ID: 936038871

View in Genome Browser
Species Human (GRCh38)
Location 2:109133963-109133985
Sequence TCCAGCTGGTCAGCTAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936038871 Original CRISPR TCCAGCTGGTCAGCTAGTGG AGG Intronic
901068137 1:6504326-6504348 CCCAGCTGCCCAGCTGGTGGAGG - Intronic
905199819 1:36307908-36307930 CCAGGCTGCTCAGCTAGTGGGGG - Exonic
906141872 1:43538617-43538639 TACAGCTCGTCAGCTACTGTAGG + Intronic
907272255 1:53298020-53298042 TCCAGAAGGTCAGCTGGAGGGGG - Intronic
910349717 1:86281525-86281547 ACCAGCTGTTCAGATGGTGGGGG - Intergenic
915233783 1:154465547-154465569 TCCAGCTGTTCAGCTGGTTGAGG + Exonic
919173693 1:193991554-193991576 TCCAGCTGCTCAGCTGGTTGAGG + Intergenic
922029182 1:221781514-221781536 TCCAATTTGTCAGCTAATGGTGG - Intergenic
1064491848 10:15866472-15866494 TCCAGTTGGTCAGGCAGTTGGGG - Intergenic
1065730161 10:28703243-28703265 TCCAGCTGCTCAGGAGGTGGAGG - Intergenic
1066221484 10:33339093-33339115 TCCAACTGGACAGATGGTGGTGG + Intergenic
1067072228 10:43141561-43141583 CCCAGCTGTTCAGGCAGTGGAGG + Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1070232465 10:74583851-74583873 TCTTGCTGCTCAGCTAGGGGAGG + Intronic
1070644155 10:78189803-78189825 CCCAGTTGCCCAGCTAGTGGTGG - Intergenic
1071941333 10:90594769-90594791 TCTACCTGGTCAGCGTGTGGAGG - Intergenic
1072508103 10:96090312-96090334 TGCAGCTGGGCTGCTGGTGGCGG + Intergenic
1072611699 10:97021355-97021377 CCCAGCTGGACAGCCAGCGGAGG + Exonic
1074161122 10:110837162-110837184 TCCAGCTGGGCAGATAGTTGAGG + Exonic
1074495502 10:113976785-113976807 TAGAATTGGTCAGCTAGTGGTGG + Intergenic
1075054851 10:119209647-119209669 TGCAGCTGGCCACCTAGTGGTGG + Intronic
1082050386 11:47766588-47766610 TCCAGCAGTTCTGCTAGTGTGGG + Intronic
1089169141 11:116500276-116500298 TGCAGCTGGGCAGTGAGTGGCGG + Intergenic
1092270972 12:7023142-7023164 TCCATTAGGTCAGTTAGTGGGGG - Intronic
1096256260 12:50063960-50063982 TCCAGCTAGGCAGGGAGTGGAGG + Intronic
1097010844 12:55952633-55952655 TCCAGTTTGTCATCTGGTGGAGG + Intronic
1100626362 12:96337314-96337336 TCCAGCTCTTAAGCTATTGGGGG - Intronic
1112490106 13:99855147-99855169 TCCAGCTTGTCAGATCTTGGGGG + Intronic
1112668440 13:101604770-101604792 TCCAGCTGGTGAGGTGATGGCGG - Intronic
1113733426 13:112658120-112658142 TCCAGCTGGTGAGATAGTCCAGG - Intronic
1116862435 14:50005387-50005409 CCCAGTTGGTCAGCCAGTGAAGG + Intronic
1118694465 14:68370919-68370941 CCCAGCTGCTCAGGAAGTGGAGG + Intronic
1124629988 15:31330620-31330642 TGCAGCTGTTCAGAGAGTGGGGG - Intronic
1125812781 15:42556069-42556091 CCCAGCTAGTCAGCTAGTTTGGG - Intronic
1128497090 15:68204844-68204866 TCCAACTGGTCAGGTTCTGGAGG + Intronic
1131645340 15:94336291-94336313 TCCAGCTGGAGTGCCAGTGGAGG - Intronic
1134102663 16:11462895-11462917 TCCAGCTGGTGAGGCAGCGGAGG - Intronic
1136779389 16:32886927-32886949 CCAAGCTGCTCAGCTGGTGGCGG - Intergenic
1136891228 16:33974591-33974613 CCAAGCTGCTCAGCTGGTGGCGG + Intergenic
