ID: 936039771

View in Genome Browser
Species Human (GRCh38)
Location 2:109141353-109141375
Sequence CTGAGCAAGTTGGAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936039771_936039778 9 Left 936039771 2:109141353-109141375 CCCTCTTCCTCCAACTTGCTCAG 0: 1
1: 0
2: 0
3: 40
4: 361
Right 936039778 2:109141385-109141407 GGGCTCAGAGCCTCACTCACAGG 0: 1
1: 0
2: 1
3: 25
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936039771 Original CRISPR CTGAGCAAGTTGGAGGAAGA GGG (reversed) Intronic
900200198 1:1401256-1401278 CTGCGCAGGTTGGAGGTAGGTGG + Intronic
901141388 1:7034839-7034861 CTGGCCAAGATGGAGTAAGAAGG - Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901857094 1:12051578-12051600 CTGAGCAACTTGGAGCCAGCTGG - Intergenic
902781980 1:18710929-18710951 CTTAGCAGGTTGTAGGAACATGG + Intronic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
903173682 1:21568670-21568692 CTGGGCAAGTAGGAGGATGGAGG + Intronic
903473301 1:23602415-23602437 CTGTGCAGGGTGGAAGAAGAGGG - Intronic
904150525 1:28435112-28435134 GGGAGCAAGTTGGAAGAAGCAGG - Intronic
906374185 1:45281470-45281492 CTGAGAAAGTTGGAGAGAGGGGG - Intronic
906606876 1:47179049-47179071 CTGAGCAAATTGGAAGACGATGG - Intergenic
906741581 1:48190137-48190159 AGGAGGAAGCTGGAGGAAGAAGG + Intergenic
907606578 1:55823911-55823933 CAAAGCAAGTGGGAGGCAGATGG + Intergenic
908760031 1:67503212-67503234 CTTACCAAGCTGGGGGAAGATGG + Intergenic
909242834 1:73237423-73237445 TAGAGCAATTTGGAGGAAGATGG - Intergenic
909883856 1:80915269-80915291 GTGAGCAAAATGGAGGAAGAAGG - Intergenic
910876815 1:91885910-91885932 CGCAGCAAGTTGGAGGAAAGCGG + Exonic
911051021 1:93671406-93671428 CTGAGCAAGATAGAGGAGGCAGG + Intronic
911381510 1:97120782-97120804 CTCAGCAAGTTGAAGAAATATGG + Intronic
911503329 1:98716282-98716304 CTGCCCAAGTAGGATGAAGAGGG - Intronic
912446739 1:109742110-109742132 CTGATCAAGTAAGATGAAGATGG + Intronic
912456746 1:109803258-109803280 CAGAGCAAGGTGGAGAAAGTTGG - Intergenic
912924728 1:113904226-113904248 CTGAACAGGTTTGAGGAAGACGG + Intronic
914521740 1:148423645-148423667 CTGGCCAAGTTGGAGTAATAGGG - Intergenic
914665923 1:149832499-149832521 CTGAGCAGAGTGGAGGAGGAGGG + Intergenic
914669842 1:149861295-149861317 CTGAGCAGAGTGGAGGAGGAGGG - Intronic
914911096 1:151787607-151787629 CTGAGCACGTTGGGGACAGAAGG + Intronic
915875918 1:159612158-159612180 ATGAAAAAGATGGAGGAAGAGGG - Intergenic
915924560 1:160005921-160005943 GGGAGAAAGTTGGAGGAAGAGGG - Intergenic
916491482 1:165306151-165306173 ATGAACAGGTGGGAGGAAGAAGG - Intronic
916493784 1:165326736-165326758 CTGAGCAAGTTTGGGGGAAATGG - Intronic
917023840 1:170619810-170619832 GTGAGCATGCTGGAGGCAGAAGG - Intergenic
917533864 1:175860762-175860784 CTGAGGAAGTTGGAGGAATGTGG - Intergenic
917665143 1:177218899-177218921 ATCAGCAAGATGGTGGAAGAAGG - Intronic
918246539 1:182665198-182665220 CAGAGCAGGGTTGAGGAAGAGGG - Intronic
918534654 1:185560815-185560837 CTCAGCAAGGTGGAGAAGGATGG - Intergenic
919414294 1:197287829-197287851 CTGAGCAAGATGGAGTAGGTGGG + Intronic
920405570 1:205706999-205707021 CTTAGCAATCTAGAGGAAGAGGG + Intergenic
920722811 1:208403402-208403424 CTGGACAAGATGGAGTAAGAAGG + Intergenic
921752669 1:218815243-218815265 CTGAGCCAGTAGAAGGAACATGG + Intergenic
922460936 1:225813859-225813881 CTGAGCAAGCTTGCAGAAGAGGG + Intronic
924213657 1:241796123-241796145 CTGAGCAACTGGGAAGAAGGGGG + Intronic
1063818224 10:9802006-9802028 CTGGCCAAGTTAGAGAAAGAGGG - Intergenic
1065368013 10:24953230-24953252 TGGAGAAAGGTGGAGGAAGATGG - Intergenic
