ID: 936041732

View in Genome Browser
Species Human (GRCh38)
Location 2:109154985-109155007
Sequence AAAATGACTCCTATGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936041732_936041737 15 Left 936041732 2:109154985-109155007 CCAGCCTTCATAGGAGTCATTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 936041737 2:109155023-109155045 AAATAGAGTGGAGTGTGTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 182
936041732_936041736 3 Left 936041732 2:109154985-109155007 CCAGCCTTCATAGGAGTCATTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 936041736 2:109155011-109155033 GTTGGGTTCATAAAATAGAGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
936041732_936041738 26 Left 936041732 2:109154985-109155007 CCAGCCTTCATAGGAGTCATTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 936041738 2:109155034-109155056 AGTGTGTTCTGGTGTGCTCATGG 0: 1
1: 0
2: 1
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936041732 Original CRISPR AAAATGACTCCTATGAAGGC TGG (reversed) Intronic
900272843 1:1801890-1801912 GAAAGGACCCCCATGAAGGCAGG + Intronic
903042151 1:20539282-20539304 ACAATGCCTCATTTGAAGGCTGG - Intergenic
905458110 1:38102479-38102501 AAAATGACACCTTTGAAGGTGGG + Intergenic
907339129 1:53721502-53721524 AAAATGACTGAGTTGAAGGCAGG + Intronic
908077347 1:60535163-60535185 AACATCACTCCTCTGTAGGCCGG + Intergenic
913672439 1:121110376-121110398 AGAATAAGTCCTATGAAGGTAGG - Intergenic
914024203 1:143897740-143897762 AGAATAAGTCCTATGAAGGTAGG - Intergenic
914662696 1:149805767-149805789 AGAATAAGTCCTATGAAGGTAGG - Intronic
915484174 1:156208600-156208622 AATAGGACTCCAATAAAGGCTGG - Intronic
916311724 1:163405977-163405999 AAAATCAATGCTATGAAGGCTGG - Intergenic
916557994 1:165909667-165909689 AAGATGCCTCCTTTGAAAGCCGG + Intronic
917910559 1:179640546-179640568 ACACTGACTTCTTTGAAGGCTGG - Intronic
918373656 1:183886772-183886794 AAATTGACTACGATGAATGCAGG - Intronic
918641945 1:186852177-186852199 AATATAAATTCTATGAAGGCAGG - Intronic
920803620 1:209211808-209211830 AGTATGGCACCTATGAAGGCTGG - Intergenic
920843185 1:209571955-209571977 AACATGAATTCTTTGAAGGCAGG - Intergenic
921564272 1:216697881-216697903 AAAATGACTACTATGAATAAAGG + Intronic
1063548814 10:7008506-7008528 AAAATCAAGCCTATGGAGGCAGG - Intergenic
1066242531 10:33552158-33552180 AAAATGGCACACATGAAGGCTGG + Intergenic
1066713935 10:38266055-38266077 AATAAGACTCCTATGAAGACTGG - Intergenic
1067709876 10:48639581-48639603 AGAGTGACCCCTAGGAAGGCAGG + Intronic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1069618247 10:69819985-69820007 AAAATGAATCCTTTGATGTCTGG - Intronic
1070518903 10:77234829-77234851 AAAATCAATACTCTGAAGGCAGG - Intronic
1072157689 10:92738692-92738714 AAAATGCCTCCCATGAAGCCTGG - Intergenic
