ID: 936045464

View in Genome Browser
Species Human (GRCh38)
Location 2:109184469-109184491
Sequence GACCCACGGCTGGGACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936045464_936045474 22 Left 936045464 2:109184469-109184491 CCTGTCTGTCCCAGCCGTGGGTC 0: 1
1: 1
2: 1
3: 5
4: 137
Right 936045474 2:109184514-109184536 GCGGATAGAGCTGGGCTGGGAGG 0: 1
1: 0
2: 0
3: 23
4: 265
936045464_936045469 13 Left 936045464 2:109184469-109184491 CCTGTCTGTCCCAGCCGTGGGTC 0: 1
1: 1
2: 1
3: 5
4: 137
Right 936045469 2:109184505-109184527 GAGTCCTGTGCGGATAGAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 83
936045464_936045473 19 Left 936045464 2:109184469-109184491 CCTGTCTGTCCCAGCCGTGGGTC 0: 1
1: 1
2: 1
3: 5
4: 137
Right 936045473 2:109184511-109184533 TGTGCGGATAGAGCTGGGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 173
936045464_936045470 14 Left 936045464 2:109184469-109184491 CCTGTCTGTCCCAGCCGTGGGTC 0: 1
1: 1
2: 1
3: 5
4: 137
Right 936045470 2:109184506-109184528 AGTCCTGTGCGGATAGAGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 70
936045464_936045472 18 Left 936045464 2:109184469-109184491 CCTGTCTGTCCCAGCCGTGGGTC 0: 1
1: 1
2: 1
3: 5
4: 137
Right 936045472 2:109184510-109184532 CTGTGCGGATAGAGCTGGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 164
936045464_936045468 3 Left 936045464 2:109184469-109184491 CCTGTCTGTCCCAGCCGTGGGTC 0: 1
1: 1
2: 1
3: 5
4: 137
Right 936045468 2:109184495-109184517 TCACTGCTCAGAGTCCTGTGCGG 0: 1
1: 0
2: 1
3: 43
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936045464 Original CRISPR GACCCACGGCTGGGACAGAC AGG (reversed) Intronic
900637364 1:3672571-3672593 GGTCCAGGGCTGGGACAGAGCGG - Intronic
904775180 1:32901705-32901727 GGCCCAAGGCTGGGACGGAGAGG + Intergenic
904903048 1:33872686-33872708 GAAACACAGCTGGGACAGAAAGG + Intronic
916725315 1:167517739-167517761 CACCCACGCCTGGGACTGCCGGG - Intronic
917001962 1:170370221-170370243 GATCCTCGGCTGGGGCAGGCTGG + Intergenic
917431786 1:174976901-174976923 GGCCCCTGGCTGGGACTGACAGG - Intronic
917624766 1:176834653-176834675 GACCCACAGCTGAGAAAAACAGG + Intronic
922238624 1:223740087-223740109 GACCCTCAGCTGGGAAAGATGGG + Intronic
1064015857 10:11771807-11771829 GACCCCAGGCTGGGAAACACTGG - Intergenic
1070461627 10:76676137-76676159 GTCCCAGGGCTGGGATACACAGG + Intergenic
1075730292 10:124631747-124631769 GACCCAGGGCTGGTGCAGAGGGG - Intronic
1076288118 10:129321444-129321466 GATCCACGGCTGAGTCAGAAGGG + Intergenic
1077268090 11:1661899-1661921 CACCCACGGCCAGGACAGGCAGG + Intergenic
1077272828 11:1689835-1689857 CACCCACGGCCGGGACAGGCAGG - Intergenic
1079348955 11:19676732-19676754 AACCCAGGCCTGGGACAGCCTGG - Intronic
1083671222 11:64300818-64300840 GACCCGCGGGTGGCACAGCCCGG + Exonic
1084417699 11:69042978-69043000 GACCCATGGATGGGGCAGGCAGG + Intergenic
1084666802 11:70580728-70580750 GAGCCAGGGCTGGGGCAGGCGGG + Intronic
1087205270 11:95387509-95387531 GACCCAGGTCAGTGACAGACTGG - Intergenic