1066616416 10:37299539-37299561 CTGGGCAAGTTTGAGGAGCATGG - Intronic
1067046818 10:42989809-42989831 AGGAGCAGGTTGGAGGAAGGTGG - Intergenic
1068562475 10:58530838-58530860 GTCAGCAAGATGGAGGAATAGGG + Intronic
1069905149 10:71727827-71727849 CTGAGCAAGTGGGAGCAACTGGG - Intronic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070046918 10:72847288-72847310 CTGATCAAGTTGGGGGAACCTGG + Intronic
1070085430 10:73232433-73232455 CTGAGCAAGTTGGAGCTGGCAGG - Intronic
1070169783 10:73924198-73924220 CTGAGCCAGCTGGAGGAGGGAGG - Intergenic
1070406374 10:76101017-76101039 CTGAACCAGTGGGAGGAAGATGG - Intronic
1070717843 10:78735373-78735395 CTGAGCAAGTTGTGGGAGAAGGG - Intergenic
1070933055 10:80274261-80274283 CTGAGCAACTGGGAGGCAGGCGG - Intronic
1072069136 10:91899738-91899760 CAGGGCAAGTAGGAGGAAGGAGG - Intergenic
1078187206 11:9062165-9062187 CTGAAGGAGTTGGGGGAAGAGGG - Intronic
1079025828 11:16946870-16946892 CTGATCAAAGTGGAAGAAGAAGG + Intronic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1080562891 11:33480227-33480249 CTGAGAGAGTTGGAGGAAAAAGG - Intergenic
1081372164 11:42317190-42317212 CTAAGCAAGCTGGAGTAATAGGG - Intergenic
1081492720 11:43580166-43580188 CCGAGCGGGATGGAGGAAGAGGG + Intronic
1081580492 11:44348496-44348518 CTGAGCAAGTTAGAGGCTGAGGG - Intergenic
1083756400 11:64793957-64793979 GTGAGCACGTTGCAGGAAGGGGG + Intronic
1085129551 11:74026394-74026416 CTGAGGAGGTTGGAAGAGGATGG + Intronic
1085385721 11:76157131-76157153 CTGAGCACCTTGGAGCAGGAAGG + Intergenic
1085498037 11:76990425-76990447 CTGAGTAAGATGGGGGAAGCAGG + Intronic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087735318 11:101826382-101826404 CTGAGTAAGGTGTTGGAAGATGG - Intronic
1088824319 11:113481155-113481177 CTGATTGTGTTGGAGGAAGAGGG - Intergenic
1088855158 11:113743568-113743590 TTGAGCAAGGTGTAGGAAGTAGG - Intronic
1089186739 11:116622048-116622070 CTCAGCAAGTTAGAAGTAGAGGG + Intergenic
1089378597 11:118012100-118012122 TAGAGCAAGTGGGAGGAGGAGGG - Intergenic
1089612926 11:119679647-119679669 CTGAATAAATGGGAGGAAGAGGG - Intronic
1089697009 11:120222084-120222106 CTGTGAAGGTTGGAAGAAGAGGG + Intronic
1090873688 11:130770143-130770165 CTGAGCAGGTATGTGGAAGATGG - Intergenic
1090992016 11:131826284-131826306 CTTAGCATGTTGGCAGAAGAGGG + Intronic
1091047855 11:132341019-132341041 CTGAGGATGTAAGAGGAAGAGGG + Intergenic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1091619575 12:2076187-2076209 GTGAGCACGTTGGAGAAAGATGG - Intronic
1092292002 12:7165601-7165623 CTGATTAAGATGGGGGAAGAGGG + Intergenic
1092880979 12:12887809-12887831 CTGAGTTGGTTGGAGGAAGGCGG - Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1096077283 12:48813829-48813851 CTGAGCAACTTGGAGGTGGGTGG + Intronic
1096473597 12:51894983-51895005 CTGAGCAGGTTGGAGGTGGAGGG - Intergenic
1096618144 12:52846252-52846274 CTGAGCAAGATGGAGTTGGAGGG - Exonic
1096777170 12:53971397-53971419 CTGAGCAAGTTTGAGGAGGCAGG + Intergenic
1097273881 12:57798056-57798078 TTGAGGAAGTTGGAGCAAGAGGG + Intronic
1097976271 12:65690060-65690082 CTGACCAAGTTGGACAAAGCAGG + Intergenic
1098416925 12:70244127-70244149 CTGTGCATGGTGGAGGGAGAAGG + Intronic
1098426992 12:70375776-70375798 ATGACCAAGTTGGAGGAATAAGG - Intronic
1098498887 12:71167403-71167425 CTGAGTATGCTGGAGAAAGAAGG + Intronic
1099343881 12:81473491-81473513 CTGATGAAGCTGTAGGAAGATGG - Intronic
1100385202 12:94099666-94099688 GTGTGCAAGTTGCAGAAAGAAGG + Intergenic
