ID: 936028622

View in Genome Browser
Species Human (GRCh38)
Location 2:109053648-109053670
Sequence TGCAGCAAGTGACATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936028622_936028623 10 Left 936028622 2:109053648-109053670 CCTGCTTCATGTCACTTGCTGCA No data
Right 936028623 2:109053681-109053703 CTGTCTCACCAGAATCAGACAGG No data
936028622_936028624 14 Left 936028622 2:109053648-109053670 CCTGCTTCATGTCACTTGCTGCA No data
Right 936028624 2:109053685-109053707 CTCACCAGAATCAGACAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936028622 Original CRISPR TGCAGCAAGTGACATGAAGC AGG (reversed) Intergenic
No off target data available for this crispr