ID: 936040362

View in Genome Browser
Species Human (GRCh38)
Location 2:109145178-109145200
Sequence CTGTCTCAGAAGCAGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 381}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936040362_936040365 -5 Left 936040362 2:109145178-109145200 CCTTTCTGCTGCTTCTGAGACAG 0: 1
1: 0
2: 4
3: 24
4: 381
Right 936040365 2:109145196-109145218 GACAGAGCCGTGTCCTGGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 140
936040362_936040363 -10 Left 936040362 2:109145178-109145200 CCTTTCTGCTGCTTCTGAGACAG 0: 1
1: 0
2: 4
3: 24
4: 381
Right 936040363 2:109145191-109145213 TCTGAGACAGAGCCGTGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 170
936040362_936040368 11 Left 936040362 2:109145178-109145200 CCTTTCTGCTGCTTCTGAGACAG 0: 1
1: 0
2: 4
3: 24
4: 381
Right 936040368 2:109145212-109145234 GGCTGGGTCCTTCCTGACCACGG 0: 1
1: 0
2: 0
3: 21
4: 265
936040362_936040364 -6 Left 936040362 2:109145178-109145200 CCTTTCTGCTGCTTCTGAGACAG 0: 1
1: 0
2: 4
3: 24
4: 381
Right 936040364 2:109145195-109145217 AGACAGAGCCGTGTCCTGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936040362 Original CRISPR CTGTCTCAGAAGCAGCAGAA AGG (reversed) Intronic
900248095 1:1648774-1648796 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
900259314 1:1715931-1715953 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
900937869 1:5778282-5778304 CTGTATTAGAAGCATGAGAATGG + Intergenic
900942807 1:5811866-5811888 ATCTCTCATAAGCAGCAGACGGG + Intergenic
902080312 1:13816146-13816168 GTGTCTCAGAACCAGCCCAATGG + Intronic
902954638 1:19917157-19917179 CAGCCGCAGAAGCAGCAGCAGGG - Intergenic
903008742 1:20315694-20315716 GTGTCACGGCAGCAGCAGAAAGG + Intronic
903376903 1:22872248-22872270 ACATCTCAGAAGCAGCAGCAGGG + Intronic
905907490 1:41628606-41628628 CTTTCACAGAGGCACCAGAAAGG + Intronic
905915679 1:41682718-41682740 AGGTCTCAGAGGCAGCAGGAGGG - Intronic
907209701 1:52809704-52809726 CTGTCTCAGACCCATTAGAATGG - Intronic
907358716 1:53897533-53897555 CAGTCTCAGCTGCAGCAGCAGGG - Intronic
909226398 1:73029813-73029835 ATGACTCAGAAACATCAGAACGG + Intergenic
909266482 1:73565093-73565115 CTCTCTGGGAAGCAGCACAAGGG + Intergenic
910051452 1:82978825-82978847 CTGCCTCAAAAACAGGAGAAGGG - Intergenic
910374310 1:86552496-86552518 ATTTCTCAGAATCAGCAGACAGG + Intronic
910678477 1:89839171-89839193 GTGTTACAGAAGCAGCAGCAGGG - Intronic
911122236 1:94308327-94308349 ATGTCTCTGAAGCAGCGGATGGG - Intergenic
911151642 1:94602067-94602089 CTGTGGCAGATGCAGCAGGAAGG + Intergenic
911395926 1:97309895-97309917 GGGTCTCAAAAGCAGCAGGATGG - Intronic
914885899 1:151584235-151584257 TTGGCTGAGAAGCAGGAGAAGGG - Intergenic
915058814 1:153162451-153162473 CTGGCTCAGGCACAGCAGAAGGG - Intergenic
915545473 1:156594765-156594787 CTGGGTTAGAAGCTGCAGAAAGG + Intronic
916799867 1:168206751-168206773 CTTTCTCAGTATCAGCAGTAAGG + Intergenic
917837750 1:178954201-178954223 CTGTGTCAGAAGCTGCTGGAAGG - Intergenic
917838929 1:178962085-178962107 CTGTCTCACAAACAAAAGAAAGG - Intergenic
918606580 1:186434499-186434521 CTTTCTCTGAAGGAGCAGCAAGG - Intergenic
919008371 1:191928733-191928755 CTGTCTCAAAAACAGAAAAAAGG + Intergenic
919324558 1:196090290-196090312 CTGTCTGAGGTGAAGCAGAAAGG + Intergenic
919651757 1:200156400-200156422 CCGTCTCAGAAAAACCAGAATGG - Intronic
919670110 1:200330612-200330634 CTATCTCAGGATCAGCAGGAGGG - Intergenic
919974787 1:202603358-202603380 GTGTCTCAGAGGCAGGAGAGTGG - Intronic
922933328 1:229406961-229406983 CTGTTTCAGAAGCAGCGGTTGGG + Intergenic
922980637 1:229823545-229823567 ATGTCTCAGAAACAGCCAAATGG - Intergenic
923340792 1:233005391-233005413 CTCACTCAGCAGCAGGAGAAAGG + Intronic