1100818965 12:98413284-98413306 CAAAGCAAGATAGAGGAAGACGG + Intergenic
1101538720 12:105644731-105644753 CTGAGCCAGTTGCAAGAATAGGG + Intergenic
1101649058 12:106658515-106658537 CTGAGCCACAAGGAGGAAGAAGG - Intronic
1102512088 12:113422583-113422605 CTGAGCAGGTGGGAGTGAGAGGG + Intronic
1102609402 12:114098185-114098207 CTGAGCCACCTGGAGGAAGATGG + Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1106861549 13:33914399-33914421 AGGAGCAAAGTGGAGGAAGAAGG - Intronic
1107145778 13:37059440-37059462 CAGAGCCCGCTGGAGGAAGACGG - Intronic
1107652849 13:42561942-42561964 CTGAGCATGGTGGTGGCAGAAGG - Intergenic
1107999667 13:45894706-45894728 CAGAGGAAGATGGCGGAAGATGG - Intergenic
1108613234 13:52104848-52104870 TTGAGCAATTTGGAGGAGGCAGG + Intronic
1109118333 13:58419709-58419731 TTGATTTAGTTGGAGGAAGAAGG - Intergenic
1109298697 13:60567513-60567535 CTTTGCAAATAGGAGGAAGAAGG + Exonic
1110646226 13:77888058-77888080 CTGACAAAGTTTGAGGAAGTGGG - Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1111375932 13:87379311-87379333 CTGATCAAGGGGGAAGAAGAGGG + Intergenic
1111641254 13:90973414-90973436 TTGAGAAACTTGGAGGAAGGAGG + Intergenic
1111896621 13:94150114-94150136 TTGAGCAACTTAGAGGCAGATGG - Intronic
1113447703 13:110382385-110382407 CTGGGGAAGTGGGCGGAAGACGG - Intronic
1113606052 13:111607037-111607059 GTGAGAAAGTTTGATGAAGAGGG - Intronic
1113627661 13:111858486-111858508 CAGAGCAAGACGGAGGAAGGAGG - Intergenic
1114251674 14:20967144-20967166 CTGGGAATGTTGGGGGAAGAAGG + Intergenic
1114683709 14:24507919-24507941 CAGAGCAAGTGGAAGGAAAAGGG - Intronic
1115735139 14:36320104-36320126 AAGAGTAAGTTGGAGGAAAAAGG + Intronic
1117293561 14:54357352-54357374 CTGAGCTGGTTGGAGGAGCAGGG - Intergenic
1118338882 14:64879061-64879083 AAGACCAAGTTAGAGGAAGAGGG + Intronic
1119030749 14:71190410-71190432 CATAGCAAGTTGGAGGAAGTTGG - Intergenic
1119461008 14:74803729-74803751 ATCAGCAAGATGGAGCAAGATGG - Intronic
1120904546 14:89608992-89609014 CTGTACAACATGGAGGAAGAAGG + Intronic
1121644007 14:95505267-95505289 CTGGGGAAGGTGGAGCAAGAGGG + Intergenic
1121686863 14:95842126-95842148 CTGACCTAGTTGGAGAGAGAGGG + Intergenic
1122095064 14:99364440-99364462 CTCTGCAAGTTGAAGGAAAAGGG + Intergenic
1122128076 14:99589958-99589980 CTGAGCAGGAAGGAGGCAGAGGG - Intronic
1122579424 14:102762295-102762317 GTGAGCAGGTTGGGGGAGGAAGG + Intergenic
1122656912 14:103268173-103268195 CTGAGCAAGCTGGAGGCCCAAGG - Intergenic
1122909233 14:104818840-104818862 CTGGGCAAGTGGGAGGGAGGGGG + Intergenic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1125929333 15:43589462-43589484 CATAGCAAGTTGGGGAAAGAAGG - Intronic
1125942500 15:43689294-43689316 CATAGCAAGTTGGGGAAAGAAGG - Intergenic
1126837961 15:52686888-52686910 CTGTGCAAGTTGAAATAAGAAGG - Intronic
1127044765 15:55013866-55013888 CTAACCAAATTGGAGGAAGATGG - Intergenic
1127221093 15:56881956-56881978 CTATGCAGGTTGGAGGAAGAAGG + Intronic
1127270649 15:57398454-57398476 CTGTTCTATTTGGAGGAAGAGGG + Intronic
1127908404 15:63394963-63394985 CTGGGCAACTAGGAGGATGATGG - Intergenic
1128359387 15:66950473-66950495 TAGAGCAATTTGGAGGAATAAGG - Intergenic
1128646221 15:69380634-69380656 CTGAGAAAGGTGGGGGATGAAGG + Intronic
1130939926 15:88498822-88498844 CTGAGAGACTTTGAGGAAGAGGG - Intergenic
1132142707 15:99408342-99408364 CTGAGTTGGTTGGAGGGAGAGGG + Intergenic
1132724131 16:1331552-1331574 CAGAACAAGTTGGAGAATGAAGG + Intergenic
1133783493 16:8957258-8957280 TTAAGAAAGTTGGAGGAAGCAGG - Intronic
1135178887 16:20255763-20255785 GTGGGCAAGGAGGAGGAAGAAGG - Intergenic
