ID: 936030650

View in Genome Browser
Species Human (GRCh38)
Location 2:109067855-109067877
Sequence CAGGGTGGTCGTGATGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936030650_936030662 21 Left 936030650 2:109067855-109067877 CCTCCTCCATCACGACCACCCTG No data
Right 936030662 2:109067899-109067921 CCCCTTCCTCCCTCAGCCACAGG No data
936030650_936030664 22 Left 936030650 2:109067855-109067877 CCTCCTCCATCACGACCACCCTG No data
Right 936030664 2:109067900-109067922 CCCTTCCTCCCTCAGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936030650 Original CRISPR CAGGGTGGTCGTGATGGAGG AGG (reversed) Intergenic
No off target data available for this crispr