ID: 936022217

View in Genome Browser
Species Human (GRCh38)
Location 2:109003492-109003514
Sequence CACGTGAACCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936022217_936022223 9 Left 936022217 2:109003492-109003514 CCTCCGTCTCCTGGGTTCACGTG No data
Right 936022223 2:109003524-109003546 CCTCAGCCTCCCAAGTAGCTGGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
936022217_936022221 8 Left 936022217 2:109003492-109003514 CCTCCGTCTCCTGGGTTCACGTG No data
Right 936022221 2:109003523-109003545 GCCTCAGCCTCCCAAGTAGCTGG 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
936022217_936022225 17 Left 936022217 2:109003492-109003514 CCTCCGTCTCCTGGGTTCACGTG No data
Right 936022225 2:109003532-109003554 TCCCAAGTAGCTGGGATTACAGG 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936022217 Original CRISPR CACGTGAACCCAGGAGACGG AGG (reversed) Intergenic
No off target data available for this crispr