ID: 936025673

View in Genome Browser
Species Human (GRCh38)
Location 2:109029375-109029397
Sequence AAATGGGAGAAACTTCATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936025662_936025673 27 Left 936025662 2:109029325-109029347 CCATAAAGCTAGTAAAGCATCCA No data
Right 936025673 2:109029375-109029397 AAATGGGAGAAACTTCATTAGGG No data
936025668_936025673 7 Left 936025668 2:109029345-109029367 CCAGGAGAGGGATGATGAGGGAC No data
Right 936025673 2:109029375-109029397 AAATGGGAGAAACTTCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936025673 Original CRISPR AAATGGGAGAAACTTCATTA GGG Intergenic
No off target data available for this crispr