923949515 1:238932352-238932374 GTGTCTCACAAGCAGAAGGAAGG - Intergenic
924852406 1:247843659-247843681 CAGCCTGAGAAGCAGCAGATGGG - Intergenic
1062869768 10:889935-889957 CTCTCTCAAAAGGATCAGAAGGG + Intronic
1064134526 10:12739230-12739252 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
1064963769 10:20994902-20994924 CTGTCTCAGGAGTGGCAGAGAGG + Intronic
1064971679 10:21072984-21073006 CTGTCTCAGAAAAAGAAAAAGGG + Intronic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1065309464 10:24400462-24400484 ATGTCACAGAAGCAGGATAAAGG + Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1066005130 10:31140035-31140057 CTGTCTCATGAGAAGCAGCAAGG - Intergenic
1068601155 10:58958010-58958032 CTGTCTATCAAGCAGCATAATGG + Intergenic
1070733713 10:78849339-78849361 AGGTCTCAGGAGCATCAGAACGG + Intergenic
1072026319 10:91462513-91462535 CTGTATCAGAATCACAAGAAGGG + Intronic
1072182013 10:92992949-92992971 CTTTTTCAGAAGCAAAAGAAGGG - Intronic
1074442348 10:113489322-113489344 CTGTCTCATACCCATCAGAATGG - Intergenic
1074774724 10:116758979-116759001 CTGTCTGGGGTGCAGCAGAAGGG - Intergenic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075120108 10:119658658-119658680 CTGTGACAGGAGTAGCAGAAAGG + Intronic
1075647406 10:124105395-124105417 CTGCCTCAAAAGCAGCCGAGGGG + Intergenic
1076507042 10:130985009-130985031 TTGTCTCCGGAGAAGCAGAAGGG - Intergenic
1078279506 11:9885968-9885990 CTGTCTCAGAATTAGAAGAGAGG + Intronic
1078436999 11:11333676-11333698 CTTTCTCAGGAGCATCAGAGAGG + Intronic
1078913963 11:15760484-15760506 CTGCCTCAGAGTCAGCAAAAAGG - Intergenic
1078971153 11:16413270-16413292 CTGTCTCTGAAGTAAGAGAAGGG - Intronic
1079133878 11:17765085-17765107 CTGCCTCAGAATCCTCAGAAAGG + Intronic
1079564494 11:21864981-21865003 CTGTCTCAAAAAGAGGAGAAGGG - Intergenic
1080876367 11:36278644-36278666 CTGTAACAGAAGCAGCAGGCAGG + Intronic
1081156089 11:39692888-39692910 CTGTCTCAGGAGTAGCAGAAGGG - Intergenic
1081392847 11:42549661-42549683 CTGTCACAGAGACAGTAGAATGG + Intergenic
1081825860 11:46050999-46051021 GTTTCTCAGCAGCAGCTGAATGG - Intronic
1083229902 11:61310176-61310198 CTGTCCTAGGAGGAGCAGAAAGG - Intronic
1085829714 11:79886468-79886490 CTTTCTCTGAAGAGGCAGAATGG + Intergenic
1086640314 11:89146278-89146300 CTCCTTCTGAAGCAGCAGAAAGG + Intergenic
1086644629 11:89204354-89204376 CTGACTCAGCTCCAGCAGAAGGG - Intronic
1087321946 11:96673180-96673202 CAATCTAAGAAGCAGGAGAAGGG - Intergenic
1087368444 11:97250686-97250708 CTTTCTCACAAGCCCCAGAAGGG - Intergenic
1088707409 11:112476233-112476255 CAGTGCCAGAAGCTGCAGAAAGG - Intergenic
1089312690 11:117570336-117570358 CTGTCTAAGGAGAAGCAGAACGG - Intronic
1089930623 11:122307265-122307287 GTGTCACAGCAGGAGCAGAAAGG - Intergenic
1090477034 11:127032405-127032427 CTGTCTCAGAACCACCTGATGGG + Intergenic
1090875302 11:130783753-130783775 CTGACCCAGAGGCAGGAGAATGG - Intergenic
1091236839 11:134027797-134027819 CTGTGCCAGAGACAGCAGAAGGG + Intergenic
1092057875 12:5522504-5522526 CTGCCTCACACTCAGCAGAAAGG + Intergenic
1092649595 12:10619530-10619552 CTGTCTCAGAATCAGATAAAAGG + Exonic
1094434207 12:30403039-30403061 CTTTCTCAGCAGCATGAGAATGG + Intergenic
1095548369 12:43400244-43400266 CTGTCTCAGAGGAATGAGAAAGG - Intronic
1096587551 12:52632616-52632638 CCGTCTCAAAACCAGCAGAGTGG + Intergenic
1096653182 12:53072278-53072300 GAGTGTCAGAAGCAGCAGGAGGG + Intronic
1100405491 12:94269196-94269218 CTCTCTCAGATACAGCAGATTGG - Intronic
1102131288 12:110530854-110530876 CTGCCTCACAAGTAGCATAATGG - Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1102929129 12:116849239-116849261 CGGTCTCGGGAGCAGGAGAAGGG - Intronic
1103516667 12:121512824-121512846 CTGTCTTTGAGGCAGCAGGAGGG - Intronic
