ID: 936038305

View in Genome Browser
Species Human (GRCh38)
Location 2:109129581-109129603
Sequence CTCGCTCTGCGCAGCAGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936038305_936038318 23 Left 936038305 2:109129581-109129603 CCGCCGCTGCTGCGCAGAGCGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 936038318 2:109129627-109129649 GCGACGGCGGCGTCGGGCGGCGG 0: 1
1: 0
2: 22
3: 87
4: 518
936038305_936038315 16 Left 936038305 2:109129581-109129603 CCGCCGCTGCTGCGCAGAGCGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 936038315 2:109129620-109129642 CAGGCGAGCGACGGCGGCGTCGG 0: 1
1: 0
2: 1
3: 8
4: 118
936038305_936038310 -8 Left 936038305 2:109129581-109129603 CCGCCGCTGCTGCGCAGAGCGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 936038310 2:109129596-109129618 AGAGCGAGGGCGACGAGGACAGG 0: 1
1: 0
2: 0
3: 13
4: 137
936038305_936038317 20 Left 936038305 2:109129581-109129603 CCGCCGCTGCTGCGCAGAGCGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 936038317 2:109129624-109129646 CGAGCGACGGCGGCGTCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 134
936038305_936038313 10 Left 936038305 2:109129581-109129603 CCGCCGCTGCTGCGCAGAGCGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 936038313 2:109129614-109129636 ACAGGCCAGGCGAGCGACGGCGG 0: 1
1: 0
2: 0
3: 10
4: 110
936038305_936038316 17 Left 936038305 2:109129581-109129603 CCGCCGCTGCTGCGCAGAGCGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 936038316 2:109129621-109129643 AGGCGAGCGACGGCGGCGTCGGG 0: 1
1: 0
2: 1
3: 6
4: 78
936038305_936038312 7 Left 936038305 2:109129581-109129603 CCGCCGCTGCTGCGCAGAGCGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 936038312 2:109129611-109129633 AGGACAGGCCAGGCGAGCGACGG 0: 1
1: 0
2: 2
3: 17
4: 246
936038305_936038311 -3 Left 936038305 2:109129581-109129603 CCGCCGCTGCTGCGCAGAGCGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 936038311 2:109129601-109129623 GAGGGCGACGAGGACAGGCCAGG 0: 1
1: 0
2: 1
3: 29
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936038305 Original CRISPR CTCGCTCTGCGCAGCAGCGG CGG (reversed) Exonic
900798736 1:4725031-4725053 CTCGCTCTGGGCACAAGCGTGGG - Intronic
902810291 1:18884299-18884321 CCAGCTCTGTGCAGCAGAGGGGG + Intronic
904190171 1:28737214-28737236 CTCGGCCTGCCCAGGAGCGGCGG - Intronic
915564417 1:156705816-156705838 CGCGCTCTCCGCAGAGGCGGGGG + Exonic
916367911 1:164054644-164054666 CTCTCTCTTCGCAGCTGCAGCGG + Intergenic
917790688 1:178496894-178496916 CTCCTTCTGCGCAGCAGGTGAGG - Intergenic
1062968226 10:1626479-1626501 CTTCCTCTGCTCAGCAGCCGAGG + Intronic
1062982538 10:1737226-1737248 CTCAAGCTTCGCAGCAGCGGCGG - Exonic
1063971703 10:11385647-11385669 CCAGCTCTGCGCAGCAGGTGGGG + Intergenic
1065099615 10:22320909-22320931 CTCGCTCCGCGCCGCGGCGGCGG - Intronic
1067453773 10:46398396-46398418 CTGACTCTCCGCAGCAGCAGTGG + Intergenic
1067583454 10:47461350-47461372 CTGACTCTCCGCAGCAGCAGTGG - Intronic
1067633458 10:47986698-47986720 CTGACTCTCCGCAGCAGCAGTGG - Intergenic