1073350215 10:102814190-102814212 AAGATGTCTCGTGTGAAGGCTGG + Exonic
1075832429 10:125422812-125422834 AAAATGACGCCAAGGAATGCCGG + Intergenic
1076877673 10:133224565-133224587 CAAATGATTCCTAAGAACGCGGG + Intronic
1083433360 11:62626512-62626534 GAACTGAGTCCTAGGAAGGCAGG + Intronic
1083970547 11:66071120-66071142 AAACTGACTGCCAGGAAGGCCGG - Intronic
1085725936 11:78954615-78954637 AAAATAAATACTATGAAAGCAGG - Intronic
1087334403 11:96825179-96825201 AAAATGACTGGTCAGAAGGCAGG + Intergenic
1089797968 11:120998632-120998654 AAAATGACTCCAATGGCTGCTGG - Intergenic
1090722123 11:129485178-129485200 AAAATGTCTATTATCAAGGCCGG - Intergenic
1091221685 11:133933408-133933430 GAAATGAATCCAAGGAAGGCTGG - Intronic
1094523623 12:31218016-31218038 AGAATGTTTCCTATGAAGCCAGG + Intergenic
1095343024 12:41114660-41114682 GCAATGACTTCTATGAAGACAGG + Intergenic
1099185414 12:79511110-79511132 AAAATGCTTCTTATGAAGTCTGG + Intergenic
1100097095 12:91054107-91054129 AAAATAACCGCTATGATGGCAGG + Intronic
1103128719 12:118447883-118447905 CAAATGACCCCTTTGCAGGCAGG - Intergenic
1105655614 13:22434277-22434299 AAAGTGGCTCCTCTGAAGGAAGG + Intergenic
1105841500 13:24257811-24257833 AAATTGAGTCCTTTAAAGGCAGG + Intronic
1107191620 13:37595029-37595051 AAAATCACTACTTTGAAGCCTGG - Intronic
1110646851 13:77896340-77896362 AAAATGACTTCTATGATAACAGG + Exonic
1112360314 13:98711379-98711401 AAAATGACTCCTCTCCAAGCAGG - Intronic
1112696274 13:101952594-101952616 AAAAAGAGCTCTATGAAGGCAGG - Intronic
1118945592 14:70383797-70383819 AAAATGGCTATTACGAAGGCTGG - Intronic
1121991744 14:98564390-98564412 AAAGTGGCCCCTGTGAAGGCTGG + Intergenic
1122799149 14:104221201-104221223 AAACTGCCTCCTAGGAAGTCAGG + Intergenic
1124104626 15:26725994-26726016 AAAATGACACATGTGCAGGCTGG - Intronic
1127733833 15:61823548-61823570 AAGATGAGTCCCAGGAAGGCTGG - Intergenic
1128874737 15:71192911-71192933 AAAACGATTCCCATGAAGGATGG - Intronic
1130054353 15:80509495-80509517 AAAATGAATTCTATGCAGGCAGG - Intronic
1131032829 15:89200784-89200806 AGAAAGAATCCAATGAAGGCCGG + Exonic
1131048622 15:89332499-89332521 AAAATGCCTGCTTGGAAGGCTGG + Intronic
1138477585 16:57281229-57281251 AAAATCACTCCTGTGGAGGAGGG + Intronic
1140418691 16:74798034-74798056 AAAATGAATTTTACGAAGGCAGG + Intergenic
1143156107 17:4837386-4837408 AAAATGAAGCCTAAGAAGCCTGG - Intronic
1144340636 17:14307771-14307793 AAAATGCCTACTCTAAAGGCAGG + Intronic
1145232797 17:21186874-21186896 AAAATGAGACATAAGAAGGCAGG + Intronic
1145921144 17:28611070-28611092 AAAATCACTTTAATGAAGGCAGG + Intronic
1147303559 17:39548426-39548448 AAAGTGACTGCCATTAAGGCAGG - Intronic
1150009598 17:61491611-61491633 AAGATGACTTCTACCAAGGCGGG + Intergenic
1151211415 17:72547270-72547292 AAAAATACTTTTATGAAGGCAGG - Intergenic
1153615068 18:6926621-6926643 AAAATGTCTCCTGTGAGGCCGGG + Intergenic