1104137154 12:125951573-125951595 CTGTCTCAAAAACAAAAGAAAGG - Intergenic
1104354375 12:128072212-128072234 TTTTGTCAGAAGCAGTAGAAAGG - Intergenic
1104570920 12:129924907-129924929 CTGTCTGAGGAGCTGCAGACAGG + Intergenic
1105765084 13:23551371-23551393 CTGTCTCTAAAGGAACAGAAAGG - Intergenic
1106111327 13:26780012-26780034 CTGTCTCAAAAAAAGAAGAATGG + Intergenic
1107112492 13:36712866-36712888 CTGCCTCACAAGAAGCTGAAAGG - Intergenic
1107388873 13:39942601-39942623 GACTCTCAGAGGCAGCAGAAAGG + Intergenic
1107586467 13:41854253-41854275 CAGTATCAAAACCAGCAGAATGG + Intronic
1107860184 13:44653251-44653273 CTGTCAGTGAAGCAGGAGAAAGG + Intergenic
1108904834 13:55455451-55455473 CTGTCTATAAAGCAGCAGCAAGG - Intergenic
1110550041 13:76801755-76801777 CTGTCTCAGAAGAAAAAAAATGG + Intergenic
1110852730 13:80263159-80263181 ATGTAGAAGAAGCAGCAGAAAGG - Intergenic
1112958257 13:105088487-105088509 CTCTCCCAGAGGCTGCAGAAAGG - Intergenic
1114261896 14:21043021-21043043 CAGCAGCAGAAGCAGCAGAAGGG - Exonic
1114672921 14:24421980-24422002 TTGTGTCAGAAGCAGTAGTATGG - Intergenic
1115057115 14:29142170-29142192 ATGTCTAGGAAGCAACAGAAAGG - Intergenic
1115128795 14:30027800-30027822 CTGTCTCACACCCATCAGAATGG - Intronic
1115221349 14:31061557-31061579 CAGTCTCCTAAGCAGCAGATTGG + Intronic
1117279855 14:54228452-54228474 CTGTCTCAAAAAAAGAAGAAAGG + Intergenic
1117781930 14:59242324-59242346 CAGTGTTAGAAGCAGCAGCAGGG + Intronic
1120242802 14:81969332-81969354 CTCCCTCTGAAGCAGCAGATAGG - Intergenic
1121239041 14:92414733-92414755 CTGTCTCAAAAACAGAAAAAAGG + Intronic
1121640314 14:95480900-95480922 CCATCTCAGCAGCAGCAGAAGGG + Intergenic
1122190400 14:100038055-100038077 CTCACTGAAAAGCAGCAGAATGG - Intronic
1122518817 14:102327976-102327998 GAGTTGCAGAAGCAGCAGAAGGG - Intronic
1122724892 14:103743956-103743978 CTGTCTCAGAAGCCGCTGCCTGG - Intronic
1122946159 14:105011081-105011103 ATTTCTCAGAATCAGCAGACAGG + Exonic
1124138099 15:27052558-27052580 GTGTTTTAGAAGCAGCAGGAGGG - Intronic
1124151790 15:27186694-27186716 CTATCTCAGAACAATCAGAATGG - Intronic
1125099718 15:35897951-35897973 ATGTCTGAGAAGCAACAGAGTGG - Intergenic
1126364383 15:47878697-47878719 CTGTATGAAAAGCAGCTGAAAGG + Intergenic
1126664060 15:51059879-51059901 CTGACCCAGAAGGAGCAGAGAGG - Intronic
1127299291 15:57637021-57637043 CTGCCTCTGAAGCTGCAGGAGGG - Intronic
1127650780 15:61004524-61004546 CTGTCAGAGAAGCAGCAGCCAGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128522986 15:68387719-68387741 CTCTCCTAGAAGCAGCTGAAGGG - Intronic
1129755153 15:78093630-78093652 CTGTGTCTGAAGCAGCTAAAAGG - Intronic
1130036681 15:80367495-80367517 CTGTCTCATCAGCAGGAAAATGG + Intronic
1130217751 15:81988189-81988211 CTGTTTCAGAAAGAGCAGGAAGG + Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1135246254 16:20859858-20859880 CTGTCCCAGGAGCAGCAGCAAGG - Exonic
1135472591 16:22744634-22744656 TTGTCCAAGAACCAGCAGAAGGG - Intergenic
1135490017 16:22900951-22900973 CTGTCGCAGGAGCAGGTGAAGGG + Intronic
1136401816 16:30023413-30023435 CTGTCTTGGGAGCAGCAGGAAGG + Intronic
1136461716 16:30415332-30415354 CTGTTTCTGAAGCTGCAGGAGGG - Intronic
1137570154 16:49560092-49560114 CTATCTCACAAGCAGCAGGTTGG + Intronic
1137629280 16:49930905-49930927 GTGATTCAGAAGCATCAGAACGG + Intergenic
1137782124 16:51106360-51106382 ATGACTTAGGAGCAGCAGAATGG - Intergenic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1139194854 16:64906921-64906943 CTGTCTTAGTAACAACAGAATGG - Intergenic
1140146565 16:72316720-72316742 CTGTCACAGCAGCAGAACAAGGG - Intergenic
1140148652 16:72338716-72338738 CTGTCTCAAAAGAAACAGGAAGG - Intergenic
1140469317 16:75205669-75205691 CTGTCCCTGAAGCAGCCGAGGGG + Intronic
