ID: 936036996

View in Genome Browser
Species Human (GRCh38)
Location 2:109120898-109120920
Sequence TGTCTACACAGTAAAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936036991_936036996 2 Left 936036991 2:109120873-109120895 CCCTGCACCAGGTAACTGGCAGC No data
Right 936036996 2:109120898-109120920 TGTCTACACAGTAAAGAGGGTGG No data
936036988_936036996 17 Left 936036988 2:109120858-109120880 CCTGGTACAGAGAAGCCCTGCAC No data
Right 936036996 2:109120898-109120920 TGTCTACACAGTAAAGAGGGTGG No data
936036992_936036996 1 Left 936036992 2:109120874-109120896 CCTGCACCAGGTAACTGGCAGCT No data
Right 936036996 2:109120898-109120920 TGTCTACACAGTAAAGAGGGTGG No data
936036993_936036996 -5 Left 936036993 2:109120880-109120902 CCAGGTAACTGGCAGCTTTGTCT No data
Right 936036996 2:109120898-109120920 TGTCTACACAGTAAAGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936036996 Original CRISPR TGTCTACACAGTAAAGAGGG TGG Intergenic
No off target data available for this crispr