ID: 936038300

View in Genome Browser
Species Human (GRCh38)
Location 2:109129539-109129561
Sequence CCATGCTGCTCGGAGCGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936038293_936038300 -5 Left 936038293 2:109129521-109129543 CCGCTGCGGGCGCCTCCCCCATG 0: 1
1: 0
2: 1
3: 15
4: 185
Right 936038300 2:109129539-109129561 CCATGCTGCTCGGAGCGTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 80
936038289_936038300 14 Left 936038289 2:109129502-109129524 CCTAGGCAGCCGCGCGAGACCGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 936038300 2:109129539-109129561 CCATGCTGCTCGGAGCGTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 80
936038286_936038300 22 Left 936038286 2:109129494-109129516 CCCCGGGACCTAGGCAGCCGCGC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 936038300 2:109129539-109129561 CCATGCTGCTCGGAGCGTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 80
936038292_936038300 5 Left 936038292 2:109129511-109129533 CCGCGCGAGACCGCTGCGGGCGC 0: 1
1: 0
2: 0
3: 4
4: 59
Right 936038300 2:109129539-109129561 CCATGCTGCTCGGAGCGTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 80
936038285_936038300 26 Left 936038285 2:109129490-109129512 CCGGCCCCGGGACCTAGGCAGCC 0: 1
1: 0
2: 2
3: 14
4: 242
Right 936038300 2:109129539-109129561 CCATGCTGCTCGGAGCGTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 80
936038287_936038300 21 Left 936038287 2:109129495-109129517 CCCGGGACCTAGGCAGCCGCGCG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 936038300 2:109129539-109129561 CCATGCTGCTCGGAGCGTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 80
936038288_936038300 20 Left 936038288 2:109129496-109129518 CCGGGACCTAGGCAGCCGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 33
Right 936038300 2:109129539-109129561 CCATGCTGCTCGGAGCGTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936038300 Original CRISPR CCATGCTGCTCGGAGCGTCC TGG Exonic
900992941 1:6106365-6106387 GCATGCTGCCCGGAGCGGACGGG + Intronic
913024152 1:114819039-114819061 CCAGGCTGCTCTGGGCCTCCTGG + Intergenic
915286412 1:154856173-154856195 CCCTGCTGCTAGGAGGGTTCAGG + Intronic
922035561 1:221844630-221844652 CCATGCAGCTTGGAGGGGCCTGG + Intergenic
1063371177 10:5523997-5524019 CCATGCTGCCCGGAGCTCCTGGG + Exonic
1065828695 10:29595351-29595373 CCGTGCTGCTCTGAGGGTGCCGG - Intronic
1069969360 10:72152619-72152641 CCAGGCTGATCTCAGCGTCCTGG - Intronic
1072120977 10:92405481-92405503 CCATGCTGCTCCAAGGGCCCTGG - Intergenic
1075343182 10:121663300-121663322 CCATGCTGCTCACTGCTTCCAGG + Intergenic
1076365095 10:129916565-129916587 TCATGCTCCTCTGAGCCTCCTGG - Intronic
1077078629 11:712779-712801 CCAGGCTGCTGGGAGGGCCCTGG - Intronic
1079282031 11:19096172-19096194 CCATGCTGCACTGAGATTCCAGG - Intergenic
1081607871 11:44538459-44538481 ACAGGCTGCTTGGAGCCTCCAGG - Intergenic
1087465715 11:98502494-98502516 CCATGCTGCTTGGAGCATCCTGG + Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1089729044 11:120509286-120509308 CCATGGTGGTCGGAGCGCACAGG - Intergenic
1090750711 11:129744198-129744220 CAAGGCTGCTCAGAGCTTCCCGG - Intergenic
1092612866 12:10189915-10189937 CCCTGCAGCTCGGAGGATCCTGG + Exonic
1097255353 12:57669649-57669671 CCATGCTGCTCTCAAAGTCCTGG + Intergenic
1098856539 12:75659047-75659069 CTAGGCTGCTCGGAGCCTGCAGG + Intergenic
1102229552 12:111253063-111253085 CCATCCTGCTCTGAGCCGCCTGG + Intronic
1103096743 12:118138113-118138135 CCTTCCTGCTGGGAGCATCCGGG - Exonic
1104049863 12:125187538-125187560 CCAGGCTCCCCGGCGCGTCCTGG - Intronic
1107438672 13:40404422-40404444 GCATGCTGCTGGGACCTTCCAGG + Intergenic
1114081107 14:19201866-19201888 CCATGCTGCTCTGCTCCTCCAGG - Intergenic
1117841970 14:59870041-59870063 CCCTACAGCTCGGAGCCTCCTGG + Intronic
1120872372 14:89349057-89349079 CCATGCAGCTTGGAGAGTCGGGG + Intronic
1121758611 14:96423986-96424008 CCTTCCTGCTTGGAGCATCCGGG + Intronic
1123039859 14:105486085-105486107 CCATGCTGCATGGAGCTCCCTGG - Intergenic
1139840281 16:69873133-69873155 CCATGCTGCTCTGGGTCTCCTGG - Intronic