1073243562 10:102073954-102073976 CTCACTCTGGGGAGCAGAGGAGG + Intergenic
1075548979 10:123378244-123378266 CTTGCTTTGCCCAGCAGAGGTGG - Intergenic
1077191968 11:1259358-1259380 CTGGGTCTGCCCAGCAGCTGTGG - Intronic
1079081314 11:17415329-17415351 CCCGCTCTGGGCTGCAGCAGGGG + Exonic
1083895881 11:65619523-65619545 CTCTCTCTGGGCAGCGGCCGAGG + Exonic
1084520173 11:69657959-69657981 CTCGCTCTGCCCAGCATTGGGGG + Intronic
1088679390 11:112226357-112226379 CACGCACTGCGCAGCCGCGGTGG + Exonic
1090611340 11:128473770-128473792 CTCACTCTCTGCAGCAGGGGAGG + Intronic
1090901189 11:131033270-131033292 CAAGCTCAGCGCAGCAGAGGAGG - Intergenic
1096103855 12:48985514-48985536 CTCCCTCTGCGCTGGAGAGGAGG - Intergenic
1096169192 12:49453128-49453150 CTCGCTCTGTGCAGCCCAGGTGG - Intronic
1096475683 12:51907522-51907544 CTCGCTCGGCGCAGCTGGCGCGG - Exonic
1101253834 12:102958372-102958394 CGCGCTCTGCGCTGCCGCTGCGG - Exonic
1102473413 12:113173405-113173427 CTCCCTCTGTGCAGCTGCTGGGG - Intronic
1102576167 12:113857479-113857501 TTGGCTCAGGGCAGCAGCGGAGG - Intronic
1105029265 12:132871424-132871446 CTCGCTCTGCTCTGTTGCGGAGG - Intronic
1107548359 13:41454530-41454552 ATTACTCTGCGCATCAGCGGGGG - Intergenic
1122602938 14:102930296-102930318 CCCGCGCGGCGCAGCAGCGGCGG - Exonic
1127267153 15:57371664-57371686 CTGGCTCTGAGCAGGAGCAGAGG - Intergenic
1130882152 15:88064656-88064678 CTCGCTCTGGACTGCAGTGGAGG - Intronic
1137618067 16:49858397-49858419 CTCGCGCTCCCCAGCCGCGGGGG - Intergenic
1138591325 16:58000945-58000967 CCGGCTCTGCGCAGGAGAGGAGG + Intronic
1140430622 16:74899725-74899747 CTCGCTCTGCCCGGCGGCGTTGG - Intronic
1142321444 16:89385804-89385826 CTCTGGCTGCGCAGCGGCGGGGG - Intronic
1144671506 17:17135148-17135170 CTGGCACTGCGGAGCAGCTGAGG + Intronic
1147597916 17:41728420-41728442 CTGGCACAGCGCAGCAGCCGAGG - Intronic
1149535601 17:57431237-57431259 CTGGCTCTGAGCATCAGGGGAGG - Intronic
1160569931 18:79809380-79809402 CTCGCTCTGAGGAGCTGCCGGGG + Intergenic
1160865520 19:1254303-1254325 GTCCCCCCGCGCAGCAGCGGCGG - Exonic
1161593046 19:5137343-5137365 CTCGCTCCCCGCAGCGGGGGTGG + Intronic
1163445127 19:17341500-17341522 CTTGCTCGGGTCAGCAGCGGGGG - Exonic
1164654206 19:29909091-29909113 CTTGCCCTGCACAGCAGGGGTGG - Intergenic
1165486426 19:36099458-36099480 CCCGCTCTGCCCAGCGGCCGTGG - Exonic
1166553059 19:43679595-43679617 CTGGCTCTTCCCAGCAGCAGTGG - Intergenic
1168297436 19:55384272-55384294 CTCTCTCTGGGCGCCAGCGGCGG - Exonic
925844052 2:8020021-8020043 CTCGCTCTGCACAGCACTTGCGG - Intergenic
931587011 2:63840620-63840642 CTCCCTCGGGGCAGCTGCGGTGG + Intergenic
932635639 2:73385838-73385860 CTCGCTCTGGGCGGCAGAGGAGG - Exonic
936038305 2:109129581-109129603 CTCGCTCTGCGCAGCAGCGGCGG - Exonic
937092965 2:119218668-119218690 CTCACTCAGCACAGCAGGGGTGG - Intergenic
937904249 2:127045203-127045225 GTCCCTCTGCTCAGCAGCTGTGG - Intergenic
938192950 2:129299876-129299898 CCAACTCTGCGCAGCTGCGGGGG + Intergenic
938407361 2:131039941-131039963 CGCGCCCTGCGCCGCAGCGGCGG - Intronic