1138986125 16:62330816-62330838 GTCAGCAAGATGGTGGAAGAGGG - Intergenic
1140229591 16:73106643-73106665 CTGTGCAAGTTGGAAAAAGCTGG + Intergenic
1140617121 16:76678906-76678928 CTGAGGACCTTTGAGGAAGAGGG + Intergenic
1142548308 17:720935-720957 CTGAGGGAGTTGGGGGAGGATGG + Intronic
1142698253 17:1645196-1645218 CTGCGCAGGCTGGAGGCAGAAGG - Exonic
1143916225 17:10295276-10295298 TTGAGCACGTTGGAGAAAGGTGG + Intergenic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1144494291 17:15736905-15736927 CTGGGCAGGATGGGGGAAGATGG + Intronic
1144905974 17:18639771-18639793 CTGGGCAGGATGGGGGAAGATGG - Intronic
1145030475 17:19501271-19501293 CTGAGCAAGGTGGTGGTACAGGG + Intronic
1146648363 17:34590438-34590460 CAGAGCATTGTGGAGGAAGAGGG + Intronic
1148327194 17:46790134-46790156 CTGATGAAGTTGGGGGAAGGAGG - Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1148666953 17:49382186-49382208 CTGAGGAAGTTGGAGGAGAAAGG - Intronic
1150206619 17:63413596-63413618 TTGAGCAAGCTGATGGAAGAGGG + Exonic
1150688397 17:67340188-67340210 CTGATCAAGTGAGAGGATGAGGG + Exonic
1150887965 17:69109672-69109694 CTGAGCAAGATGGAGTGTGATGG - Intronic
1151125388 17:71839226-71839248 CTGAGAGAGATGAAGGAAGATGG - Intergenic
1151346261 17:73503973-73503995 CTGAGCGACTTGGAGGAAAGAGG + Intronic
1151531841 17:74711601-74711623 CTGGGCACGTCTGAGGAAGAGGG - Intronic
1152796735 17:82311278-82311300 CTGAGAAAGTACGAGAAAGAAGG + Intergenic
1153455798 18:5280825-5280847 CAGAGCAAGTAGGAGGGAGGAGG - Intergenic
1153911598 18:9709729-9709751 CTGAGCAAGTCGGGGGAGGTGGG - Intronic
1154936853 18:21068404-21068426 AAGAGCAAGTTGGAGGATTAAGG - Intronic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1155123798 18:22850320-22850342 CTAAGCAAAATGTAGGAAGATGG - Intronic
1157453290 18:47803941-47803963 GTGACCAAGTTTCAGGAAGATGG - Intergenic
1157487717 18:48100441-48100463 ATTAGCAAGCTGGAGGAGGAAGG - Intronic
1159449815 18:68585491-68585513 CAGAGCAGGTTGGAGAAAGTTGG + Intergenic
1160274017 18:77413633-77413655 CTGAGCCTGCTGGAGGATGATGG + Intergenic
1160398345 18:78588652-78588674 CAGAGCAAGCTGGAGAATGAGGG + Intergenic
1160758805 19:772171-772193 CCTGGCAAGTTGGAGGAACAGGG - Intergenic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1164231919 19:23296888-23296910 CTGAGGATGATGGAGGAAGGGGG + Intergenic
1164348382 19:27297324-27297346 CTGAGCAATTTGGCAGGAGAAGG + Intergenic
1164620147 19:29690659-29690681 ATGAGGCAGTTGGAGGGAGAGGG + Intergenic
1165660247 19:37572400-37572422 TTGAGCAAGATGGAGTAGGATGG - Intronic
1165789441 19:38482838-38482860 CTGGGAAAGTTGGAGGAGGTTGG + Intronic
1166354282 19:42217733-42217755 CTGCGCGAGTTGGGGGAAGGAGG - Intronic
925593207 2:5530276-5530298 GTGAGCAGGCTGGAGGAAGGAGG - Intergenic
925721822 2:6836952-6836974 CTAAGCAAGTTGAAGGCACATGG - Intergenic
927220740 2:20706644-20706666 CTGAACAAGATGGAGTAAGAGGG + Intronic
927269978 2:21196529-21196551 CTGAGAAAGTTTTAGGCAGAAGG - Intergenic
927339499 2:21966331-21966353 CTGAGCAAGCAGCAGGAACAAGG + Intergenic
927457764 2:23271848-23271870 CTGAGCAGGATGGAGTAACAGGG - Intergenic
929034533 2:37678042-37678064 CTGAACAGGTTGGAGCCAGAGGG + Intronic
931907932 2:66862774-66862796 CTGAGCAAGTTGAAGGGATGGGG + Intergenic
932452916 2:71827279-71827301 TTGAGCAAGATGGTGGAAGGTGG - Intergenic
932459975 2:71875813-71875835 CTGGGCTAGCTGGAGGGAGAGGG + Intergenic
932500282 2:72177193-72177215 GTGAACAAGGTGGAGGAATAGGG - Exonic
932736962 2:74261004-74261026 AGGAGCAAGGAGGAGGAAGAGGG - Intronic