1140472467 16:75223270-75223292 CTGTCCCTGAAGCAGCCGAGGGG - Intronic
1141090228 16:81125122-81125144 CTGTCTCAAAAGAAGAAAAAAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141289780 16:82707023-82707045 CTGTCACAGAAGCCTCAGATTGG + Intronic
1141898403 16:86973657-86973679 CCGACAGAGAAGCAGCAGAAGGG + Intergenic
1144003218 17:11074788-11074810 CAATCTCAGAGTCAGCAGAAAGG + Intergenic
1146007514 17:29169979-29170001 CGGTCACAGCAGCAGCACAAGGG + Intronic
1146110992 17:30089327-30089349 GTGGCTCAGCAGCAGCAAAAGGG + Intronic
1146254353 17:31381348-31381370 CTGTCACAGAAGCAAGAGAAGGG - Intronic
1146480764 17:33203192-33203214 CTGTCTCAGAAGCAGCCCGAAGG + Intronic
1146699975 17:34949028-34949050 CTGTCTCAGAAAAAAAAGAAAGG + Intronic
1149021858 17:51976863-51976885 CAGTATCAGAAGCAAAAGAAGGG + Intronic
1149367400 17:55959620-55959642 CTGGTTCAGAAGAAACAGAAAGG + Intergenic
1149596981 17:57870024-57870046 CTGACTCATAAGCAGCAGGCTGG - Intronic
1150274655 17:63888680-63888702 CTGTCTCAAAAGCAAAATAAAGG + Intergenic
1150276794 17:63903477-63903499 CTGTCTCAAAAGCAAAACAAAGG + Intergenic
1152374458 17:79911925-79911947 CTGTCTCTGAAGCACCAGGATGG - Intergenic
1152882344 17:82825588-82825610 CTGTCCCTAAAGCAGCAGCAAGG - Intronic
1153543036 18:6177459-6177481 CTGGCTGAGAAGGAGCACAAAGG + Intronic
1153834402 18:8951134-8951156 CTGTCCCTGAAGGGGCAGAAGGG - Intergenic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1154120799 18:11650969-11650991 CAGTCTCAGTAGCAGCCTAAAGG + Intergenic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1155134507 18:22975531-22975553 CTGTCCCAGAAGCTTCATAAGGG + Intronic
1156633576 18:38999043-38999065 CTTTCTGAGAAGCAGTATAAAGG - Intergenic
1156885523 18:42131362-42131384 CCATCTCAGAAGCCACAGAAAGG + Intergenic
1157661401 18:49448207-49448229 CTGTCTCATCAGCAGGAAAATGG + Intronic
1157691661 18:49687345-49687367 CTGACTCAGAAGCATAAAAATGG + Intergenic
1158380386 18:56923539-56923561 CTGTGTTAGATGCAGAAGAAAGG + Intronic
1160900170 19:1424041-1424063 CCGTCTCAGAAGATGCAGAAAGG - Intronic
1161067145 19:2244262-2244284 CTGACTCAGAACCACCAGGAAGG + Intronic
1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG + Intronic
1162018628 19:7858630-7858652 CTGTGTCACAGGCAGCAGACAGG + Intronic
1162218674 19:9157848-9157870 CTGACTTAGGAGCAGCAAAATGG - Intronic
1162551142 19:11359049-11359071 CTGTCTCAGAAAAAAAAGAAAGG - Intronic
1162587355 19:11568413-11568435 CTGACTCAGAGGCACCAGACAGG - Intronic
1163612769 19:18309704-18309726 CAGCAGCAGAAGCAGCAGAAAGG - Exonic
1164695638 19:30241579-30241601 CTGTCTAAGGAGCAGCAGTGTGG + Intronic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
926302255 2:11612797-11612819 CTTTCTGAGAATCAGGAGAAGGG - Intronic
926781712 2:16478605-16478627 CTGTGTCATAACAAGCAGAAGGG - Intergenic
927172485 2:20381797-20381819 CTGTCCCAGAGGGAGCAGAATGG - Intergenic
928583401 2:32731378-32731400 CTGTCTCAGAAGGAAAAAAAGGG - Intronic
928735259 2:34281086-34281108 CTGTCTGAGAATCAGAAAAAGGG - Intergenic
928822224 2:35374993-35375015 CTGTGAAAGAAGCACCAGAAAGG + Intergenic
929768802 2:44874079-44874101 CTGTGTCAGAAGTAACATAATGG + Intergenic
929869344 2:45745212-45745234 CTGTCTCAGTCGCTGCAGGAAGG - Intronic
930144340 2:47986014-47986036 CTCACTCACAATCAGCAGAACGG + Intergenic
931679279 2:64730116-64730138 CTCTCTCAGAAGCAGAGGAGTGG + Intronic
933479332 2:82835321-82835343 CTGTCTAGGAAGCAGCAAAACGG + Intergenic
933852552 2:86382291-86382313 CTGACTCAGAAGCAACTTAAAGG - Intergenic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
936061983 2:109300881-109300903 CTGCCTCCAAAGCAGCAGAGAGG - Intronic
936165915 2:110119439-110119461 CTGTCTCATAGGCAGGAAAATGG - Intergenic
