ID: 936028621

View in Genome Browser
Species Human (GRCh38)
Location 2:109053629-109053651
Sequence CAGGTTTATTACTTACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936028621_936028623 29 Left 936028621 2:109053629-109053651 CCTGTCTGTAAGTAATAAACCTG No data
Right 936028623 2:109053681-109053703 CTGTCTCACCAGAATCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936028621 Original CRISPR CAGGTTTATTACTTACAGAC AGG (reversed) Intergenic
No off target data available for this crispr