933271250 2:80235482-80235504 CTGAGGAAGTTGTGGGAAGCAGG + Intronic
933943938 2:87268106-87268128 CTGAGAAAGACGGGGGAAGAAGG + Intergenic
934067179 2:88350890-88350912 CAGAACAAGTGGCAGGAAGAAGG - Intergenic
935493775 2:103752883-103752905 CTCTGCAACTTGGAGCAAGAAGG + Intergenic
935493931 2:103754861-103754883 CTCTGCAACTTGGAGTAAGAGGG - Intergenic
936039771 2:109141353-109141375 CTGAGCAAGTTGGAGGAAGAGGG - Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936336282 2:111593473-111593495 CTGAGAAAGATGGGGGAAGAAGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937841761 2:126531715-126531737 ACAAGCAAGTTGGAAGAAGAAGG - Intergenic
939446454 2:142315685-142315707 CTGTGTAAGTTTGAGGAAGCAGG - Intergenic
940255483 2:151724024-151724046 CTGAGCAACCTGGGGGCAGAGGG - Intronic
940277677 2:151956513-151956535 CTGAGAGAGTTGGAAGGAGATGG + Intronic
943046156 2:182864782-182864804 CTGCGCAAGTTGAAAGAGGAAGG + Intronic
943398816 2:187377980-187378002 AGAAGGAAGTTGGAGGAAGAAGG + Intronic
944382859 2:199131716-199131738 CTTAGAAAGTAGGAGTAAGAGGG - Intergenic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
945683854 2:212945738-212945760 CTGAGAAATTGGTAGGAAGACGG - Intergenic
945846976 2:214957311-214957333 CTGAGGAGTTTGCAGGAAGATGG + Intronic
946087300 2:217186906-217186928 CTGGGGAAGCTGGAGGAAGCAGG - Intergenic
946091894 2:217233924-217233946 CTGAGCCTGTTGGAGATAGAAGG - Intergenic
946095827 2:217273450-217273472 CTGGGGCAGTTGGAGGAGGATGG - Intergenic
946407779 2:219501298-219501320 ATGAGGAATTTGGAGGAAGTCGG - Intronic
946539947 2:220673286-220673308 CTGAGCAGGGTTGAGGCAGATGG + Intergenic
947502513 2:230681768-230681790 GTGAGCAAATTGGAGCAAGAGGG + Intergenic
948667231 2:239544254-239544276 ATGAGCCAGTTGGAGCATGAAGG - Intergenic
1171195837 20:23198591-23198613 CTGTGCAAGATGGAGTAACAGGG - Intergenic
1171973757 20:31580820-31580842 CTGAGCAAATTGGAAGAAGCTGG - Intergenic
1172873767 20:38151883-38151905 CTGAGGAAGTTGGGGCAAGATGG + Intronic
1175187852 20:57190746-57190768 TTGAGCTTGTTGGAGGAGGAGGG - Intronic
1175242711 20:57561580-57561602 CTGGGCCAGATGGAGGAAGAGGG + Exonic
1177055571 21:16297351-16297373 CTGAGCAATTGGGTGGATGAGGG - Intergenic
1178345936 21:31828044-31828066 CTGGACAAGATGGAGAAAGAGGG + Intergenic
1178383130 21:32128252-32128274 CTCAACAACTTGGAGGAAAAGGG - Intergenic
1178882480 21:36460453-36460475 GTGGGGACGTTGGAGGAAGACGG - Intergenic
1178982499 21:37276694-37276716 CTGAACAATATGGAGAAAGAAGG + Intergenic
1179353037 21:40631490-40631512 CTGAGTCAGCTGGAGGAAAACGG - Intronic
1180837056 22:18935159-18935181 CGGAGGATGGTGGAGGAAGAAGG - Intronic
1181064901 22:20300864-20300886 CGGAGGATGGTGGAGGAAGAAGG + Intergenic
1181971198 22:26691365-26691387 CTGGGTAGGTTGGAGGAGGATGG + Intergenic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1183338086 22:37262417-37262439 GGTAGAAAGTTGGAGGAAGAGGG - Intergenic
1184345200 22:43908888-43908910 CTGAGCATGGTGGAGGGAGTCGG - Intergenic
1185412254 22:50689022-50689044 CTGACAGAGTTGGAGGGAGAGGG - Intergenic
1203287149 22_KI270734v1_random:160458-160480 CGGAGGATGGTGGAGGAAGAAGG - Intergenic
949125092 3:437622-437644 CTAAGCAAGTTGTGGGATGAAGG - Intergenic
949218738 3:1603326-1603348 CTTAGGAAATTGGAGAAAGAAGG - Intergenic
950004970 3:9685737-9685759 CTGAGCACATTGGAAGAGGAAGG - Intronic
950141056 3:10615657-10615679 ATGAGCAAGTTGGATGTGGATGG - Intronic
951379604 3:21967795-21967817 GGGAGGAAGTTGGAGTAAGATGG + Intronic
951494373 3:23309906-23309928 TAGAGGAAGGTGGAGGAAGATGG + Intronic