940912900 2:159224687-159224709 GTGACTCTGAGCAGCAGCGGAGG + Intronic
942799623 2:179861014-179861036 CTCGCTCTGCGGAGGAGGGCGGG + Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1176178906 20:63740559-63740581 CTCGGTGTGCGCAGGGGCGGTGG + Intronic
1182418899 22:30239113-30239135 CTCGCTCTGGGAGGCAGCAGGGG - Intergenic
1183724015 22:39578507-39578529 CTCTCTCTGCAGAGCAGGGGAGG - Intronic
1183966942 22:41447648-41447670 CTGGCTCTGCGCAGGCGCGCGGG + Intergenic
1184653064 22:45928028-45928050 CTCCCTCTAGGCAGCAGGGGAGG - Intronic
1184912080 22:47542826-47542848 CTTCCTCTGCACAGCAGTGGAGG + Intergenic
1185296697 22:50058274-50058296 CTCGGGCTGTGCAGCGGCGGCGG + Intergenic
961515041 3:127427068-127427090 CTGGCTCTGCGCCTCAGCGCTGG - Intergenic
970753384 4:19394211-19394233 CTCTCTCTACCCAGCAGCAGTGG + Intergenic
979674744 4:123398570-123398592 CTCGCTCGGCGCGGCAGGTGCGG + Intronic
980988845 4:139720175-139720197 CTCCGACTGCGCAGCTGCGGTGG + Exonic
985744573 5:1638810-1638832 CTCTCCCTGCTCAGCAGCGAGGG - Intergenic
999707221 5:154284545-154284567 ATTGCTCTGCACAGCAGCTGTGG - Intronic
1002867083 6:1131145-1131167 CTTGCTCTGGGCAGTAGCTGTGG - Intergenic
1006578925 6:35065452-35065474 CTCGTTGTGAGCAGCAGCAGAGG + Intronic
1016404595 6:143716853-143716875 CTTGCTCTGGTCAGCAGCAGTGG + Intronic
1017933732 6:158985140-158985162 CTCGCTCTGCTCAGCTGTAGAGG - Intronic
1018771831 6:166977154-166977176 CTCACTCTGCTCAGTAGCTGGGG + Intergenic
1022046736 7:26627829-26627851 CTCGCTCTCCACAGCGGTGGAGG + Intergenic
1023118456 7:36885491-36885513 CTCTAGCTGGGCAGCAGCGGAGG + Intronic
1023609036 7:41955983-41956005 CCAGCTCTGCGCCTCAGCGGGGG + Intergenic
1024099076 7:46010740-46010762 CCTGCTCTGCGCTGCAGGGGTGG - Intergenic
1024665731 7:51545199-51545221 CTCCCTCTGCTCTGCAGTGGGGG - Intergenic
1034831141 7:154308600-154308622 TTCCCTCTGCGCAGGAGCAGAGG - Intronic
1036239047 8:7067357-7067379 ATTACTCTGCGCATCAGCGGAGG - Intergenic
1036906766 8:12713848-12713870 ATTACTCTGCGCATCAGCGGAGG + Intergenic
1038944681 8:32345458-32345480 ATTGCTCTGCACAGCAGCAGAGG - Intronic
1049265580 8:141666214-141666236 GTCCCTCAGCGCAGCAGCGAGGG - Intergenic
1049693719 8:143973629-143973651 CTCCCTCTGCCCGGCCGCGGCGG - Intronic
1052994257 9:34541782-34541804 CCCACTCTGGGCAGCAGTGGAGG + Intergenic
1053503824 9:38622616-38622638 CTCCCACTCCGCTGCAGCGGAGG + Intergenic
1057261708 9:93588114-93588136 CTGTCTCTGAGCAGCAGCTGGGG + Intronic
1057313374 9:93954982-93955004 CTCGCCCGCCGCGGCAGCGGCGG + Exonic
1060793784 9:126501819-126501841 CTCGCTCTGGGCAGCAGGGAGGG + Intronic
1061955167 9:133957532-133957554 CTCGCCCTGCCCTGCAGCCGGGG - Intronic
1062016891 9:134295622-134295644 CTCGGACTGGGCAGCGGCGGGGG - Intergenic
1062032948 9:134370266-134370288 GTCACACTGCCCAGCAGCGGCGG - Intronic
1062566671 9:137166748-137166770 CCCGCTTTCCGCAGCAGAGGTGG - Intronic
1190285225 X:48957204-48957226 CGCGCTGGGCGCAGCGGCGGCGG - Exonic
1190466330 X:50727872-50727894 CTCCCTCTGGGCAGAAGCTGTGG - Intronic