ID: 936033091

View in Genome Browser
Species Human (GRCh38)
Location 2:109087673-109087695
Sequence GGAACAATGATACCTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936033084_936033091 12 Left 936033084 2:109087638-109087660 CCTCTCTGGGCCCCAGCTTATTG No data
Right 936033091 2:109087673-109087695 GGAACAATGATACCTAGAGTGGG No data
936033085_936033091 2 Left 936033085 2:109087648-109087670 CCCCAGCTTATTGAAGTTTAAAA No data
Right 936033091 2:109087673-109087695 GGAACAATGATACCTAGAGTGGG No data
936033087_936033091 0 Left 936033087 2:109087650-109087672 CCAGCTTATTGAAGTTTAAAATG No data
Right 936033091 2:109087673-109087695 GGAACAATGATACCTAGAGTGGG No data
936033086_936033091 1 Left 936033086 2:109087649-109087671 CCCAGCTTATTGAAGTTTAAAAT No data
Right 936033091 2:109087673-109087695 GGAACAATGATACCTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936033091 Original CRISPR GGAACAATGATACCTAGAGT GGG Intergenic
No off target data available for this crispr