ID: 936024618

View in Genome Browser
Species Human (GRCh38)
Location 2:109021746-109021768
Sequence AGGGAGCTGTGAACTCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936024614_936024618 -4 Left 936024614 2:109021727-109021749 CCAGGGCCACAGGGTGTGGAGGG No data
Right 936024618 2:109021746-109021768 AGGGAGCTGTGAACTCACCTGGG No data
936024602_936024618 29 Left 936024602 2:109021694-109021716 CCTCGCAGGCAGTGTGTGTCCAT No data
Right 936024618 2:109021746-109021768 AGGGAGCTGTGAACTCACCTGGG No data
936024611_936024618 -2 Left 936024611 2:109021725-109021747 CCCCAGGGCCACAGGGTGTGGAG No data
Right 936024618 2:109021746-109021768 AGGGAGCTGTGAACTCACCTGGG No data
936024606_936024618 10 Left 936024606 2:109021713-109021735 CCATTACCAGGTCCCCAGGGCCA No data
Right 936024618 2:109021746-109021768 AGGGAGCTGTGAACTCACCTGGG No data
936024612_936024618 -3 Left 936024612 2:109021726-109021748 CCCAGGGCCACAGGGTGTGGAGG No data
Right 936024618 2:109021746-109021768 AGGGAGCTGTGAACTCACCTGGG No data
936024616_936024618 -10 Left 936024616 2:109021733-109021755 CCACAGGGTGTGGAGGGAGCTGT No data
Right 936024618 2:109021746-109021768 AGGGAGCTGTGAACTCACCTGGG No data
936024609_936024618 4 Left 936024609 2:109021719-109021741 CCAGGTCCCCAGGGCCACAGGGT No data
Right 936024618 2:109021746-109021768 AGGGAGCTGTGAACTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936024618 Original CRISPR AGGGAGCTGTGAACTCACCT GGG Intergenic
No off target data available for this crispr