ID: 936024615

View in Genome Browser
Species Human (GRCh38)
Location 2:109021727-109021749
Sequence CCAGGGCCACAGGGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936024602_936024615 10 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024615 2:109021727-109021749 CCAGGGCCACAGGGTGTGGAGGG No data
936024606_936024615 -9 Left 936024606 2:109021713-109021735 CCATTACCAGGTCCCCAGGGCCA No data
Right 936024615 2:109021727-109021749 CCAGGGCCACAGGGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936024615 Original CRISPR CCAGGGCCACAGGGTGTGGA GGG Intergenic
No off target data available for this crispr