ID: 936019679

View in Genome Browser
Species Human (GRCh38)
Location 2:108985384-108985406
Sequence GACCGTGAAGTGAGTTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936019677_936019679 7 Left 936019677 2:108985354-108985376 CCTACTGTGTTTGGAGCAGTAGG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 936019679 2:108985384-108985406 GACCGTGAAGTGAGTTAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 64
936019676_936019679 11 Left 936019676 2:108985350-108985372 CCTTCCTACTGTGTTTGGAGCAG 0: 1
1: 0
2: 2
3: 37
4: 277
Right 936019679 2:108985384-108985406 GACCGTGAAGTGAGTTAAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936019679 Original CRISPR GACCGTGAAGTGAGTTAAGC TGG Intronic
905414196 1:37793686-37793708 GCCAGTGAAGTGAGTAAAGGTGG + Intergenic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
922592573 1:226788674-226788696 GACCTTGAAGTGGAATAAGCAGG + Intergenic
1065565414 10:27002604-27002626 GACCCTGAACTGGGATAAGCAGG + Intronic
1065628789 10:27657019-27657041 GACCATTAAGTGAATTGAGCAGG + Intergenic
1065819828 10:29515595-29515617 GAAGGTGAAGTGAGAGAAGCTGG - Intronic
1065953089 10:30669290-30669312 GAAGGTGAAGTGAGAGAAGCTGG + Intergenic
1068233210 10:54198358-54198380 GACCTTGAAATGATTTAAGCAGG + Intronic
1070856719 10:79612476-79612498 GACCCTGAAGTCAGTTACACGGG + Intronic
1072330298 10:94342218-94342240 GACAGTGAAGTGAGTTACCTAGG - Intronic
1078157881 11:8814306-8814328 GTCAATGAAGTGTGTTAAGCAGG - Intronic
1080100869 11:28457835-28457857 GACAATGAAGTGAGGTGAGCTGG + Intergenic
1091162140 11:133433754-133433776 AACCCTGAAGTGGGTTAAGGGGG - Intronic
1091754717 12:3043859-3043881 GTCCTGGAAGTGTGTTAAGCAGG + Intergenic
1097597850 12:61656041-61656063 GACCTTGAAGTAAGTAAAGGAGG - Intergenic
1098917217 12:76269968-76269990 GGCAGTAAAGTGAGATAAGCCGG - Intergenic
1108684929 13:52810909-52810931 GACCTTGAATTGAGTTCTGCAGG - Intergenic
1108704154 13:52969941-52969963 TACTCTGAAGTGAGTTAAGTTGG + Intergenic
1114488344 14:23078667-23078689 GAGCTGGAAATGAGTTAAGCAGG + Intronic
1115777826 14:36735714-36735736 GCCCATGAATTGAGTAAAGCAGG - Intronic
1119709023 14:76807908-76807930 GACCCTGATGTGAGTGAAGAGGG - Exonic
1126556674 15:49995810-49995832 GACTGTCAAGTGGGTAAAGCAGG + Intronic
1137439692 16:48487507-48487529 GACCATGAAATGAGTTGAGAAGG - Intergenic
1139104754 16:63815314-63815336 GACCCTGAACTGAAATAAGCGGG - Intergenic
1139343470 16:66287067-66287089 CACAGTGAAGTGAGTGATGCTGG - Intergenic
1142389780 16:89791586-89791608 GAACATGACGTGAGTTATGCTGG + Intronic
1149161907 17:53704128-53704150 GAGCGTCAAGTGAGTGAAGTTGG + Intergenic
1149657635 17:58318736-58318758 GACTGTCAAGTGAGTGGAGCTGG + Intronic
1150831967 17:68530332-68530354 CCCCTTGAAGTGCGTTAAGCTGG + Exonic
1155130439 18:22929255-22929277 GACCCTGAAATGCTTTAAGCAGG + Intronic
