ID: 936034353

View in Genome Browser
Species Human (GRCh38)
Location 2:109098873-109098895
Sequence CTCAAATCTCAGATGGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936034347_936034353 1 Left 936034347 2:109098849-109098871 CCGGTTATTTGGCTGCCCTCCAA No data
Right 936034353 2:109098873-109098895 CTCAAATCTCAGATGGGTTCAGG No data
936034345_936034353 11 Left 936034345 2:109098839-109098861 CCTGTAATACCCGGTTATTTGGC No data
Right 936034353 2:109098873-109098895 CTCAAATCTCAGATGGGTTCAGG No data
936034346_936034353 2 Left 936034346 2:109098848-109098870 CCCGGTTATTTGGCTGCCCTCCA No data
Right 936034353 2:109098873-109098895 CTCAAATCTCAGATGGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936034353 Original CRISPR CTCAAATCTCAGATGGGTTC AGG Intergenic
No off target data available for this crispr