergenic
1168144180 19:54410421-54410443 GCTCCTTCTCAGTCTCATTGTGG + Intergenic
929383821 2:41381939-41381961 GCTGCTGCACAGAGACATAAGGG - Intergenic
929780284 2:44952794-44952816 GCTTCAGCTCAGACACACAGGGG - Intergenic
930166303 2:48206820-48206842 TCTGCTGCTAAGTGCCATAGTGG - Intergenic
934713337 2:96529435-96529457 GCTGCTGGCCAGTCACACAATGG + Intergenic
934919107 2:98327978-98328000 GATGTTGCTCAGTAGCATAGTGG - Intergenic
936017645 2:108971922-108971944 GCTGCTGCTCAGTCACATAGGGG + Intronic
938110067 2:128558338-128558360 GTTTCTGCTCAGTCACTTTGAGG + Intergenic
938613892 2:132977933-132977955 GGTGCTTCTTTGTCACATAGTGG + Intronic
939719301 2:145628062-145628084 GCTGCTGCTCAGCCAGATTTGGG - Intergenic
941059302 2:160827477-160827499 GCTTCAGCTCAGGCACAGAGGGG + Intergenic
944010355 2:194966921-194966943 ACTGCTGCTCAGCCACCTACAGG + Intergenic
945049132 2:205806805-205806827 GCAGAGGCTCAGTCACAAAGAGG - Intergenic
946248869 2:218401237-218401259 GCTGCTGATCAGCCCCATTGCGG - Intronic
946354007 2:219173451-219173473 CCTGCTGCTCAGCCACACTGGGG + Exonic
948227352 2:236321696-236321718 GCTCCTGCTCTGTCACACATGGG - Intergenic
948541666 2:238695359-238695381 GCTGCTGGTCAGCCCCACAGAGG - Intergenic
1168757297 20:326209-326231 GCTGCGGCTCAAGCACATGGCGG + Exonic
1170200370 20:13737104-13737126 GTTGTTTTTCAGTCACATAGTGG - Intronic
1170612539 20:17926347-17926369 GCTGGAGCTCAGTCTCATGGGGG - Intergenic
1170974542 20:21150028-21150050 CCTGGTGCTCAGTCCCATTGGGG + Intronic
1173265539 20:41476359-41476381 ACTCCTGGCCAGTCACATAGAGG - Intronic
1174396473 20:50250067-50250089 GGTGCCGCTGAGTCACATGGAGG - Intergenic
1175848517 20:62073101-62073123 GATGGTGCTCACTCACATTGAGG - Intergenic
1176124171 20:63468029-63468051 GATGCTGCTTAGTTACACAGTGG - Intronic
1181628875 22:24140049-24140071 GGTGCTGCTCAGCCAGAAAGGGG + Intronic
1183638707 22:39080556-39080578 ACTGCTGCTCCGTGACATGGGGG + Intronic
949725113 3:7035088-7035110 GCAGCTGCTTAGTCCCAAAGAGG - Intronic
951343946 3:21523036-21523058 GCTGCTATTCTGTCACACAGTGG + Intronic
952214412 3:31262564-31262586 GCAGCTGCACAGTCACATGTTGG - Intergenic
957538232 3:81533513-81533535 CATGCTGCTCAGTGACATTGAGG - Intronic
958420405 3:93923962-93923984 GCTGATGCTCAGTTATATTGAGG - Intronic
959786916 3:110310390-110310412 GAAGCTGCTCAGTCACTTAAGGG - Intergenic
962264484 3:133935397-133935419 CCTGCTGCTCAGAGACAGAGGGG - Intronic
963521870 3:146365898-146365920 GCTGCTGCACAGAGACATAATGG - Intergenic
965067166 3:163864514-163864536 CCTGCTGCTCAATCCCGTAGGGG - Intergenic
965404580 3:168253433-168253455 ACTACTGCTGAGTCACAAAGTGG - Intergenic
965771108 3:172181872-172181894 ACTGCTGCTCACTCACTGAGTGG + Intronic
967613036 3:191530909-191530931 ACTACTGCTCAGTTATATAGAGG - Intergenic
967969811 3:194990676-194990698 ACAGGTGCTCAGTCACAGAGAGG + Intergenic
968708165 4:2093310-2093332 GAAGCTGCTCAGTCACTTGGAGG + Intronic
971488959 4:27191063-27191085 GCTCCAGCACAGCCACATAGTGG - Intergenic
976659846 4:87529221-87529243 TCTGCTGCTCTGTCAACTAGTGG + Exonic
979337098 4:119475900-119475922 GCTGCTACACAGTCACTTTGGGG - Intergenic