1155993590 18:32306062-32306084 GACTGGAAAGTGAGTTAACCAGG - Intronic
1160208035 18:76853141-76853163 GAGGTTGAAGTGAGTTAAGATGG - Intronic
1165770898 19:38379587-38379609 GACTGTGCAGTGAGCCAAGCAGG + Intronic
936019679 2:108985384-108985406 GACCGTGAAGTGAGTTAAGCTGG + Intronic
938307232 2:130264482-130264504 GGCCTTGATGTGAGTCAAGCTGG - Intergenic
940500583 2:154488783-154488805 AAACGTTAAGTGAGTTAACCAGG - Intergenic
940600605 2:155854638-155854660 GACCCTGAAGGATGTTAAGCAGG - Intergenic
943139784 2:183967874-183967896 GACCCTGAACTGAAGTAAGCGGG - Intergenic
944461033 2:199950762-199950784 GACCCTGAACTGAAATAAGCAGG + Intronic
948861768 2:240756001-240756023 GGCTGTGAGGTGAGATAAGCTGG - Intronic
948990955 2:241553786-241553808 GACCCTGAAGTGAGTTGTGTGGG - Intergenic
1170276773 20:14599943-14599965 GACTGTGAATTGAATTAAGGTGG + Intronic
1181322769 22:22021337-22021359 GACAGAGAAGTGAGTAAGGCTGG + Intergenic
951723616 3:25729741-25729763 GTCACTGAAGTGAGTTAAGCAGG - Intronic
964753285 3:160071704-160071726 GACCCTGAAGTGCAATAAGCAGG + Intergenic
969102427 4:4779088-4779110 GTCCTTGAAGTGAGTGGAGCTGG - Intergenic
972632344 4:40853298-40853320 GCCCGTGAAGAGGGTTAACCAGG - Intronic
977824699 4:101517203-101517225 GACCTTGAAGAGAGTAAGGCAGG - Intronic
984047614 4:174820604-174820626 GAATGTGAAATGAGTTAAACAGG + Intronic
991420673 5:66438185-66438207 GACCCTGAACTGAAATAAGCCGG - Intergenic
995720841 5:115130799-115130821 GACCGTGTAGAGAGTAGAGCTGG - Exonic
996312459 5:122122273-122122295 GGCCGTGAAGTGAGTCAGGCAGG + Intergenic
998052157 5:139044998-139045020 GAACATGAAGTGAGTGAAGAAGG - Intronic
999833222 5:155340937-155340959 GACCGGGAATTGGGTTAAGATGG - Intergenic
1010798342 6:80144653-80144675 GAGCGTGAATTAAGTTAATCTGG - Intronic
1014019228 6:116568358-116568380 GCCAGGGAAGTGAGTTAGGCTGG + Intergenic
1014778995 6:125541844-125541866 AACCTTTAAGTGAGTTAACCTGG + Intergenic
1018629583 6:165810446-165810468 GATGGTGAAGTGAATTAAGCAGG - Intronic
1022093146 7:27120929-27120951 GCCGGTGAAGTGAGTGAAGAGGG - Intronic
1022173759 7:27853542-27853564 GACCCTGAACTGAAATAAGCGGG + Intronic
1025970670 7:66321352-66321374 GACCCTGAAGTCAGTTGTGCAGG - Intronic
1044425578 8:92046204-92046226 TCCCCTGCAGTGAGTTAAGCTGG - Intronic
1048285480 8:133137966-133137988 GACTTTGAAGTGAGGTAGGCTGG + Intergenic
1048611839 8:136031309-136031331 TACTGAGAAGTGAGTTTAGCGGG - Intergenic
1050530127 9:6581347-6581369 GACAGGGAAGTGAGGAAAGCTGG - Intronic
1052478248 9:28989899-28989921 GACTGTGAAGTGAGCCAAGATGG + Intergenic
1056765981 9:89444788-89444810 GACCATAAAATGAGTTAATCTGG + Intronic
1058426985 9:104883785-104883807 GACCGTGATGTGAGTTAGGACGG - Intronic
1190461108 X:50676428-50676450 GGCTGTGAAATGAGTTAAGTCGG + Intronic
1197148033 X:123190320-123190342 GGCCGAGAAGTGAGCTAAGCCGG - Intronic
1199428902 X:147736255-147736277 AGCAGTTAAGTGAGTTAAGCTGG + Intergenic