1103341914 12:120225268-120225290 GCCCCACGGCTCAGACAGCCTGG + Intronic
1104822288 12:131684082-131684104 CGCCCAGGGCTGGGACACACTGG + Intergenic
1105620452 13:22061193-22061215 GACCCAAGGCTGGGAAACAAAGG - Intergenic
1106183447 13:27387491-27387513 CACACACGGCTGGGCCAGAGGGG - Intergenic
1106201479 13:27541159-27541181 GAGCCACAGCTAGGACAGAGAGG + Intergenic
1108096124 13:46903280-46903302 TAACCATGGCTGAGACAGACTGG + Intergenic
1112291161 13:98144440-98144462 TCCCCAGGGCTGGGAGAGACAGG - Intronic
1113077439 13:106480916-106480938 GACCCACGGCCTGGACAGTTTGG + Intergenic
1113355669 13:109577576-109577598 GGCCCATGACTGGGACAGGCTGG + Intergenic
1120884724 14:89442780-89442802 CATCCATGGCTGGGAAAGACTGG - Intronic
1121438046 14:93931839-93931861 CACCCACCGCTGGGTCAAACAGG + Intergenic
1122037954 14:98962053-98962075 GCCCCACTGCTGGGACATCCTGG - Intergenic
1125019063 15:34967344-34967366 GAAACAGGGCTGTGACAGACTGG - Intronic
1125535069 15:40437843-40437865 GACTGACAGCCGGGACAGACTGG - Intergenic
1129229359 15:74188332-74188354 GACCCCAGGCTGGGACGGATGGG - Intronic
1130870910 15:87971585-87971607 GACCCAGTGCTGAGAAAGACTGG + Intronic
1130892480 15:88144943-88144965 GACCCTCTGCAGGGACAGAAGGG - Intronic
1132369994 15:101289503-101289525 GAAGAACGGGTGGGACAGACAGG + Intronic
1132632814 16:928101-928123 CACCCAACGCTGGGACAGCCTGG + Intronic
1132981887 16:2742514-2742536 GACCCAGGGCCTGGACAGACTGG + Intergenic
1137716587 16:50601927-50601949 GACCCAGGGATGGGAGAGGCTGG - Intronic
1141944366 16:87299175-87299197 GAGCCACTGCAGGGACAGGCTGG - Intronic
1142130212 16:88428774-88428796 GTCCCACAGCTGGGGCAGCCTGG - Exonic
1142250375 16:88989224-88989246 GACCCACGCCTGGGCCATGCGGG - Intergenic
1144781586 17:17810960-17810982 GACGCACGGCGGCGACACACGGG - Exonic
1145264547 17:21373512-21373534 CACCCAAAGCTGGGAGAGACTGG + Intergenic
1147833784 17:43315579-43315601 GACCCCCGGATGGTCCAGACCGG + Intergenic
1147980722 17:44272425-44272447 GTCCCACGGCTGGGACATGTGGG + Intergenic
1150587642 17:66532984-66533006 AACCCACGGCTGGAAAATACTGG + Intronic
1151231432 17:72688017-72688039 GACCCAAGCCGGGGACAAACAGG + Intronic
1151512543 17:74570195-74570217 GACCCACATCTGGGACATCCAGG + Intergenic
1151704353 17:75758732-75758754 GACCCACGTCTGAGAGAGCCAGG - Intronic
1152262917 17:79276901-79276923 GACTCAGGGCTGGTACAGGCTGG + Intronic
1152523186 17:80872456-80872478 GACCCAGTGCTGGGACAGCTGGG - Intronic
1152531579 17:80922304-80922326 GACTCAAGGCTGGGACAGTGTGG + Intronic
1158397970 18:57094670-57094692 GACCCACGGCCGGAACACAGAGG - Intergenic
1160462064 18:79046784-79046806 GACCCAGGGAGGGGCCAGACGGG + Intergenic
1160486121 18:79294423-79294445 GAGCCACGGCTGGGCAAGGCTGG - Intronic
1160804915 19:988395-988417 TGCCCAGGGCCGGGACAGACCGG - Intronic
1161018755 19:1997652-1997674 GACCCACGGCAAGGACAGGCAGG + Intronic
1161153277 19:2720601-2720623 GACCCAGGGCTGGGGTAGATTGG - Intronic
