ID: 936019693

View in Genome Browser
Species Human (GRCh38)
Location 2:108985457-108985479
Sequence GGCCGTAAGGAGCCCTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936019693_936019702 25 Left 936019693 2:108985457-108985479 CCTCTGTAGGGCTCCTTACGGCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 936019702 2:108985505-108985527 TTCTCGGAAATGGAAAACAAAGG 0: 1
1: 0
2: 0
3: 29
4: 388
936019693_936019700 15 Left 936019693 2:108985457-108985479 CCTCTGTAGGGCTCCTTACGGCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 936019700 2:108985495-108985517 GTCCTCTGTTTTCTCGGAAATGG 0: 1
1: 0
2: 0
3: 10
4: 129
936019693_936019698 9 Left 936019693 2:108985457-108985479 CCTCTGTAGGGCTCCTTACGGCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 936019698 2:108985489-108985511 TCCATAGTCCTCTGTTTTCTCGG 0: 1
1: 0
2: 0
3: 19
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936019693 Original CRISPR GGCCGTAAGGAGCCCTACAG AGG (reversed) Intronic
903364613 1:22798281-22798303 GTCCCTCAGGAGCCCTCCAGAGG - Intronic
903372510 1:22846047-22846069 GACCCTAAGGATCCCTGCAGAGG + Intronic
906185639 1:43860066-43860088 GGCAGAAAGAAGCCCTTCAGGGG - Intronic
906292920 1:44631741-44631763 GGGCGGAAGGAGCCCCGCAGCGG + Intronic
909399784 1:75214193-75214215 GGCTGTCAGGAGCCCTGCAGTGG + Intronic
910776928 1:90886303-90886325 GGAAGTAAGAAGCTCTACAGAGG - Intergenic
913660779 1:121004697-121004719 GGCAGTCAGCAGCCCTGCAGGGG + Intergenic
914012142 1:143787853-143787875 GGCAGTCAGCAGCCCTGCAGGGG + Intergenic
914165689 1:145173281-145173303 GGCAGTCAGCAGCCCTGCAGGGG - Intergenic
914650773 1:149696516-149696538 GGCAGTCAGCAGCCCTGCAGGGG + Intergenic
916301230 1:163276693-163276715 GGCCGTAAGCATCCCAACAAGGG + Intronic
920952771 1:210587861-210587883 GGCTGTTAGGAGACATACAGAGG - Intronic
1070961107 10:80500803-80500825 AGCGGTAAGCGGCCCTACAGCGG + Intronic
1071598644 10:86945352-86945374 GGCCGCAGGGAGCCCTACCGTGG + Exonic
1072817652 10:98525494-98525516 GGCCTAAGGGAGCCCCACAGTGG + Intronic
1077121831 11:912432-912454 GGCCGTTGGGAGCTCTGCAGAGG - Intronic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1085047753 11:73363283-73363305 GGCCCAAAGGAGCCAGACAGTGG - Exonic
1095944189 12:47744838-47744860 GGCAGTAAGGAACTCTGCAGGGG - Intronic
1102567447 12:113805848-113805870 GGCAGTGACAAGCCCTACAGAGG + Intergenic
1113672649 13:112185400-112185422 GGCAGTAAGGAGCCCCTCAGTGG - Intergenic
1115264454 14:31486679-31486701 GGATGTTAGGAGCCCTACAGAGG + Intronic
1121201521 14:92121998-92122020 GGCCGGCAGAAGCCCCACAGTGG - Exonic
1129678311 15:77644038-77644060 GGCACTCAGGAGCCCTCCAGGGG + Intronic
1133009719 16:2904463-2904485 GGCCGTAAGGAGCCCGGGTGGGG - Intergenic
1136287794 16:29254446-29254468 GGCCGCAGGGATCCCTGCAGTGG - Intergenic
1137072093 16:35912450-35912472 GGCAGTAAGGACCCCAGCAGAGG + Intergenic
1142093445 16:88227148-88227170 GGCCGCAGGGATCCCTGCAGTGG - Intergenic
1147668148 17:42161650-42161672 GGCAGGAAAGAGTCCTACAGTGG + Intronic