952181136 3:30917813-30917835 CAGAGCAGGGTGGAGAAAGATGG - Intergenic
956946792 3:74232463-74232485 CTTTGCATGGTGGAGGAAGAGGG + Intergenic
957380289 3:79419175-79419197 TTGAGCAAGTTTGAGAGAGAGGG + Intronic
957693526 3:83602300-83602322 CTGAAAAAGTTGGAAGAAAAAGG - Intergenic
957975419 3:87437252-87437274 CAGAACAAGATGTAGGAAGAGGG + Intergenic
958564655 3:95794261-95794283 CTTAGCATGTTTGAGGAAAAGGG - Intergenic
960242481 3:115361704-115361726 CGAAGCAAGTGAGAGGAAGAGGG + Intergenic
960530567 3:118759401-118759423 CAGAGCAATTTGTAGGAAAATGG - Intergenic
960622075 3:119646811-119646833 ATGGGCAAGTTGGACCAAGAGGG + Intronic
962385374 3:134928517-134928539 TTGAGCAAGTGGGTGGATGATGG + Intronic
962479605 3:135787111-135787133 CTGAGCATGGTGGAAGAAGAGGG - Intergenic
962776823 3:138669051-138669073 CTCAGAGGGTTGGAGGAAGAAGG - Intronic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
962979407 3:140474201-140474223 CTCAGCAAGGTGTAGGGAGATGG - Intronic
963001546 3:140686354-140686376 CTGAGCCAGTGTGAGGAAGGAGG + Intronic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
964408924 3:156378521-156378543 CAGAGAAAGGTTGAGGAAGAAGG - Intronic
965395342 3:168155016-168155038 CTGAGGGAGTTGGAGTCAGAAGG + Intergenic
966470386 3:180282473-180282495 CTGAGCAAGGTAGAGCAATATGG + Intergenic
967133956 3:186497415-186497437 ATAAGCAAGATGGAGGAATAGGG + Intergenic
967780361 3:193432170-193432192 TTGAGAAGGTTGGAGGAAGTAGG + Intronic
967865058 3:194183344-194183366 CTGAGCCAGATGGAGCAAGTTGG + Intergenic
968426008 4:523762-523784 CTGAGCACTTCGGAGGTAGAGGG - Exonic
968946030 4:3664794-3664816 CTGTGCAAGTTGGAGGCAGTTGG + Intergenic
969401338 4:6957653-6957675 CTTAGAAAGTTAGAGGGAGAAGG + Intronic
970158796 4:13168621-13168643 CAGAGAAAGTTGTAGGAAGGAGG - Intergenic
970641888 4:18075988-18076010 CTGAGCGTGGAGGAGGAAGAGGG + Intergenic
970651895 4:18187921-18187943 CTGAGGATGGTGGAGGGAGATGG - Intergenic
970900823 4:21157406-21157428 CTGATCAAGATGGAGTAACAGGG + Intronic
970990950 4:22212494-22212516 CTGAAAAAGCTGGAGGAAGTGGG - Intergenic
971284948 4:25280110-25280132 CCAAGCAAGTTGGTGAAAGAAGG - Intergenic
971811068 4:31427927-31427949 GAGAGCAAGTTGCAGGAACAGGG + Intergenic
972802569 4:42492522-42492544 CTGTGCATGATGGAAGAAGAAGG - Intronic
974908132 4:68082405-68082427 CAGAGCTATTTGGAGGAAGGGGG - Intronic
975053583 4:69898297-69898319 GTGTGCATGGTGGAGGAAGATGG - Intergenic
975335303 4:73169502-73169524 CTGAGATAGATGGAGTAAGATGG + Intronic
975445014 4:74453395-74453417 CTGAGCATGTTGTAGGTATAAGG + Intronic
975624715 4:76334043-76334065 CTGAGCAAGACAGAGGAAGATGG - Exonic
975798958 4:78038676-78038698 CTGGGAAAGGTGGAGTAAGAAGG + Intergenic
976106868 4:81628340-81628362 CTGGGAAAGTTGGAAGCAGAAGG - Intronic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
978743952 4:112170615-112170637 CCGAGCAGGATGGAGCAAGATGG + Intronic
978831097 4:113085780-113085802 CTGAGAAATTTGGAGGAAGGGGG + Intronic
980121957 4:128736947-128736969 GTGAGCAAGTTAAAGGAAAATGG + Intergenic
981155807 4:141433427-141433449 CTGAGAAGGTTGGAGGCAGGAGG - Intergenic
981583224 4:146271776-146271798 CTTGGCATGTTGGAGGAAGGAGG - Intronic
981805057 4:148705580-148705602 CTGTGCCAGTTAGAGGAAAAGGG - Intergenic
982108744 4:152033990-152034012 ATGGGCAAGGTGGAGAAAGAGGG + Intergenic
983178669 4:164622314-164622336 TTGAGCAAGTTTGAGTCAGATGG - Intergenic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
984410027 4:179386186-179386208 CTGAGCATCTTCAAGGAAGAGGG - Intergenic
