ID: 936025662

View in Genome Browser
Species Human (GRCh38)
Location 2:109029325-109029347
Sequence TGGATGCTTTACTAGCTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936025662_936025672 26 Left 936025662 2:109029325-109029347 CCATAAAGCTAGTAAAGCATCCA No data
Right 936025672 2:109029374-109029396 TAAATGGGAGAAACTTCATTAGG No data
936025662_936025670 11 Left 936025662 2:109029325-109029347 CCATAAAGCTAGTAAAGCATCCA No data
Right 936025670 2:109029359-109029381 ATGAGGGACCATGTGTAAATGGG No data
936025662_936025669 10 Left 936025662 2:109029325-109029347 CCATAAAGCTAGTAAAGCATCCA No data
Right 936025669 2:109029358-109029380 GATGAGGGACCATGTGTAAATGG No data
936025662_936025673 27 Left 936025662 2:109029325-109029347 CCATAAAGCTAGTAAAGCATCCA No data
Right 936025673 2:109029375-109029397 AAATGGGAGAAACTTCATTAGGG No data
936025662_936025667 -5 Left 936025662 2:109029325-109029347 CCATAAAGCTAGTAAAGCATCCA No data
Right 936025667 2:109029343-109029365 ATCCAGGAGAGGGATGATGAGGG No data
936025662_936025666 -6 Left 936025662 2:109029325-109029347 CCATAAAGCTAGTAAAGCATCCA No data
Right 936025666 2:109029342-109029364 CATCCAGGAGAGGGATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936025662 Original CRISPR TGGATGCTTTACTAGCTTTA TGG (reversed) Intergenic
No off target data available for this crispr