937153031 2:119698990-119699012 CTGTCTCAAAACCAAAAGAAAGG + Intergenic
940824469 2:158395230-158395252 CTGCTTCAGAAGCAGAAGAGTGG - Intronic
940968957 2:159873106-159873128 CTGTTTCAAAAGAAGAAGAAAGG + Intronic
941320822 2:164052053-164052075 CTGTCCCAGAAGCTCCAGAAAGG - Intergenic
941865833 2:170333381-170333403 TTGTCTCTGATCCAGCAGAAGGG + Intronic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
942906976 2:181194760-181194782 CTGTCACAGAAGCAGCTGCCAGG + Intergenic
944052363 2:195485041-195485063 CTGTCTCAGAGGTGGCAGACTGG + Intergenic
944180729 2:196889936-196889958 CTGTCTCAGAAGAAAAAAAAGGG - Intronic
945331504 2:208545019-208545041 ATGTCACATAAGCAACAGAAAGG + Intronic
945897345 2:215498527-215498549 GTGACTCAGAAGAAGCAGAAAGG - Intergenic
946322575 2:218962218-218962240 CTGTCACAGACAGAGCAGAAAGG + Intergenic
946695728 2:222356822-222356844 TTCTCTCAGTACCAGCAGAAAGG + Intergenic
946838670 2:223797950-223797972 TAGTCTCAGAAGCCACAGAAAGG - Intronic
948017207 2:234700555-234700577 CTGTCTCAGAACCAGAAAATGGG - Intergenic
948318702 2:237051679-237051701 CTGAGGCAGAGGCAGCAGAATGG + Intergenic
948451995 2:238081443-238081465 CCGTCTCCGTAGAAGCAGAAAGG + Intronic
949010774 2:241677138-241677160 CTGTCCCAGAAGCTTGAGAAGGG - Intronic
1169187208 20:3628826-3628848 CAGGCTAAGAAGCAGCAGTAGGG - Intronic
1170797965 20:19566161-19566183 CTGGCACAGAGGCAGCAGCAAGG + Intronic
1172035948 20:32010791-32010813 CTGTCTGAGAGGCTGCAGGAGGG - Intronic
1172328639 20:34057976-34057998 GTGTCTCAGCTGCAGGAGAAAGG - Intronic
1172347377 20:34213491-34213513 CTGTCTCTAAAGCAGCAGACTGG + Intronic
1173132223 20:40404983-40405005 CTGTCTCAGAGGCAGCTGAGAGG + Intergenic
1175010308 20:55728023-55728045 CTGTTGCAGAGGCAGCAGAGAGG - Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175187474 20:57188751-57188773 CTGCCTCACCAGCAGCAGACTGG + Intronic
1175531839 20:59678879-59678901 CTGTATCAGAAGCACCTGGAGGG + Intronic
1175883813 20:62276708-62276730 CTTTCCCAGAAGCAGAAGCAGGG - Intronic
1176167116 20:63680174-63680196 CTTTCTCAAAAGCAGAATAATGG - Intronic
1176305897 21:5122989-5123011 CTGTCTCAGAGGGTGCAGAGTGG + Intronic
1177806649 21:25881716-25881738 CTGTCCAAGATGCAGCAGAACGG - Exonic
1179851160 21:44139042-44139064 CTGTCTCAGAGGGTGCAGAGTGG - Intronic
1180046863 21:45310562-45310584 CTGTCCCAGAGCCTGCAGAAGGG + Intergenic
1181039648 22:20185793-20185815 CTCTCTCAGCAGCACCAGCAAGG + Intergenic
1181098856 22:20525280-20525302 CTGTCTCAAAAACAAAAGAAAGG + Intronic
1181621398 22:24093966-24093988 CTATCTCAGGAGCAGCAGCTTGG + Intronic
1182122035 22:27794436-27794458 CTGTCTTATAAGCACCAGCAGGG - Intronic
1182350732 22:29697972-29697994 CTGCCTGAGAGCCAGCAGAAGGG - Exonic
1183961621 22:41414678-41414700 GTGGCTCAGCAGCTGCAGAATGG + Intergenic
1184380093 22:44140053-44140075 CAGTTTCACAAGCAGCACAATGG - Intronic
1184782915 22:46658086-46658108 CTGACTCAGAAACAGCAGAGGGG - Intronic
1184973058 22:48041190-48041212 CTGTCCCAGCAGCAGAAGAGGGG - Intergenic
949155840 3:826702-826724 CAGTCTCAGCCACAGCAGAAGGG + Intergenic
949819402 3:8099876-8099898 CTGACTCAGAGGCAGCAGCTAGG + Intergenic
950897144 3:16463277-16463299 GAGTCTCAGAAGGAGCAGAGAGG - Intronic
952441585 3:33335843-33335865 CTGTCTCAGAAGAAGCGGGCAGG + Intronic
953085639 3:39664077-39664099 CTTTCTCAGAAACAGGAGACTGG - Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953615600 3:44488133-44488155 CTGTCTCAGAAAAAAAAGAATGG + Intergenic
955002232 3:54938121-54938143 GTGTCTGAGGGGCAGCAGAATGG + Intronic
955178443 3:56641597-56641619 CTGTCAGAGATGCATCAGAATGG + Exonic
955699299 3:61667837-61667859 AAGTCTTAGAATCAGCAGAATGG - Intronic
957427812 3:80063437-80063459 CGGTCGAGGAAGCAGCAGAAAGG + Intergenic