985320947 4:188710664-188710686 CTGAACAATTTGGAGGCAGAAGG - Intergenic
985588799 5:754384-754406 CTGAGCATGGTGGAGGCACAAGG - Intronic
986374361 5:7115038-7115060 CTGAGCAAGATGAAGCAACAGGG + Intergenic
986677739 5:10201622-10201644 GCCAGCAAGTTGGAGGAAAAAGG - Intergenic
986706931 5:10460305-10460327 TTGAGCAAGTTGGAGGTGGGAGG + Intronic
988611960 5:32735245-32735267 CAGAGCCAGATGGAGGAGGAGGG - Intronic
988655098 5:33202216-33202238 CTGAGAGAGTTCGAGGAAAATGG - Intergenic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
993826185 5:92690020-92690042 TTAAGCAATTTGGAGGAAGCAGG + Intergenic
994002011 5:94791871-94791893 CTGAGAAAGGTGCTGGAAGAGGG - Intronic
994833273 5:104813584-104813606 CTGAGTAAGTTGGAAGAGGAAGG - Intergenic
996285302 5:121783971-121783993 GAGAGCAAGTTGGAGAAAGAAGG + Intergenic
997766308 5:136507095-136507117 CTAGGCAAGATGGAAGAAGAAGG - Intergenic
999180640 5:149667782-149667804 ATGAGCAGGTTGGTGGAAGGAGG + Intergenic
999519661 5:152338208-152338230 AGGTGCAAGTTGGAGGAAGAAGG + Intergenic
1000207429 5:159075795-159075817 CTTGGCAAGTTGGAGGAAGGGGG - Intronic
1000552252 5:162681508-162681530 CTGAGCAAGTGGGTGGATGATGG + Intergenic
1000887077 5:166759396-166759418 CTAAGAAAGTTGGAAGAACATGG - Intergenic
1001209653 5:169798198-169798220 CCGAGGAAGTTGCAGGAGGAAGG - Intronic
1002169391 5:177366877-177366899 CTGAGCTAGCTGAAGGAGGAGGG - Exonic
1002469393 5:179426464-179426486 GGGAGCAAGGTGGAGGGAGAGGG + Intergenic
1003130664 6:3392756-3392778 CTGAGGATGTGGGAGGAAGGAGG + Intronic
1003961288 6:11211465-11211487 CTGAGCCAGTGTGAGGCAGAAGG - Intronic
1004297447 6:14426219-14426241 GTGAGAAAGTGGGAGGGAGAAGG - Intergenic
1005613244 6:27547223-27547245 CTGAACATGATGGAGGAAGTAGG - Intergenic
1005677008 6:28165036-28165058 GTGAGAAAGTGGGTGGAAGAGGG - Intergenic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1008117363 6:47567675-47567697 CTAAGCAAGTTTGTGGCAGAGGG + Intronic
1008554817 6:52664475-52664497 AGAAGCAAGTTAGAGGAAGAAGG + Intergenic
1008828294 6:55726547-55726569 CTGTGAAAAATGGAGGAAGAGGG - Intergenic
1009293496 6:61913853-61913875 CTGAGCATCTTTGAGGAACAGGG + Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1009715039 6:67380210-67380232 CTGAGAGAGAGGGAGGAAGAAGG + Intergenic
1009938901 6:70267059-70267081 GTGAGGAAGTTGGAGAAATAGGG - Intronic
1011467606 6:87674328-87674350 CTGACCAAGTTAGAAGAAAAAGG - Intergenic
1013033057 6:106355052-106355074 CTGTGCAGGTTGGAGAAAGTTGG + Intergenic
1013424672 6:109999956-109999978 CTGAGTAAGATGGAGGAACATGG - Intergenic
1014290469 6:119552177-119552199 CTGAGGAACTTGGGGGAGGAAGG + Intergenic
1014541242 6:122678935-122678957 GTCAGCATGATGGAGGAAGAGGG + Intronic
1014755168 6:125294750-125294772 CTGACCAAGGTGGAAGAAAATGG + Intronic
1015968879 6:138723420-138723442 CTGAGGAAGTTGAAAGTAGATGG - Intergenic
1016598765 6:145831878-145831900 GTGAGAAAGATGGAAGAAGAAGG - Intergenic
1018162264 6:161056747-161056769 CTGAGGAAGGTGAAGGAAAAAGG - Intronic
1021343869 7:19498452-19498474 CACAGCGAGTTTGAGGAAGAAGG + Intergenic
1021715861 7:23461522-23461544 CAGAGCAACTGGGTGGAAGATGG - Intronic
1022081597 7:27027571-27027593 CTGTTCTAGTTGGAGAAAGAAGG - Intergenic
1022185549 7:27964050-27964072 CAAAACATGTTGGAGGAAGAGGG - Intronic
1022923853 7:35040986-35041008 GAGAGCAAGTAGGAGGAAAAGGG - Intergenic
1023082621 7:36539415-36539437 CTGAGCAAGGAAGAGGAACAGGG - Intronic
1023570290 7:41564881-41564903 CTGAGCCATTTGGAGAAGGAAGG + Intergenic
