ID: 936024604

View in Genome Browser
Species Human (GRCh38)
Location 2:109021709-109021731
Sequence GTGTCCATTACCAGGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936024602_936024604 -8 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024604 2:109021709-109021731 GTGTCCATTACCAGGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936024604 Original CRISPR GTGTCCATTACCAGGTCCCC AGG Intergenic
No off target data available for this crispr