957715926 3:83929405-83929427 CTATCTCACCAACAGCAGAATGG + Intergenic
961035991 3:123641857-123641879 CTGTCTCAAAAGCGAAAGAAAGG - Intronic
961843061 3:129734743-129734765 TTGTCTCTGAAGAAGCGGAATGG + Intronic
962444056 3:135449297-135449319 CTGTCCCATAAGCAACACAATGG - Intergenic
962754162 3:138455557-138455579 CTGGCTCAGAGGGAACAGAAAGG + Intronic
963205905 3:142634119-142634141 CTGTCTAAAATGCAGCAAAAAGG + Intronic
964493417 3:157261746-157261768 CTTTCTCAGAGGTAGCACAAAGG - Intronic
966412113 3:179654481-179654503 ATGTGTGAGAAGCAGCAGGAGGG + Intronic
966710376 3:182966495-182966517 CTCTCTGAGAAGAAGTAGAAGGG - Intronic
967819364 3:193826702-193826724 CAGCCGCAGAATCAGCAGAAAGG + Intergenic
967927636 3:194663782-194663804 CTTTCTCTGAGGCAGAAGAAGGG - Intronic
968025420 3:195438371-195438393 TAATCTCAGAAGCAGTAGAATGG - Intronic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
968934839 4:3604620-3604642 CTGCCTCAGAACCAGCAGGGAGG - Intergenic
969230225 4:5825417-5825439 TTTCCTCAGAAGCAGCAGGAAGG + Intronic
969692561 4:8711621-8711643 CTGTCCCTGAAGCAGCAGTGTGG - Intergenic
970230166 4:13901604-13901626 CTATATCAGAAGCAGTATAATGG + Intergenic
970338249 4:15075739-15075761 GAGTCTCAGAAGGATCAGAAAGG + Intergenic
971425997 4:26516076-26516098 CATTCTCAAAAGCAGCAGAGAGG + Intergenic
972610369 4:40650612-40650634 CTGTCTCAAAAGAAGAAGAGAGG - Intergenic
974229104 4:59086523-59086545 ATGTCTCAGCAGTAGCTGAAAGG + Intergenic
975101642 4:70520946-70520968 CTGTTGCAGAAACAGCAAAATGG + Intronic
975538446 4:75477069-75477091 CTCTATCACAAGCAGCAAAAGGG + Intergenic
975544245 4:75545562-75545584 CTCTGTCAGAAGCACCACAAAGG - Intronic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
979957987 4:126979423-126979445 CTGTTAGAGAAACAGCAGAAAGG + Intergenic
980797363 4:137701587-137701609 CTAGCACAGAAGCAGCAGAGTGG + Intergenic
981130075 4:141148864-141148886 TAGGCTCAGAAGCTGCAGAAGGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982070358 4:151688846-151688868 CTGTCTCAGAGGAGGCAGAGGGG - Intronic
982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG + Intronic
983893466 4:173056321-173056343 CTTTCTCAGTAGCACGAGAAGGG + Intergenic
984181443 4:176487647-176487669 CTGTCTCAGAAAAAAAAGAAAGG + Intergenic
985846189 5:2350948-2350970 CTATCTCAAGAGCAGCAGCAGGG + Intergenic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
987642122 5:20626244-20626266 CTGTTACAGAAGCAACAAAAAGG - Intergenic
988737403 5:34036043-34036065 CTGTTACAGTAGCAGCAGGAAGG - Intronic
990125493 5:52512099-52512121 CTGTCACAAAAGAAACAGAAAGG + Intergenic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
991994314 5:72372018-72372040 CTGTCTCAGAAGCTGCATACTGG + Intergenic
992005569 5:72474231-72474253 CTGTCTCAGAAGCACCACAAAGG + Intronic
992142274 5:73810749-73810771 ATTTCTCAGAGGCATCAGAATGG - Intronic
992850146 5:80798715-80798737 TTGTTTCAGAAGCAGGAGAGAGG - Intronic
995527156 5:113059269-113059291 CTGTCCTGGAAGCAGGAGAAGGG - Intronic
996054779 5:118970419-118970441 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
996325125 5:122264432-122264454 TTGCCTCAGAAGCACCTGAAGGG + Intergenic
997133432 5:131299871-131299893 TTGTCTGAGAACCAGCAAAAAGG + Intronic
997356944 5:133268608-133268630 CTGTCTCAGGATGAGCAGGAAGG - Intronic
998893291 5:146769370-146769392 CTGTATCAGAATCACCTGAAGGG - Intronic
1000546970 5:162615144-162615166 CTCTCACAGAAGCAGCAGTAAGG + Intergenic
1000819004 5:165960410-165960432 CTGTCTCAAAAGAAGAAAAAAGG - Intergenic
1001775422 5:174325940-174325962 CTGTCTCCAGAGAAGCAGAAGGG + Intergenic
1002293933 5:178218299-178218321 CTGTCCCAGAAGGAGAGGAAAGG + Intronic
1002390726 5:178909679-178909701 CTGTCCCAGGAGCAGCAGCAAGG - Intronic