1024229528 7:47353749-47353771 CTGAGGAGGGTGGAGGAGGAGGG - Intronic
1026647916 7:72188820-72188842 CTGAGAAGGTGGGAGAAAGACGG - Intronic
1029964048 7:104719990-104720012 CTGAGAGCGATGGAGGAAGATGG + Intronic
1030488787 7:110205083-110205105 CTGAGAGGGTTGGAGCAAGATGG - Intergenic
1031419080 7:121528080-121528102 CTGAGAAAGTTGGAGTAAAGGGG - Intergenic
1032082355 7:128866056-128866078 CCGAGCAAGGTGGGGGAAGCAGG - Intronic
1033116136 7:138627142-138627164 CTGTGATAGCTGGAGGAAGATGG + Intronic
1033141668 7:138832533-138832555 CTGAAAAACCTGGAGGAAGAAGG + Intronic
1033628866 7:143138056-143138078 CTGAGCAAGCTGCAGGAGGTGGG + Intronic
1035623070 8:1049350-1049372 CTGAGCAAGTCACGGGAAGAAGG - Intergenic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1038251686 8:25911049-25911071 CTGAGCATGGTGGATGGAGAGGG - Intronic
1039954779 8:42198636-42198658 GTGAGCAAGCTAGAGGAGGAGGG + Intronic
1041778433 8:61550839-61550861 CTGAGCAAGAGGGAGGGTGAGGG + Intronic
1046903530 8:119547683-119547705 CTGATCAAGATGGACTAAGAGGG + Intergenic
1049130973 8:140840482-140840504 ATGTGTAAGTTGGAAGAAGATGG + Intronic
1050007911 9:1153153-1153175 CTTAGCAAGTTGGAAATAGAAGG + Intergenic
1050110934 9:2215133-2215155 CTTAGCAATATGCAGGAAGAAGG - Intergenic
1050334129 9:4574430-4574452 TTGAGCAAGTAGGAGCAGGATGG + Intronic
1050430794 9:5559687-5559709 CAGACCAAGTTGGAGGTAGCAGG - Intronic
1050796779 9:9556286-9556308 CTGAGTAAGTTGAAGAAAGGAGG + Intronic
1052856269 9:33408452-33408474 CTGAGAGAGGTGGAGGCAGAGGG - Intergenic
1053144505 9:35703379-35703401 CTGAGAAGGCTGGAGGAGGATGG + Intronic
1056713618 9:89010749-89010771 CTGAGAAAGTGTGGGGAAGAGGG + Intergenic
1057032277 9:91785015-91785037 CTGAGCAAGTGGGAAGATGCTGG - Intronic
1057176438 9:93003832-93003854 CTGAACCAGTTGGATGAAAAGGG + Intronic
1057424347 9:94936328-94936350 CTGAGCTACCTGGAGGGAGAGGG - Intronic
1058087222 9:100761518-100761540 CAGAGCATGTTGGAGCAAGAAGG + Intergenic
1059841519 9:118222749-118222771 CTGAGCAGCTTGGGGGACGATGG + Intergenic
1060652474 9:125340425-125340447 CTGTGTAACTTTGAGGAAGAGGG + Intronic
1061163777 9:128910999-128911021 CTCAGCAGGTTGGTGGAAGGAGG - Intronic
1061338476 9:129959818-129959840 CTGAGGAAGATGGAGGGTGACGG - Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061487608 9:130928362-130928384 CTGAGCAATTTGGAGTGAGGTGG + Intronic
1186229455 X:7437545-7437567 CTAAGCAAGATGGAGGAGGTAGG - Intergenic
1186496800 X:10017136-10017158 CTGTGCAGGTAGGAGGAAGCAGG - Intronic
1187071090 X:15889128-15889150 CTGAGCAAGTTGGCCGATGCTGG - Intergenic
1187294429 X:17985269-17985291 CTGAGGAAGTTGGAGTAAGCTGG - Intergenic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1189524099 X:41801378-41801400 CTGACCCCGTTGGAGGAAAAAGG - Intronic
1190109949 X:47583119-47583141 CTGAGGAAGTTTGAGGAATGAGG - Intronic
1190393046 X:49951683-49951705 TTGAGCTGGTTGGAGAAAGATGG + Intronic
1192694306 X:73398595-73398617 TAGAGCAACTTGGAGGATGATGG + Intergenic
1193772315 X:85602808-85602830 GTGAGCAGGTGGGAGGATGAGGG + Intergenic
1194039425 X:88921448-88921470 CTGAGCAGGATGGAGCAGGATGG + Intergenic
1194747371 X:97642854-97642876 TGCAGGAAGTTGGAGGAAGAAGG - Intergenic
1195390709 X:104359056-104359078 CTGTGCAAGTTGGAGGCAAGAGG + Intergenic
1196464582 X:115959087-115959109 AATAGGAAGTTGGAGGAAGATGG + Intergenic
1196596383 X:117550557-117550579 CTCAGAAAGGTGGAGGAAAATGG + Intergenic
1199194056 X:145006300-145006322 GTGAGCAAGTAGGATGAAAAGGG + Intergenic
1199892890 X:152105046-152105068 CTGGCCAAGATGGAGGAACAGGG + Intergenic