1141849799 16:86637373-86637395 CCAAGTTGCTCAGAGCTTCCTGG - Intergenic
1145049492 17:19648526-19648548 CCATCCTGCTGAGAGCGCCCCGG - Intronic
1152006073 17:77682073-77682095 GCAAGCTGCCCAGAGCGTCCTGG + Intergenic
1152118240 17:78401966-78401988 CGCTCCTGCTCGGAGCGTGCTGG - Intronic
1152855684 17:82663688-82663710 GCAGGGAGCTCGGAGCGTCCTGG - Intronic
1156204463 18:34871058-34871080 CCAAGCTGCTAGGTGCGGCCAGG + Intronic
1161574467 19:5048041-5048063 CCATGCTGCCCAGAGGGGCCTGG + Intronic
1162038622 19:7955996-7956018 CCCTGCTGCCCAGAGCGTCCAGG + Intergenic
1163426718 19:17244517-17244539 CCGTGGAGCTCGCAGCGTCCAGG - Intronic
1165046636 19:33109829-33109851 CTCTGCTGCTCTGAGCGTTCTGG - Exonic
1165328960 19:35130858-35130880 CCATCCTGCCCAGATCGTCCTGG + Intronic
1165653924 19:37516590-37516612 CCATGCTGCTAGAAGAGTGCCGG + Intronic
1166069663 19:40379639-40379661 CCATGCTGGTGGGAGCGGCGGGG + Exonic
1167941743 19:52952468-52952490 CCATTCTGCTCAGGGCTTCCAGG + Intronic
929375649 2:41283532-41283554 GAATGCTGCTCGGAGAGACCAGG + Intergenic
929604520 2:43226030-43226052 CCACGCTGCCCGGGGCTTCCCGG - Intronic
932763379 2:74455227-74455249 TCTTGCTCCTCGGAGAGTCCAGG + Intronic
936038300 2:109129539-109129561 CCATGCTGCTCGGAGCGTCCTGG + Exonic
939267370 2:139891351-139891373 ACATGCTGTTCGGAGGGTCCTGG - Intergenic
939466364 2:142562014-142562036 CCATGCTGCCCTCAGCCTCCTGG - Intergenic
1171132181 20:22663875-22663897 CCATGCTGCTCGGTGTGCCATGG + Intergenic
1172539383 20:35699268-35699290 CCATGCTGCTCCGAGCCGCTTGG - Exonic
1172806472 20:37615452-37615474 CAGTGCTGCCCGGAGCCTCCTGG - Intergenic
1173026367 20:39310962-39310984 TCCTGCTGCTCGGAAAGTCCTGG + Intergenic
1175688984 20:61052253-61052275 CCATGCTGCTCGGGTCCTCATGG + Intergenic
1176048805 20:63105889-63105911 CCATGCAGCTCGGACCTCCCTGG + Intergenic
1178713563 21:34942799-34942821 CCATGCTGAGTGGAGCCTCCTGG - Intronic
1180499666 22:15920820-15920842 CCATGCTGCTCTGCTCCTCCAGG + Intergenic
1180987789 22:19915567-19915589 CCCTGCTGCTCGGAGTGGCATGG - Intronic
953932501 3:47012722-47012744 CCAGACTGCTAGGAGAGTCCAGG - Intergenic
960831283 3:121851388-121851410 CCATGCTGGTCGGAAACTCCTGG + Intronic
968045398 3:195621174-195621196 CCACGCTGATCTGAACGTCCAGG - Intergenic
968064189 3:195749195-195749217 CCATGCTGATCTGAACGTCCAGG - Intronic
969378987 4:6782428-6782450 CCAAGCTGCACGGCGCGTCCCGG + Intronic
969888613 4:10239070-10239092 CCTTGGTGCTCAGAGCCTCCTGG + Intergenic
972336205 4:38108973-38108995 CGATGCTGCTCTGTGTGTCCTGG - Intronic
975646076 4:76547520-76547542 CCATGCTGTTCTGGGCGTCGGGG + Intronic
992088602 5:73299086-73299108 CCAGGCTGCTCGCCTCGTCCGGG - Intergenic
1001275046 5:170344657-170344679 CCCTGCTGTTTGGAGCGTTCAGG + Intergenic
1001519530 5:172381313-172381335 CCAAGGTGCTGGGAGTGTCCTGG - Intronic
1001861381 5:175058709-175058731 ACATCCTGCTCAGAGCTTCCTGG + Intergenic
1006115296 6:31773062-31773084 CCATGCTGCCCGTGGTGTCCAGG + Exonic
1008109462 6:47477545-47477567 CCAAGCTGTTCCGAGCCTCCGGG + Intergenic
1010107011 6:72182294-72182316 CCATTCTGCTCGGAAAGCCCTGG - Exonic
1015857160 6:137637171-137637193 TCATGCTGCTTAGAGCTTCCTGG + Intergenic
1018173275 6:161158808-161158830 CCATGCTGCTCGCAGCACCGGGG - Intronic
1020782497 7:12534741-12534763 CCATGCTGGTCTCAGCCTCCTGG - Intergenic
1029600538 7:101560791-101560813 CCAGGCTGCTCTGAGAGTCCAGG + Intergenic
1030330101 7:108261699-108261721 CCAAGCTGCTCAAAGCCTCCAGG - Intronic
1032842014 7:135721771-135721793 CCAGGCAGCTCGGAGGGTTCTGG + Intronic
1035726902 8:1830343-1830365 CCAGGCTGCCAGGAGCCTCCGGG + Intronic
1036182119 8:6594552-6594574 CCATGTTGCTGAGGGCGTCCTGG + Intronic
1039212805 8:35235766-35235788 CCATGCTCCTCGCCGCGTTCCGG - Exonic
1040464066 8:47678483-47678505 CCATGCTGCTCTGAGTGTGGAGG - Intronic
1045270889 8:100660667-100660689 CCAGGCTGCTGGGAGAGGCCAGG - Intronic
1049189151 8:141277009-141277031 CCTTGCTGCTGGGAGCTTGCTGG - Intronic
1061852794 9:133425695-133425717 CCATGCTGCTTGGGGCATCCGGG - Intronic
1062242469 9:135547722-135547744 CCATGCTGTGCGGAGCAGCCAGG + Intronic