1162859695 19:13496931-13496953 GAATCACCACTGGGACAGACTGG + Intronic
1163827908 19:19533871-19533893 GACCCAAGACTGGGACTGAGGGG - Intronic
1164623134 19:29709307-29709329 GAGCCAGGGCAGGGAGAGACGGG + Intronic
1166300355 19:41909134-41909156 GCCCCACGCCTGGGAGAGCCAGG - Intronic
1166406121 19:42523091-42523113 GACCCACAGGTGGGTCAGGCAGG - Intronic
1167611309 19:50508985-50509007 GACTGAAGGCAGGGACAGACTGG + Intronic
1168001140 19:53446955-53446977 GACCCAGGGCTGGGTCAGGAAGG + Intronic
928816890 2:35307681-35307703 GACCCCCTGCTGCCACAGACTGG + Intergenic
928928097 2:36598250-36598272 GACCCAGGGTTGGGACAGCCTGG - Intronic
929646920 2:43637358-43637380 GACCCGCTGCTGAGATAGACAGG + Exonic
929790336 2:45017815-45017837 GCCCCACAGCTGGGAAAGTCTGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
936045464 2:109184469-109184491 GACCCACGGCTGGGACAGACAGG - Intronic
938262748 2:129907002-129907024 GACCTACGCCAGGCACAGACAGG - Intergenic
946481114 2:220057669-220057691 GGCACATGGCTGAGACAGACTGG + Intergenic
948135789 2:235635200-235635222 GACCCACTGCTGCCACACACAGG - Intronic
948386864 2:237585919-237585941 GACCCACACCTGGGGCAGATGGG - Intronic
1172101127 20:32484264-32484286 GACCCCGGGCTGGGAAAGCCAGG + Intronic
1172528929 20:35617469-35617491 GGCCCACGGCAGGGAGAGGCGGG - Intronic
1172655022 20:36531613-36531635 GAACCAGGACAGGGACAGACAGG + Intergenic
1174208231 20:48856753-48856775 GACCCACTGGTGGGAGAAACTGG - Intergenic
1175305944 20:57975625-57975647 GCCCCCTGGCTGGGACAGGCTGG + Intergenic
1176147889 20:63573573-63573595 GACCCCTGGCTGGGGCAGAGGGG - Intronic
1176251653 20:64124649-64124671 GACCTAAGGCTGTGCCAGACAGG - Intergenic
1176260621 20:64177705-64177727 GACCCGCTGCTGGGAAAGGCTGG + Intronic
1178254790 21:31042193-31042215 TAGCCACGGCTGGTACAGGCTGG + Intergenic
1181992889 22:26850973-26850995 GACCCATGCCTGAGACAAACAGG - Intergenic
1182768651 22:32777232-32777254 GACCCACAGCTGGGACACGAAGG - Intronic
1183079883 22:35449575-35449597 GGGCCACGGCTGGGACAGAGAGG - Intergenic
1183079888 22:35449595-35449617 AGACCACGGCTGGGACAGAGGGG - Intergenic
1183087778 22:35497484-35497506 GACCCAGAGCTGAGCCAGACTGG + Intergenic
1183922113 22:41177652-41177674 GAGCCAGGGATGGGACCGACAGG + Exonic
1184167062 22:42735864-42735886 GTCCCAGGGTTAGGACAGACTGG - Intergenic
1184791257 22:46701516-46701538 GACCCACGGCCAGGACAGGACGG + Intronic
1185277448 22:49955905-49955927 GGCCCAGGCCTGGGACACACAGG + Intergenic
952132770 3:30384192-30384214 GACCCATGGGAGGTACAGACAGG + Intergenic
952834001 3:37588915-37588937 GACCCAAGGCTGGGTCTGAGTGG + Intronic
954906225 3:54065362-54065384 ACCCCACGCCTGGGACAAACAGG - Intergenic
961313479 3:126018498-126018520 GTCCCAAAGCTGGGACAGAAAGG + Intronic
961365322 3:126395798-126395820 GACCCTCGGGTGGGAGAGGCAGG + Intronic
968546464 4:1201273-1201295 GACTCACGGCCGGGACACTCAGG - Intronic
969694391 4:8726378-8726400 GATCCACAGCTGGGAGACACAGG - Intergenic
969791931 4:9498561-9498583 GCCCAGAGGCTGGGACAGACGGG - Intergenic