1137416351 16:48285200-48285222 GCCAGCTGTTAAGCTTGTGGCGG + Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1203081805 16_KI270728v1_random:1149015-1149037 CCAAGCTGCTCAGCTGGTGGCGG - Intergenic
1142478890 17:206006-206028 TCCAGCTGGTCACCTTATGTAGG + Intergenic
1142502222 17:339519-339541 TCCAGTTGGTCAGCCAGTGGCGG - Intronic
1143336484 17:6175351-6175373 TCCAGCTGGACATCCCGTGGTGG - Intergenic
1143352339 17:6297994-6298016 CCCAGCTGGTGAGCCAGGGGAGG - Intergenic
1145001895 17:19311217-19311239 TCCACCTGGGCAGTTACTGGTGG - Intronic
1146748087 17:35349640-35349662 TCCAGCTTCTCAGCTAGTTGGGG + Intergenic
1147670764 17:42175641-42175663 ACCAGGTGGCCAGGTAGTGGAGG + Exonic
1148731563 17:49839897-49839919 TCCAGCTGATATGCTGGTGGTGG + Exonic
1151466930 17:74291561-74291583 TGCAGTTGGTCAGCTATGGGAGG - Intronic
1153269635 18:3307410-3307432 TCCAACTGTCCAGATAGTGGTGG + Intergenic
1153408748 18:4770040-4770062 TACAGCTGGTCAGCCAGGTGTGG + Intergenic
1153770275 18:8409634-8409656 TGCAGCTGGCCAGCAGGTGGTGG - Intergenic
1154974292 18:21442126-21442148 TCCAGGTGGTCTACAAGTGGAGG + Intronic
1155082947 18:22428779-22428801 TCCAGCTGGCCAGGCAGTGTGGG + Intergenic
1159217179 18:65408292-65408314 TCCAGCTGGTTGGTTAGTTGTGG + Intergenic
1160155978 18:76434058-76434080 TCCAGCTGGTCAGGAACTGACGG + Intronic
1161975247 19:7604904-7604926 TCCAGCTGGCCTGGTATTGGGGG + Intronic
1163819648 19:19488682-19488704 GCCAGCGGGTCAGGGAGTGGGGG + Intronic
1164596979 19:29536692-29536714 TCCAGCTGGGCAGAGAGTGTGGG - Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1168342406 19:55632782-55632804 CCCAGCTGGTTAGCCAGTGTTGG - Intergenic
925584215 2:5446586-5446608 TCCAGCTGGAAAGCCAGAGGAGG - Intergenic
926797247 2:16629124-16629146 TCCAGCAGGTCCAGTAGTGGTGG - Intronic
927094365 2:19736426-19736448 TGCAGCTGGTCACATAGTGCAGG + Intergenic
928388088 2:30886401-30886423 TCCAGGTGGGCAGCGAGGGGAGG - Intergenic
929313317 2:40450716-40450738 TCCTGCTAGTCAGCTACTAGTGG - Intronic
931352562 2:61505124-61505146 CCCAGCTAGTCAGCTAGCTGAGG - Intronic
936038871 2:109133963-109133985 TCCAGCTGGTCAGCTAGTGGAGG + Intronic
937742372 2:125370846-125370868 TCAAACTAGTCAGCTAGTGAAGG - Intergenic
938696511 2:133840187-133840209 TCCCACTGGTCTGCTCGTGGTGG - Intergenic
943441860 2:187935221-187935243 GCCAGCAGCTCAGCAAGTGGGGG + Intergenic
1168828053 20:827241-827263 GCCAGCTAATCAGCTTGTGGTGG + Intergenic
1168973911 20:1949889-1949911 TCCCGCTGCTCAGAGAGTGGTGG - Intergenic
1178779891 21:35592554-35592576 TCCAGCTCTGCAGCTACTGGTGG - Intronic
1178901960 21:36605633-36605655 TGCAGCTGGAGAGCTGGTGGAGG + Intergenic
1181908161 22:26216203-26216225 CCCACGTGGTCAGTTAGTGGAGG + Intronic
1184813314 22:46852124-46852146 TGCAGCTGCTCAGCTATTTGGGG + Intronic
953676019 3:45003085-45003107 CCCAGCTGCTCAGGTAGGGGAGG + Intronic
953831508 3:46301568-46301590 ACCAGCTGGGGAGCTAGTAGAGG - Intergenic
954140841 3:48604522-48604544 TGCAGCTGGGCAACTAGGGGTGG - Intronic
955036403 3:55272449-55272471 TCCAACTGGTCTGCTAGTCCAGG + Intergenic