1153665273 18:7362589-7362611 AAAATGAGGCCTGTGAATGCAGG - Intergenic
1157199814 18:45650604-45650626 AAAATGAATTCCTTGAAGGCAGG - Intronic
1159152821 18:64542089-64542111 ATAATGACACCTCTGCAGGCTGG - Intergenic
1159490050 18:69120819-69120841 AAAAAGAGGCCTATGAAGTCAGG - Intergenic
1160231683 18:77053866-77053888 AAAGTGAGCCCCATGAAGGCAGG - Intronic
1161858321 19:6778573-6778595 AAAATGGCACCTTTTAAGGCTGG + Intronic
1162610563 19:11746919-11746941 ACAAGGACTCCTAAAAAGGCAGG + Intergenic
1164144555 19:22504157-22504179 AAGATGACACCTCTGAGGGCTGG - Intronic
1164860947 19:31561783-31561805 AAACTTACTCCTTGGAAGGCTGG - Intergenic
1164904068 19:31952612-31952634 AAAATGAGTGCCATGAAGGCTGG + Intergenic
928688879 2:33778291-33778313 AAAATGACTTCTGTGAATGGAGG + Intergenic
929715149 2:44302613-44302635 GAAATGACTCCGATCAATGCTGG - Intronic
929745485 2:44653142-44653164 AAAAAGACTCTTATGAAGCCAGG - Intronic
929866554 2:45722288-45722310 CAGCTGACTCCTATGAAGCCAGG - Intronic
933717105 2:85369694-85369716 AGAATGACTCCTATAAATCCTGG + Intronic
935412325 2:102778577-102778599 CAAGTAACTCCTAGGAAGGCAGG - Intronic
936041732 2:109154985-109155007 AAAATGACTCCTATGAAGGCTGG - Intronic
938764580 2:134451811-134451833 AAAAAGACTTCTTTGAATGCTGG + Exonic
939888903 2:147712173-147712195 GATATGACTCCTAGGAAGCCAGG + Intergenic
940467814 2:154054657-154054679 TTAATGACTCCTATGCAGACAGG + Intronic
943889589 2:193270107-193270129 AAAATGACTCCTATCTAGTCAGG + Intergenic
945203346 2:207306912-207306934 AAAGTGACAACTAGGAAGGCTGG - Intergenic
945798787 2:214398225-214398247 AAACTGACTCCAATAATGGCTGG - Intronic
946058632 2:216922021-216922043 AACATGAATCCTGTGAAAGCAGG + Intergenic
946572914 2:221043830-221043852 AAAATCACTCATATGAAGCTTGG + Intergenic
946953073 2:224898363-224898385 AGGATGACAGCTATGAAGGCAGG + Intronic
948168251 2:235879412-235879434 AATATGACTCCTAAGAGGCCAGG + Intronic
1168765421 20:378998-379020 AAAATAACTCCTCTAGAGGCTGG - Intronic
1173814020 20:45973427-45973449 AAAAAAACTCCTAAGCAGGCTGG + Intergenic
1174490666 20:50892413-50892435 AAGATGATTCCTATGAAGCCAGG - Exonic
1177159310 21:17530515-17530537 GAAATAACTACTGTGAAGGCCGG + Intronic
1177227804 21:18280278-18280300 AAACTTCATCCTATGAAGGCCGG + Intronic
1177729046 21:25004796-25004818 AACATGAACTCTATGAAGGCAGG - Intergenic
1182050336 22:27308259-27308281 AAAATGAATCCTATGGAGATGGG - Intergenic
1182951848 22:34383490-34383512 AATATGACCCCCATGAAGGAAGG + Intergenic
1183562615 22:38588152-38588174 AAAATGCCTCCTTTCATGGCTGG + Intronic
1183922206 22:41178105-41178127 AACATGAATCCAATGCAGGCGGG + Exonic
1185253465 22:49818118-49818140 AAAATGACACCAGTGAAGGCGGG + Intronic
950944379 3:16929389-16929411 AAAAAGACTTCTGGGAAGGCGGG + Intronic
952912627 3:38203910-38203932 AAAATGACTGCCATGAAAGGAGG - Intronic
