ID: 936024608

View in Genome Browser
Species Human (GRCh38)
Location 2:109021718-109021740
Sequence ACCAGGTCCCCAGGGCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936024602_936024608 1 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024608 2:109021718-109021740 ACCAGGTCCCCAGGGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936024608 Original CRISPR ACCAGGTCCCCAGGGCCACA GGG Intergenic
No off target data available for this crispr