1149597736 17:57874193-57874215 GGACGCCAGGATCCCTACAGAGG + Intronic
1152060852 17:78074094-78074116 GGCAGTAAAGCGCCTTACAGAGG - Intronic
1161488083 19:4546437-4546459 GGCAGTCAGGACCCCTACTGCGG - Exonic
1161829781 19:6594270-6594292 GGCCGTGATGAGCCTCACAGAGG - Intronic
1162053826 19:8051059-8051081 GGGCGAAAGGAGCGCTGCAGAGG - Intronic
1162536291 19:11264501-11264523 GGCTGTGAGCAGCCCTACTGCGG - Intergenic
1163529063 19:17839079-17839101 GGAAGGAAGGAGCCCTGCAGGGG + Intronic
1163629909 19:18412988-18413010 GAAGGGAAGGAGCCCTACAGGGG + Intergenic
933766967 2:85716343-85716365 GGCCTTGAGGAGCCCTAAAAAGG + Intergenic
936019693 2:108985457-108985479 GGCCGTAAGGAGCCCTACAGAGG - Intronic
941950120 2:171146896-171146918 GGCCTTAAGGAGGCCTACTGAGG - Intronic
948892534 2:240914519-240914541 GGCCGCGAGGAGCGCTGCAGGGG - Intergenic
1171020182 20:21577695-21577717 GGCTGTGAGGTGCCTTACAGAGG - Intergenic
1174849560 20:53979409-53979431 GGCTGTATGGATGCCTACAGTGG + Intronic
1175109069 20:56633411-56633433 GGCCGTAATGAACCCCACTGAGG + Exonic
1175904022 20:62371078-62371100 GGCCGTCAGGAGCCCAGCAGTGG - Intergenic
1184729514 22:46365044-46365066 GGCCTGGAGGAGCCCTCCAGAGG + Intronic
962322905 3:134406427-134406449 GGCCTAGAGGAGCCCTGCAGCGG - Intergenic
962975537 3:140442757-140442779 GCCAGTAAGGAGCCATACATAGG - Intronic
963082772 3:141409880-141409902 GGCCCTGAGGAACTCTACAGGGG + Intronic
968815319 4:2818645-2818667 GGCCCGAAGGAGCCCCGCAGTGG - Intronic
971389859 4:26175644-26175666 GGCCAGAAGGAGCCCTAATGGGG - Intronic
975346265 4:73296003-73296025 GGCCGTAGGGAGTCCCACTGAGG + Intergenic
986523996 5:8653043-8653065 GACCCTAGGGAGCCCCACAGAGG - Intergenic
989840184 5:46055385-46055407 GGGTGTAATGAGGCCTACAGTGG + Intergenic
994458632 5:100047283-100047305 GGCTGTAAGGAGTCCTAGGGAGG + Intergenic
999339949 5:150761832-150761854 GGCAGTAAGGGCCCCCACAGGGG - Intergenic
1003479549 6:6518606-6518628 AGCCGTGAGGAGCCATGCAGTGG + Intergenic
1005825379 6:29628736-29628758 GGTCGCAAGGAACCCCACAGGGG + Intronic
1011621058 6:89242991-89243013 GGCAGTAAGAAGCCCTTCATGGG + Intergenic
1026560712 7:71445802-71445824 GGCATTAAGGAGCACTCCAGGGG - Intronic
1032046053 7:128609293-128609315 GGACGTAAGGAACCCAGCAGAGG + Intergenic
1043544396 8:81298874-81298896 GGCTGAAAGGAACCTTACAGAGG + Intergenic
1045300057 8:100903229-100903251 GGCCCTAGAGAGCCCTTCAGTGG + Intergenic
1045687860 8:104729782-104729804 GCCCCTGAGGAGTCCTACAGTGG + Intronic
1049679429 8:143911112-143911134 TGCTTTAAGGAGCCCTCCAGGGG - Intergenic
1055422999 9:76163282-76163304 GGCCGTCTGGAGCCCCTCAGTGG + Intronic
1061517682 9:131098901-131098923 GGGCCTCAGCAGCCCTACAGCGG - Intronic
1185647834 X:1627741-1627763 GGCCGTAAAAAGCTCTTCAGCGG - Exonic
1191912720 X:66168149-66168171 GACAGTAAGTAGCCCTGCAGAGG + Intronic
1197724919 X:129769808-129769830 GACAGAAAGGAGCCCTACACTGG + Intergenic
1198774363 X:140163939-140163961 GTGTGTAAGGAGCCCTCCAGTGG - Intergenic
1200938736 Y:8761033-8761055 GGCCCAAAGGAGCCCTGAAGTGG - Intergenic