1002400926 5:178991274-178991296 CAGACTCAGAGGCAGCAGCAGGG + Intronic
1002599403 5:180345780-180345802 CTGTCTCAGACCCAGCTCAAAGG - Intronic
1005127984 6:22470730-22470752 ATGTCCCAGAAGCAGGAGGAAGG + Intergenic
1005257060 6:24014558-24014580 CTGGCTAATAAGGAGCAGAATGG + Intergenic
1007006961 6:38373287-38373309 ATGTCCCAAAAGCAGCAGACTGG - Intronic
1008268271 6:49459309-49459331 CTGGCTAAAAAGCAGCTGAAAGG - Exonic
1008490641 6:52083339-52083361 CTGCCTCAGAATCACCAGAAAGG + Intronic
1008698774 6:54073691-54073713 CTGTTTCAGGATCAGCAGCATGG - Intronic
1010572697 6:77496914-77496936 CTGTCTCTGAAGATGGAGAAAGG - Intergenic
1011023983 6:82845931-82845953 CCAGCTCAGAAGCAGTAGAATGG + Intergenic
1011147386 6:84233700-84233722 CTGACTCAGAAGACCCAGAAAGG - Intergenic
1011221428 6:85058309-85058331 AAGTCTCAGAAGAAGCAGAAGGG + Intergenic
1011233890 6:85193527-85193549 CTGTTTCAGAAAGACCAGAAAGG + Intergenic
1011771512 6:90678586-90678608 TTGTCACAGTAGCAGCAGCAAGG - Intergenic
1012346844 6:98198783-98198805 CTGGCCCTGAAGCAGCAGACAGG - Intergenic
1013461162 6:110376779-110376801 GTGCCCCAGAAGCACCAGAAGGG - Intergenic
1013522962 6:110949359-110949381 CTGTATCAGAATCAGCTGGAGGG - Intergenic
1014905503 6:127022082-127022104 CTGCCTCATAAGGAGAAGAAAGG + Intergenic
1015562519 6:134531760-134531782 CTGCCTCAGACACAGCAGTAGGG - Intergenic
1015944570 6:138486850-138486872 GTGTATCATAAGCAGCAGAATGG + Intronic
1016321279 6:142848766-142848788 CTATTTCAAAAGCATCAGAATGG - Intronic
1016447868 6:144151104-144151126 CTGTGTCAAAAACACCAGAATGG + Intronic
1016676608 6:146777630-146777652 CTGTGTCAGAATCACCTGAAGGG - Intronic
1017649722 6:156569923-156569945 CTGCCTCAGAATCAGCTGGAGGG + Intergenic
1020098279 7:5380467-5380489 CAGTCCCAGAAGCAGAAGAGAGG + Intronic
1020398404 7:7745239-7745261 CTGTCTCAGGAGTGGCAGAGGGG + Intronic
1021154467 7:17193240-17193262 CTGTCTCACATTCATCAGAATGG + Intergenic
1022073125 7:26937461-26937483 CATAATCAGAAGCAGCAGAATGG + Intronic
1022439898 7:30424705-30424727 CTGCCTCCCAAGCAGCTGAAGGG - Exonic
1026385081 7:69838799-69838821 CTTTCTCAGAAGCCACAGCAAGG - Intronic
1026586057 7:71657065-71657087 GTTTCTCAAAAGCAGCAGGAAGG - Intronic
1027254152 7:76419801-76419823 CTGTCTCAAAAAAAGAAGAAAGG - Intronic
1027584646 7:80043698-80043720 CTTTCTCAGCAGCATGAGAACGG - Intergenic
1028915300 7:96252484-96252506 CTCTCACAGAAGCAGCAGGGAGG + Intronic
1029375300 7:100173859-100173881 CTGTCTCAGCAGCAGGGGACTGG - Exonic
1030934498 7:115568449-115568471 CTGTCTCTGAATCAGGAGAAGGG - Intergenic
1031136995 7:117895394-117895416 CTGTCTGAGAAGCAGGCCAAGGG - Intergenic
1031946077 7:127841988-127842010 ATGCTTTAGAAGCAGCAGAATGG - Intronic
1032061195 7:128726825-128726847 GAGTTTCAGGAGCAGCAGAAAGG + Exonic
1033321670 7:140345489-140345511 CTGTCTCAGCAGCATCTTAAGGG + Intronic
1035437950 7:158873304-158873326 CACTCTTAGAATCAGCAGAAGGG + Intronic
1035716020 8:1755498-1755520 CTGTCTCTGAAGGGGTAGAACGG - Intergenic
1037821308 8:22136114-22136136 CCGACTCACAAGCAGCACAATGG + Intergenic
1038493687 8:27987198-27987220 CTCTCTCAGGAGCAGAAGCATGG + Intronic
1038707196 8:29905572-29905594 CTGTTACAGCAGCAGCAGTAAGG - Intergenic
1038740561 8:30213135-30213157 CTGTCTCAGAGGGAGGAGCAGGG + Intergenic
1039029806 8:33297100-33297122 GTGTCTCAGAAGCAAAACAAAGG + Intergenic
1039191829 8:34984990-34985012 CTGTCTCTGAATCATCAGCAAGG - Intergenic
1040466561 8:47700956-47700978 GTGTCTCAGAAGCAGCAAAATGG + Intronic
1040914990 8:52559637-52559659 CTGTTTCAGAACCAGCTGAGAGG - Intronic
1041140285 8:54810837-54810859 CTGCCTCAAAGCCAGCAGAATGG - Intergenic
1042341325 8:67683079-67683101 CTGTCCAGGAAGCAGCAGACCGG - Intronic