952946745 3:38482942-38482964 AAGATGACTGCCATGAAGGCAGG + Intronic
956108884 3:65851116-65851138 AAAATGCCTCATTAGAAGGCAGG + Intronic
957544973 3:81625178-81625200 AAAATATCTTCTATCAAGGCAGG - Intronic
960425004 3:117496346-117496368 AAAAAGAGTACTATGAAGGGAGG + Intergenic
960484117 3:118229889-118229911 AAAATTACTCATGTGAAGCCTGG - Intergenic
961127672 3:124435155-124435177 GCAATGCCTCCTATGAAGGTTGG + Intronic
962020519 3:131496208-131496230 AGAATTACTCATATGAAGGCTGG + Intronic
962669945 3:137694771-137694793 AAAATGAGTACTTTGAGGGCAGG - Intergenic
963982611 3:151556797-151556819 AACATGACTTCTATGAAAACAGG - Intergenic
964591654 3:158369339-158369361 AAAATGGCTCATAGGAAGACAGG - Intronic
965927362 3:173998199-173998221 AGAATGACTGCTTTGAAAGCAGG - Intronic
966728506 3:183130775-183130797 AAAATGGCTCCCAGGAAGACTGG - Intronic
968421749 4:490790-490812 AAAATGAACCCTGTGCAGGCTGG + Intronic
968733716 4:2284448-2284470 AAAATGCTTCCTCTGAAAGCTGG - Intronic
969343510 4:6557098-6557120 AAAATGACCTCCTTGAAGGCTGG - Intronic
970239295 4:13991550-13991572 AAAATGACACATAGAAAGGCAGG + Intergenic
970890526 4:21038930-21038952 AAAAAGCATCCTGTGAAGGCTGG + Intronic
973049646 4:45579840-45579862 AAAATGAGTCCTTAGAAGACAGG - Intergenic
975129274 4:70816425-70816447 AAAAAAACTCCAATGACGGCTGG + Exonic
976169821 4:82291657-82291679 GAAATGACTACTATGGAAGCTGG - Intergenic
979730223 4:124014644-124014666 AAAATGTTTGCAATGAAGGCAGG + Intergenic
980770120 4:137361117-137361139 AAAATGAGTGGTATGAAGGGAGG + Intergenic
980847804 4:138344847-138344869 AGAATCTCTCCTATGAAGGATGG + Intergenic
984822261 4:183892271-183892293 AAAATTACACCTATGGAAGCAGG - Intronic
984896492 4:184546135-184546157 AACATGACTCCCCTGAATGCAGG + Intergenic
986413403 5:7504456-7504478 AACACAACGCCTATGAAGGCAGG + Intronic
986772324 5:10985541-10985563 AAAATGCAGCCTATGAGGGCTGG - Intronic
987468421 5:18300053-18300075 AAAATGACTGCTCTGCAGCCAGG + Intergenic
990312398 5:54552575-54552597 AAAATGACTCCAATGTGTGCTGG - Intergenic
993303545 5:86245437-86245459 AAAGTTACTCCTTTAAAGGCAGG + Intergenic
993334582 5:86642342-86642364 AAAAAGACCACTGTGAAGGCTGG - Intergenic
995113963 5:108458265-108458287 CATATAACTCCTATAAAGGCTGG + Intergenic
995177877 5:109199396-109199418 AAAATGTCTCCTTTTAAGCCTGG + Intergenic
995459248 5:112385484-112385506 AAAATAACCAGTATGAAGGCTGG - Intronic
999552504 5:152704637-152704659 AGAGTGAGTCCTATGAGGGCAGG - Intergenic
1000874434 5:166618679-166618701 AAAATGAGTCCTATGCAGCTGGG - Intergenic
1001446455 5:171787776-171787798 AGAATCACTGCTATGAAGGGTGG - Intronic
1008456414 6:51716282-51716304 CTAATGACTCATATGAAGGCTGG - Intronic
1013806190 6:113998505-113998527 AAAATAACTCCCATAAAGGAAGG - Intronic
1013967125 6:115968263-115968285 AATATGAGTTCTAGGAAGGCAGG - Intronic