979536475 4:121826592-121826614 GCTGCTACTCAGTCCCCTTGGGG - Intronic
980723116 4:136722538-136722560 GCTGTTGATAGGTCACATAGAGG - Intergenic
984538810 4:181011399-181011421 GCTTCTGCTCAGTAAAATTGTGG - Intergenic
984790049 4:183607116-183607138 CCTGCTGCTCAGACCCCTAGGGG + Intergenic
984921091 4:184765156-184765178 GGTGGTGACCAGTCACATAGGGG - Intronic
987071794 5:14344205-14344227 TCTAATGCTCAGTCACACAGGGG - Intronic
989001737 5:36768035-36768057 GTTGCTTCACAGTTACATAGAGG + Intergenic
992782493 5:80140852-80140874 GCTGCTGGTCAGACACATTTAGG - Exonic
997148264 5:131461979-131462001 GCTGCAGCTCAGTACCATTGAGG - Exonic
997819620 5:137053199-137053221 GCTGCTGCTCAGGGACAAGGAGG + Intronic
998722000 5:144963154-144963176 GTTGCTGGTAAGTCACATAAGGG - Intergenic
1000426208 5:161093815-161093837 CCTGCTGGTCAGTCACAGGGTGG - Intergenic
1002564905 5:180105947-180105969 GCTGCCTATCAGTCACTTAGTGG - Intronic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1005952623 6:30642892-30642914 GCTCCTGCTCTGGCACAAAGGGG - Exonic
1006255961 6:32832521-32832543 TTTGCAGCTCAGTCTCATAGAGG - Intronic
1007923662 6:45633540-45633562 GCTGCTGCAGATTCACATAATGG + Intronic
1010252188 6:73719201-73719223 AAAGCTGCTCAGTCACATACAGG - Intronic
1011794183 6:90934761-90934783 GCTGCTGTTCAGTTAAAGAGAGG + Intergenic
1014764471 6:125390852-125390874 GCTTCTGCTCAGTCAGATATTGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1023180296 7:37475555-37475577 GATGGTGCCCAGTCAGATAGAGG + Intergenic
1025849683 7:65235828-65235850 GCTGCTGCTCAACCAGATGGTGG - Intergenic
1027343275 7:77232631-77232653 GCTCCTGCTCAGTAACACAGAGG - Intronic
1032316240 7:130841660-130841682 GCTGCTGCTCAAACATCTAGGGG + Intergenic
1036104220 8:5823089-5823111 GCTGGTGCACAGACTCATAGAGG - Intergenic
1037739989 8:21601105-21601127 GCTGCAGTTCAGCTACATAGTGG + Intergenic
1040602311 8:48897049-48897071 CCTGCTGCTCAGGCCCCTAGGGG + Intergenic
1041250853 8:55933852-55933874 GCTGCTGCCCCTTCACATTGTGG + Intronic
1041992355 8:64008600-64008622 GCTGCTGCTCACTTCCAAAGTGG + Intergenic
1042437379 8:68783230-68783252 GCTGCTGCTCACTGAAATAGAGG + Intronic
1043879311 8:85523983-85524005 GCTGCTGCTCGGTGACATCTCGG - Intergenic
1044632327 8:94291835-94291857 GCTGGTGATGAGTCACATGGAGG - Intergenic
1045172010 8:99681756-99681778 ACTGCTGCTCAGTGACTGAGAGG + Intronic
1047212455 8:122850910-122850932 GCTGCAGCACAGTGACAGAGGGG - Intronic
1048266975 8:132996005-132996027 GCTGCAGCTGAGTCATATGGAGG + Intronic
1049721441 8:144117456-144117478 GCAGCTGCTGGGTCACAGAGTGG + Exonic
1052067918 9:24045502-24045524 GCTGGAGCTCATTCTCATAGTGG + Intergenic
1186166021 X:6826927-6826949 GCTGCTGAACAGTCTCAGAGGGG - Intergenic
1191108140 X:56784910-56784932 GCTGCTGCCCAGGCACTGAGCGG - Intergenic
1193695598 X:84703883-84703905 ACTGCAGCACAGTCACATGGTGG + Intergenic
1201143429 Y:11047349-11047371 GCTGCTGCCCAGGAACACAGAGG + Intergenic
1201438705 Y:13985863-13985885 GTTGCTGCTCAGGGAGATAGGGG + Exonic
1201445868 Y:14056845-14056867 GTTGCTGCTCAGGGAGATAGGGG - Exonic