969866088 4:10077924-10077946 GTCCTACGGCAGGGACAGAGAGG + Exonic
978495013 4:109349392-109349414 GACCAAAGGCAGGGACAGGCTGG - Intergenic
997658080 5:135569933-135569955 GAGCCACGCCTGGGAGATACTGG - Intergenic
999510567 5:152246580-152246602 GAACCACGTCTGGGACTGAAAGG - Intergenic
1005775815 6:29129936-29129958 GACCCTCGGCAGGAACAGCCTGG + Intergenic
1006260623 6:32866240-32866262 GACCCCTGGTTGGGATAGACCGG + Intergenic
1007679048 6:43621835-43621857 GAGCCACGGCTGGCAGAGAATGG - Intronic
1012135497 6:95551357-95551379 GAGCCACAGATGGGACAAACTGG + Intergenic
1012243203 6:96897591-96897613 GACCCACGCTAGGGACAGCCGGG + Intronic
1018148876 6:160920305-160920327 GACACATGGGTGGGACAGAGAGG + Intergenic
1019610668 7:1935244-1935266 GAGCCACGGCTGGACCAGAAAGG + Intronic
1019940139 7:4283035-4283057 GACTCAGGGGTGGGACAGGCAGG - Intergenic
1021359191 7:19690622-19690644 GACCCATTTCTGGGACATACAGG - Intergenic
1024356769 7:48421614-48421636 GAGCCAGGGCTGGGAAAGAATGG - Intronic
1025946301 7:66107475-66107497 GGCTGAGGGCTGGGACAGACAGG + Intronic
1029252245 7:99245104-99245126 ACCCCACGGCTGAGACAGGCTGG + Intergenic
1033001178 7:137507028-137507050 GACCCACAGCAGGGAAAAACTGG - Intronic
1033226978 7:139570260-139570282 GCCCCACAGCTGGGTCAGCCTGG - Exonic
1035931312 8:3783392-3783414 GACCCACGGCTGGCACAGTCAGG + Intronic
1036142736 8:6223450-6223472 GAACCACGGCCTGGGCAGACAGG + Intergenic
1036770591 8:11575988-11576010 GACCCACTGCCGGGAAAGCCGGG - Intergenic
1041878297 8:62715815-62715837 GACCAACAGCTGGGACACTCTGG + Intronic
1045832904 8:106485940-106485962 TACCAACAGCTGGGACAGAGGGG + Intronic
1048373944 8:133805372-133805394 GAGCCCTGGCTGGGACAGCCAGG + Intergenic
1049381215 8:142316992-142317014 CACCTACGGCAGGGACAGATTGG + Intronic
1049441958 8:142613678-142613700 GACCCACGGCTGGTACTGCTGGG + Exonic
1049623589 8:143610064-143610086 GACCGACGGAGGGGACAGTCGGG + Intergenic
1053475303 9:38377916-38377938 GGCGCACGGCTGGGACTGGCAGG + Intergenic
1057196959 9:93120778-93120800 GACCCACAGCGGGGACACAGAGG + Intergenic
1057384255 9:94593550-94593572 GACTCACAGGTGGGCCAGACCGG + Exonic
1057495043 9:95553896-95553918 TACCCACAGCTGGGAGAGGCAGG + Intergenic
1058230324 9:102417147-102417169 CAGCCACGGCTGGAGCAGACTGG - Intergenic
1059415753 9:114161626-114161648 GGGCTAAGGCTGGGACAGACAGG - Intronic
1059814110 9:117892370-117892392 GAACCCCACCTGGGACAGACAGG - Intergenic
1060543523 9:124447445-124447467 GAGCCACGGCTGGGGTAGATTGG + Intergenic
1060725791 9:126005143-126005165 AGCCCATGGCGGGGACAGACAGG + Intergenic
1061505955 9:131032031-131032053 GACCCACTCCTGGGGCAGAGGGG - Exonic
1062116020 9:134809309-134809331 GACCCATGGCTGGGCCTGGCTGG + Intronic
1062441298 9:136570929-136570951 GCCCCACGGCTGGGACAGACAGG + Intergenic
1188101581 X:26094602-26094624 AACCCAAGGATGGGACAGAAAGG - Intergenic
1200043173 X:153384553-153384575 GACCCAGGACTGTGAAAGACGGG + Intergenic
1200052480 X:153442342-153442364 AACCCCAGGATGGGACAGACAGG - Intergenic