1015886165 6:137920937-137920959 ATAATGACTCATATAAAAGCTGG + Intergenic
1016175606 6:141074826-141074848 AAAATGATTCCTATCAGGCCGGG + Intergenic
1016604039 6:145898637-145898659 GAATTGGCTCCTATGAGGGCAGG + Intronic
1016798036 6:148138735-148138757 AAAATAAAACCTTTGAAGGCAGG - Intergenic
1017704532 6:157109665-157109687 ATAATGAGTCATGTGAAGGCAGG - Intronic
1019752243 7:2738607-2738629 AAAATGACTTCTAGGGAGGGAGG + Intronic
1020922941 7:14287856-14287878 ACAATGACTTCTGTGAGGGCAGG - Intronic
1021902957 7:25305920-25305942 AAACTGCCTCCTATTCAGGCTGG - Intergenic
1022564574 7:31385072-31385094 AAAATAACTCCTGTGAAATCTGG + Intergenic
1030570540 7:111216891-111216913 AAAATAACACCTTTGAAGGGTGG + Intronic
1031101665 7:117487912-117487934 AAAATGAAGCCTATGTTGGCTGG + Intronic
1034407966 7:150918278-150918300 AAAGTGACAGCTATGAAGGAAGG + Intergenic
1035154392 7:156900311-156900333 AAAATGACTGGAATCAAGGCTGG - Intergenic
1036420130 8:8587874-8587896 AAAAGGCATCGTATGAAGGCAGG + Intergenic
1042113955 8:65411441-65411463 AATATAAGTCCTATTAAGGCTGG + Intergenic
1043883819 8:85575320-85575342 AAAGTGAATCCCATGAAAGCAGG - Intergenic
1045562194 8:103275338-103275360 AGGATGACTCCTAGGAAGTCAGG - Intergenic
1047353801 8:124100882-124100904 AAAATGGCTCATTTCAAGGCAGG - Intronic
1047449938 8:124956083-124956105 AAAATGACTCATCTGAAGAATGG - Intergenic
1047856924 8:128920589-128920611 AATAGTACTCCTATGAAGACGGG - Intergenic
1048139442 8:131778950-131778972 GAAATGCCTCCTTTGAATGCTGG + Intergenic
1050026442 9:1339397-1339419 AAAATGAATGCCAAGAAGGCAGG + Intergenic
1051409102 9:16770492-16770514 AAAATGACCCATATGAATACTGG + Intronic
1054752404 9:68921351-68921373 AAAATTCCTCCTATGAAAGAAGG + Intronic
1055203041 9:73691099-73691121 AATATGTCTCCTATGAACTCAGG + Intergenic
1057121159 9:92575515-92575537 AGAATGTCTCCTATCCAGGCTGG + Intronic
1057733530 9:97632680-97632702 TAAAAGTCTCCTATGACGGCCGG - Intronic
1057899026 9:98933306-98933328 AAAATGATTCTGATGCAGGCGGG + Intergenic
1058055874 9:100448361-100448383 AAAATGTCTTCTTTGAAGACTGG - Intronic
1058918510 9:109590780-109590802 CAAGAGACTCCTCTGAAGGCAGG - Intergenic
1062373046 9:136249960-136249982 ATAATGACTTCTCTGGAGGCTGG + Intergenic
1185692219 X:2164718-2164740 AAAATGACCCCCAAGCAGGCCGG - Intergenic
1189960053 X:46315697-46315719 AAATTGTCTGCTATGTAGGCTGG + Intergenic
1192542933 X:71990442-71990464 AAGATGACTCCTAGGTGGGCTGG - Intergenic
1192594113 X:72388268-72388290 AAAATAACTGATATGAAGGATGG + Intronic
1192908145 X:75573599-75573621 AAAATGACTTCAATGATGGGTGG + Intergenic
1198689980 X:139270498-139270520 AAAATAACTCCTTTGAAGACTGG + Intergenic
1201408381 Y:13672729-13672751 CAAAGGACTCCTGTGAGGGCAGG - Intergenic
1201921366 Y:19236549-19236571 AAAATAATTTCTAAGAAGGCAGG - Intergenic