ID: 936025668

View in Genome Browser
Species Human (GRCh38)
Location 2:109029345-109029367
Sequence GTCCCTCATCATCCCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936025668_936025677 22 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025677 2:109029390-109029412 CATTAGGGTAAGGAAGGCATGGG No data
936025668_936025669 -10 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025669 2:109029358-109029380 GATGAGGGACCATGTGTAAATGG No data
936025668_936025676 21 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025676 2:109029389-109029411 TCATTAGGGTAAGGAAGGCATGG No data
936025668_936025675 16 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025675 2:109029384-109029406 AAACTTCATTAGGGTAAGGAAGG No data
936025668_936025672 6 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025672 2:109029374-109029396 TAAATGGGAGAAACTTCATTAGG No data
936025668_936025678 29 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025678 2:109029397-109029419 GTAAGGAAGGCATGGGAATCTGG No data
936025668_936025673 7 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025673 2:109029375-109029397 AAATGGGAGAAACTTCATTAGGG No data
936025668_936025674 12 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025674 2:109029380-109029402 GGAGAAACTTCATTAGGGTAAGG No data
936025668_936025670 -9 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025670 2:109029359-109029381 ATGAGGGACCATGTGTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936025668 Original CRISPR GTCCCTCATCATCCCTCTCC TGG (reversed) Intergenic
No off target data available for this crispr