956982493 3:74654867-74654889 TGCAGATGGGCAGGTAGTGGGGG - Intergenic
958595709 3:96218862-96218884 TCCAGCTAGTAATCAAGTGGTGG - Intergenic
961983304 3:131104276-131104298 CCCACCTGATCAGTTAGTGGTGG - Intronic
963529020 3:146450126-146450148 ACCAGATGGGCAGGTAGTGGCGG + Intronic
964116097 3:153137835-153137857 TCCAGGTGGTAAGAAAGTGGGGG + Intergenic
965201067 3:165658117-165658139 TCACGCTGGTGAGCTAGTGGCGG - Intergenic
973571344 4:52242895-52242917 TCCAGCAGGACAGTGAGTGGGGG - Intergenic
983457944 4:167987198-167987220 TCCATGTGGATAGCTAGTGGTGG + Intergenic
992099655 5:73394761-73394783 TCCCGCTGGTCAGCTCCTCGAGG + Intergenic
993990078 5:94645661-94645683 TCCAGCTGCTGAAATAGTGGAGG + Intronic
997737171 5:136221964-136221986 TCCAGCTTGTCAGTTTGTTGGGG - Intronic
998325910 5:141279709-141279731 ACCAGCAGACCAGCTAGTGGAGG + Intergenic
999122046 5:149217269-149217291 TCCAGCTGGGCAGCGGGTGGAGG - Intronic
1001337660 5:170813404-170813426 TCCAGCTGGTCTGCTATGAGTGG + Exonic
1001519343 5:172379664-172379686 GCCAGCTGCTCAGGAAGTGGCGG - Intronic
1006101768 6:31690008-31690030 TCCCTCTGGTCAGCCATTGGAGG - Intronic
1012627440 6:101421171-101421193 TCTACTTGGCCAGCTAGTGGAGG - Intronic
1017072339 6:150586690-150586712 TCCAAGTGGCCAGCTTGTGGGGG + Intergenic
1017767154 6:157616262-157616284 TCCAGGTGGTCAGCAGGAGGTGG - Intronic
1017810979 6:157983018-157983040 TACAGCTGGACGCCTAGTGGTGG - Intronic
1022662850 7:32382494-32382516 TCCAGATGGTCAGCATCTGGAGG - Intergenic
1023345747 7:39269499-39269521 TCCAGCTTGTCAGCTGGTGGAGG - Intronic
1029458853 7:100684230-100684252 TCCAGCTGGTCAGCAGGTATGGG - Exonic
1037796797 8:22002265-22002287 TCCAGCAGGTAAGAAAGTGGAGG + Exonic
1038006974 8:23439602-23439624 TCTCCCTGCTCAGCTAGTGGGGG + Intronic
1042216933 8:66436978-66437000 GCAGGCTGGTTAGCTAGTGGAGG + Intronic
1047012079 8:120683563-120683585 TGCAGTGGGTCAGGTAGTGGTGG + Intronic
1047764049 8:127975974-127975996 TCCAGCTGGAGAGCTAGGGAGGG - Intergenic
1049225403 8:141448354-141448376 TCCAGGTGGACAGCTAGGGGAGG - Intergenic
1049779874 8:144424037-144424059 GCCAGACGGTCAGCCAGTGGTGG - Exonic
1050653515 9:7799338-7799360 TGCCGCTGGTCAGGTGGTGGGGG - Intronic
1051593093 9:18796274-18796296 CACAGCTGCTCTGCTAGTGGCGG + Intronic
1053230830 9:36407634-36407656 TACAGCAGGCCATCTAGTGGAGG - Intronic
1056968910 9:91186639-91186661 TCCAGGTGATCAGCTTATGGTGG - Intergenic
1058689944 9:107511352-107511374 TCCAGCGGTGCAGCTTGTGGTGG + Intergenic
1058868589 9:109183483-109183505 AACAGCTGATCAGGTAGTGGTGG + Intronic
1060549196 9:124477167-124477189 ACCAGCTGGACAGCTGATGGGGG + Intronic
1061059450 9:128243315-128243337 TCCAGCTGGCCAAGGAGTGGGGG + Intronic
1062616302 9:137397825-137397847 TCCAGCTACTCAGCAAGCGGAGG + Intronic
1185507003 X:639045-639067 TCCAGCTGGTCTGTCTGTGGAGG + Intronic
1193995855 X:88365390-88365412 TCCTGCTGTCCTGCTAGTGGAGG + Intergenic
1194102524 X:89723650-89723672 TCCATCTGCTGAGCTGGTGGTGG + Intergenic
1200455111 Y:3380927-3380949 TCCATCTGCTGAGCTGGTGGTGG + Intergenic