ID: 936025915

View in Genome Browser
Species Human (GRCh38)
Location 2:109031218-109031240
Sequence CACTGCTGACACCTTGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936025915_936025930 23 Left 936025915 2:109031218-109031240 CCACCATCAAGGTGTCAGCAGTG No data
Right 936025930 2:109031264-109031286 GGGGGCTTCTTGATGGGTGCTGG No data
936025915_936025925 5 Left 936025915 2:109031218-109031240 CCACCATCAAGGTGTCAGCAGTG No data
Right 936025925 2:109031246-109031268 GGCCTGTTCCTCACAGATGGGGG No data
936025915_936025929 17 Left 936025915 2:109031218-109031240 CCACCATCAAGGTGTCAGCAGTG No data
Right 936025929 2:109031258-109031280 ACAGATGGGGGCTTCTTGATGGG No data
936025915_936025922 2 Left 936025915 2:109031218-109031240 CCACCATCAAGGTGTCAGCAGTG No data
Right 936025922 2:109031243-109031265 GGGGGCCTGTTCCTCACAGATGG No data
936025915_936025923 3 Left 936025915 2:109031218-109031240 CCACCATCAAGGTGTCAGCAGTG No data
Right 936025923 2:109031244-109031266 GGGGCCTGTTCCTCACAGATGGG No data
936025915_936025924 4 Left 936025915 2:109031218-109031240 CCACCATCAAGGTGTCAGCAGTG No data
Right 936025924 2:109031245-109031267 GGGCCTGTTCCTCACAGATGGGG No data
936025915_936025928 16 Left 936025915 2:109031218-109031240 CCACCATCAAGGTGTCAGCAGTG No data
Right 936025928 2:109031257-109031279 CACAGATGGGGGCTTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936025915 Original CRISPR CACTGCTGACACCTTGATGG TGG (reversed) Intergenic
No off target data available for this crispr