ID: 936043375

View in Genome Browser
Species Human (GRCh38)
Location 2:109167039-109167061
Sequence GTCCCGTGGGAATACCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936043375 Original CRISPR GTCCCGTGGGAATACCATGG AGG Intronic
902151752 1:14448836-14448858 GTCACGTGTGAATGTCATGGGGG - Intergenic
1075423525 10:122324298-122324320 GTCCCTTGGGAATAGTATGTGGG - Intronic
1075612043 10:123862158-123862180 GACCCGGGGGAACACAATGGAGG + Intronic
1076807598 10:132866774-132866796 TTACCGTGGGAGCACCATGGAGG - Intronic
1084501966 11:69540305-69540327 GCTCCGTGGGAATTCCCTGGGGG + Intergenic
1087063135 11:94002310-94002332 GTCCTGTGGGAGTTCCAAGGTGG + Intergenic
1089071426 11:115702300-115702322 ATCCCTTGGGAACACCAAGGAGG + Intergenic
1096834728 12:54342456-54342478 CTCACGCGGGAATACCATGCTGG + Intronic
1116224152 14:42126642-42126664 GAACAGTGTGAATACCATGGGGG + Intergenic
1117609048 14:57463747-57463769 GGCCTGTGGGGATACGATGGGGG - Intergenic
1117638354 14:57771015-57771037 TTCCTGTGAGAATTCCATGGGGG - Intronic
1127973696 15:63981819-63981841 GGCCCGTGGGAGAAACATGGAGG + Intronic
1131077969 15:89510201-89510223 GTCCCCTGGCAGTGCCATGGAGG + Intergenic
1138852867 16:60651198-60651220 GTCGTGTGGGAAGGCCATGGTGG - Intergenic
1146307778 17:31743872-31743894 ATCCCTTGGGAGTACCCTGGAGG - Intergenic
1150357616 17:64500915-64500937 TTCCTGTAGGAATACCATTGAGG + Intronic
1150932134 17:69596315-69596337 GCCCCGTGGCAATGCCAGGGTGG - Intergenic
1152467764 17:80475607-80475629 GTCCCGGGTGAACACCCTGGAGG - Exonic
1157133936 18:45035808-45035830 ATTCGGTGGGAATGCCATGGTGG + Intronic
1158630738 18:59111986-59112008 GACTCATGGGAATACCAGGGGGG + Intergenic
932743847 2:74314771-74314793 GTCACCTGGGGATACCATGAAGG + Intronic
935054443 2:99553276-99553298 GTCCAATGAGAATGCCATGGGGG - Intronic
936043375 2:109167039-109167061 GTCCCGTGGGAATACCATGGAGG + Intronic
946026176 2:216673229-216673251 GCCCTGTGGGGGTACCATGGAGG + Exonic
948808354 2:240462623-240462645 GTCCCTTGGGCAGAGCATGGGGG - Intronic
1175980175 20:62734894-62734916 GTCCCGTGGAAATAGGATGCAGG - Intronic
1177463399 21:21442529-21442551 ATCCCGTAGAAATACCATGAAGG + Intronic
1178153480 21:29823927-29823949 GTTTAATGGGAATACCATGGAGG + Intronic
1181997862 22:26897315-26897337 GGCCCGTGGGAAGAGCAGGGTGG - Intergenic
1183585622 22:38751371-38751393 GTCCTGTGGGACAACCATGAGGG + Exonic
949269873 3:2202329-2202351 TTTCTGTGGGAAAACCATGGGGG + Intronic
953804985 3:46060996-46061018 GTTATGTGGGAATACCATGATGG + Intergenic
960430063 3:117558447-117558469 GTCCTGTGGGAATACAACAGGGG + Intergenic
982529473 4:156521167-156521189 GTCCCATGGGGATATTATGGAGG - Intergenic
984870193 4:184318410-184318432 GTCCCGTGGGGGTCCCATGGGGG + Intergenic
989503022 5:42191380-42191402 GTTCCGTGGGAACACAAAGGAGG + Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1004256178 6:14066809-14066831 GTCCCCTGTGACTACCTTGGAGG - Intergenic
1009957059 6:70468477-70468499 GTCCCATGGGAGTGACATGGAGG - Intronic
1013695356 6:112696738-112696760 GTCTCTTGGGAATACCAAGTTGG - Intergenic
1014653693 6:124073042-124073064 GTCCTGTTGGAAACCCATGGAGG + Intronic
1020837938 7:13177766-13177788 GTACCATGAGAATAGCATGGGGG + Intergenic
1029544483 7:101203013-101203035 GTCCCCTGGGAAGAGGATGGTGG + Intergenic
1045663056 8:104457994-104458016 GTCCAGTGGGAAGACGAAGGTGG - Intronic
1060154250 9:121308212-121308234 GTCCCTTGGGACTAGCAGGGCGG - Intronic
1185467352 X:362782-362804 GTCCTGTGGGAGTAGCAGGGCGG - Intronic
1185467389 X:362918-362940 GTCCTGTGGGAGTAGCAGGGTGG - Intronic
1189122498 X:38409450-38409472 GTCCCCTGGGAATGCCCTGGAGG - Intronic