ID: 936024602

View in Genome Browser
Species Human (GRCh38)
Location 2:109021694-109021716
Sequence ATGGACACACACTGCCTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936024602_936024615 10 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024615 2:109021727-109021749 CCAGGGCCACAGGGTGTGGAGGG No data
936024602_936024608 1 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024608 2:109021718-109021740 ACCAGGTCCCCAGGGCCACAGGG No data
936024602_936024613 9 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024613 2:109021726-109021748 CCCAGGGCCACAGGGTGTGGAGG No data
936024602_936024604 -8 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024604 2:109021709-109021731 GTGTCCATTACCAGGTCCCCAGG No data
936024602_936024607 0 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024607 2:109021717-109021739 TACCAGGTCCCCAGGGCCACAGG No data
936024602_936024618 29 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024618 2:109021746-109021768 AGGGAGCTGTGAACTCACCTGGG No data
936024602_936024610 6 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024610 2:109021723-109021745 GTCCCCAGGGCCACAGGGTGTGG No data
936024602_936024617 28 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024617 2:109021745-109021767 GAGGGAGCTGTGAACTCACCTGG No data
936024602_936024605 -7 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024605 2:109021710-109021732 TGTCCATTACCAGGTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936024602 Original CRISPR ATGGACACACACTGCCTGCG AGG (reversed) Intergenic
No off target data available for this crispr