ID: 936041732

View in Genome Browser
Species Human (GRCh38)
Location 2:109154985-109155007
Sequence AAAATGACTCCTATGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936041732_936041736 3 Left 936041732 2:109154985-109155007 CCAGCCTTCATAGGAGTCATTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 936041736 2:109155011-109155033 GTTGGGTTCATAAAATAGAGTGG 0: 1
1: 0
2: 0
3: 14
4: 135
936041732_936041738 26 Left 936041732 2:109154985-109155007 CCAGCCTTCATAGGAGTCATTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 936041738 2:109155034-109155056 AGTGTGTTCTGGTGTGCTCATGG 0: 1
1: 0
2: 1
3: 21
4: 215
936041732_936041737 15 Left 936041732 2:109154985-109155007 CCAGCCTTCATAGGAGTCATTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 936041737 2:109155023-109155045 AAATAGAGTGGAGTGTGTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936041732 Original CRISPR AAAATGACTCCTATGAAGGC TGG (reversed) Intronic