1042553401 8:70014098-70014120 CTGTCTCAGAAAAAGAAAAAAGG + Intergenic
1042569920 8:70152560-70152582 GTGTCTCAGCAGCATTAGAAAGG + Intronic
1042711130 8:71718751-71718773 CTGTCTCAAAAAAAGAAGAAAGG + Intergenic
1045378931 8:101603673-101603695 CTGTCTCACAACCAGCAAAACGG - Intronic
1046025721 8:108721220-108721242 CTGTCTCATTAGCTGCACAAAGG - Intronic
1046490887 8:114952176-114952198 TTGTCTCAAAAGCAGCATTAGGG + Intergenic
1047776636 8:128076876-128076898 CTCTCTCAGAAGCCCCTGAAGGG - Intergenic
1048012772 8:130471636-130471658 CTCCCTCAGAAGGAGAAGAAAGG - Intergenic
1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG + Intergenic
1049955006 9:684725-684747 CTTTCTCAGAAACTGCACAAAGG - Intronic
1050366781 9:4880161-4880183 CTGGCTGTGAAGCAGAAGAAAGG - Intronic
1050371240 9:4923581-4923603 CTGGCTCACAAGGAGAAGAATGG - Intergenic
1051421968 9:16897712-16897734 CTTTATTAGAAGCAGGAGAATGG - Intergenic
1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG + Intergenic
1053034480 9:34812592-34812614 CTGTCTCTGAGGAAGCAGACTGG + Intergenic
1053587366 9:39473588-39473610 CTATCCTAGAAGCAGCAAAATGG - Intergenic
1054455336 9:65427358-65427380 CTGCCTCAGAACCAGCAGGGGGG + Intergenic
1054578935 9:66891648-66891670 CTATCCTAGAAGCAGCAAAATGG + Intronic
1055364501 9:75528142-75528164 CTGTCCAAGAAGGAGCAGAGAGG + Intergenic
1056501955 9:87218248-87218270 TTGCCTCAGAATCACCAGAATGG - Intergenic
1056707276 9:88961805-88961827 CTTTCCCAGAAGCAGAAGAGGGG + Intergenic
1057217383 9:93236607-93236629 CGGACTCAGAAGCAGCAGGGCGG - Intronic
1057287102 9:93765533-93765555 CTGCCTCAGTAGCAGCAGGCAGG - Intergenic
1057287478 9:93770823-93770845 ATGTCTGAGATGCAGCAAAAGGG + Intergenic
1057743477 9:97733115-97733137 CTGTCTCAGAATCATCTGGAGGG + Intergenic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1059083161 9:111271686-111271708 CTGTCTCAAAAGCTTCAAAAGGG - Intergenic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060014890 9:120078633-120078655 CTGCCTCAGCAGCATCTGAAGGG + Intergenic
1060943369 9:127556059-127556081 CATGCTCAGAAGCTGCAGAAGGG + Intronic
1061875295 9:133540511-133540533 CTGTCTCAGAGGGAGGAAAAGGG + Intronic
1062218873 9:135403761-135403783 GTGTCTCAGAAGCTGCTGGAAGG - Intergenic
1186117215 X:6317640-6317662 CTGTCTCATAAACAGAAGGAAGG - Intergenic
1186249116 X:7646987-7647009 CTGTCTGGGAAGAAGAAGAAGGG - Intergenic
1186820202 X:13280261-13280283 CTGTCATAGAGGCAGAAGAATGG - Intergenic
1187028358 X:15459208-15459230 TTGTCTCAAATGCAGCAGAGAGG + Intronic
1187457249 X:19452995-19453017 CAGTCACAGAAACAGAAGAATGG + Intronic
1187560137 X:20394872-20394894 CTTCCTCAGAAGCGGTAGAAGGG - Intergenic
1187985832 X:24809700-24809722 CTGGCTCAGAATCAGCATAGAGG + Intronic
1189415536 X:40809579-40809601 CAATCTCAGAAACAGTAGAAAGG - Intergenic
1190070057 X:47272276-47272298 CCCTTTCAGAAGCAGCTGAATGG + Intergenic
1190256274 X:48765096-48765118 CTGTGACTGAAGCTGCAGAATGG + Intronic
1190433194 X:50397626-50397648 TTGTATCAGAAGCATCTGAAAGG - Intronic
1190464081 X:50708437-50708459 CTGCCATAGAAGCAGCAGGAGGG + Intronic
1191672878 X:63765296-63765318 CTTTCTGAGAAGCAGCTGAGGGG - Intronic
1192362126 X:70446692-70446714 CTGTGGGAGAAGCAGCAAAATGG + Intronic
1192495450 X:71613984-71614006 CTGTCTCAAAAAAAACAGAAAGG - Intergenic
1193286858 X:79723964-79723986 CTCACTCAGAAACACCAGAAAGG + Intergenic
1193721478 X:84991791-84991813 CTGTCTCAGAAGCAGAGCATGGG + Intergenic
1197408330 X:126083830-126083852 TTGACTCAGAAGCAGCAGCTCGG - Intergenic
1197795038 X:130289504-130289526 CTCTCTCACAAGGACCAGAATGG - Intergenic
1198430238 X:136558197-136558219 CTGTCTCTGAAAAAGCAAAAAGG + Intergenic
1200842815 Y:7800845-7800867 GAGTCTCAGAAGGAGCAGAGTGG - Intergenic