ID: 936024617

View in Genome Browser
Species Human (GRCh38)
Location 2:109021745-109021767
Sequence GAGGGAGCTGTGAACTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936024612_936024617 -4 Left 936024612 2:109021726-109021748 CCCAGGGCCACAGGGTGTGGAGG No data
Right 936024617 2:109021745-109021767 GAGGGAGCTGTGAACTCACCTGG No data
936024606_936024617 9 Left 936024606 2:109021713-109021735 CCATTACCAGGTCCCCAGGGCCA No data
Right 936024617 2:109021745-109021767 GAGGGAGCTGTGAACTCACCTGG No data
936024614_936024617 -5 Left 936024614 2:109021727-109021749 CCAGGGCCACAGGGTGTGGAGGG No data
Right 936024617 2:109021745-109021767 GAGGGAGCTGTGAACTCACCTGG No data
936024609_936024617 3 Left 936024609 2:109021719-109021741 CCAGGTCCCCAGGGCCACAGGGT No data
Right 936024617 2:109021745-109021767 GAGGGAGCTGTGAACTCACCTGG No data
936024602_936024617 28 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024617 2:109021745-109021767 GAGGGAGCTGTGAACTCACCTGG No data
936024611_936024617 -3 Left 936024611 2:109021725-109021747 CCCCAGGGCCACAGGGTGTGGAG No data
Right 936024617 2:109021745-109021767 GAGGGAGCTGTGAACTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936024617 Original CRISPR GAGGGAGCTGTGAACTCACC TGG Intergenic
No off target data available for this crispr