ID: 936024103

View in Genome Browser
Species Human (GRCh38)
Location 2:109018184-109018206
Sequence GCCACATGTAAGCCCATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936024100_936024103 1 Left 936024100 2:109018160-109018182 CCATGACGACTTCAGTGAAATGG No data
Right 936024103 2:109018184-109018206 GCCACATGTAAGCCCATTGTGGG No data
936024099_936024103 6 Left 936024099 2:109018155-109018177 CCTATCCATGACGACTTCAGTGA No data
Right 936024103 2:109018184-109018206 GCCACATGTAAGCCCATTGTGGG No data
936024098_936024103 10 Left 936024098 2:109018151-109018173 CCATCCTATCCATGACGACTTCA No data
Right 936024103 2:109018184-109018206 GCCACATGTAAGCCCATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936024103 Original CRISPR GCCACATGTAAGCCCATTGT GGG Intergenic
No off target data available for this crispr