ID: 936045758

View in Genome Browser
Species Human (GRCh38)
Location 2:109186649-109186671
Sequence TTTCCCGCAGGGTCTTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936045758_936045762 3 Left 936045758 2:109186649-109186671 CCCTAGGAAGACCCTGCGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 936045762 2:109186675-109186697 ATCTTACTAGCTTTTCTCAAAGG 0: 1
1: 0
2: 2
3: 23
4: 227
936045758_936045763 25 Left 936045758 2:109186649-109186671 CCCTAGGAAGACCCTGCGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 936045763 2:109186697-109186719 GAGCCACACACACAGCTTTGAGG 0: 1
1: 1
2: 2
3: 27
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936045758 Original CRISPR TTTCCCGCAGGGTCTTCCTA GGG (reversed) Intronic
903833856 1:26190268-26190290 TTTTCCCCAGGGCCTTCCCAGGG - Intergenic
907605602 1:55814372-55814394 TTGCCCTCAGCATCTTCCTATGG + Intergenic
911316518 1:96362612-96362634 CTTCCCTCAGGATCTTCATAAGG - Intergenic
919149476 1:193677436-193677458 TTTCCTCCAAGGACTTCCTATGG + Intergenic
920067791 1:203281415-203281437 ATTCCCACAGGGCCTTCCTAGGG + Intergenic
921898362 1:220424342-220424364 TTTCCCCCAGGTTATTTCTATGG + Intergenic
1069147332 10:64910583-64910605 TTTGCCTCAGGGTCTTCTTTTGG + Intergenic
1075623952 10:123948380-123948402 TTTCCCTCATGGCCTTCCTCTGG - Intergenic
1076869277 10:133185680-133185702 CTTCCCTCTGGGGCTTCCTATGG - Intronic
1077164981 11:1130876-1130898 CTTCCCACAGGGGCTTCCTGGGG - Intergenic
1077445546 11:2589024-2589046 TTCCCCTCAGAGTCTTCCCAAGG + Intronic
1079430948 11:20387835-20387857 TGTCCCGGAGGGTCTTCCACCGG - Intronic
1081973798 11:47218037-47218059 TTTCCCCCATGGTCTTCTCATGG + Intronic
1088992219 11:114963514-114963536 TCTGCAGCAGGGACTTCCTAAGG - Intergenic
1095054320 12:37581894-37581916 TCTCCCGCAGAGTCTTCTTTGGG + Intergenic
1097232593 12:57521686-57521708 TTTCCCCCACGGTACTCCTATGG + Intronic
1098484082 12:71000562-71000584 TTTCTCCCTGTGTCTTCCTAAGG + Intergenic
1098841898 12:75487484-75487506 TTCCCCGCAGGGGGTTCCTGGGG + Intronic
1108341394 13:49501438-49501460 TTTCCCCCAGTTTCATCCTAGGG + Intronic
1113403065 13:110012757-110012779 TTTCCCCAAGGGTCTTCTTTAGG + Intergenic
1113917877 13:113884948-113884970 TAACCTGCAGGGTCCTCCTAAGG - Intergenic
1115235722 14:31207373-31207395 CTTCCCGCAGGCTCTTACTCGGG + Exonic
1116699988 14:48229042-48229064 TTTCCCAGAGGGTTTTGCTATGG + Intergenic
1117072376 14:52068719-52068741 TTTCCCGCAGCTTCTTCCCTGGG - Intronic
1117714355 14:58565211-58565233 ATTCCTGTGGGGTCTTCCTACGG + Intergenic
1117982272 14:61353558-61353580 TTTCCCACAGGGTACTCCAAGGG - Intronic
1120083010 14:80236757-80236779 TTTCCCTCAGGTTCTCCCTGAGG + Intronic
1122964562 14:105116194-105116216 TTTTCCTCAGGGTCTTCATGGGG + Intergenic
1127128155 15:55833739-55833761 TAACCTGCAGGGTATTCCTAGGG - Intronic
1128063484 15:64749708-64749730 TTTCCCACAGGATATTCCTGGGG - Intronic
1128750142 15:70143039-70143061 CTTCCCGCAGGGTCACCCTGAGG - Intergenic
1132258603 15:100401268-100401290 TTTTACTCAGGGTCTTCCTTGGG + Exonic
1140743031 16:77958381-77958403 TTTCCCGCAGGTCTTTCCAAGGG + Intronic
1142330176 16:89447056-89447078 TTTCATGCAGTGTCTTCGTAGGG - Intronic
1143104046 17:4519614-4519636 GTTCCCGCAGGGACATCCTGTGG - Intronic
1143921766 17:10336038-10336060 ATTCCCGCAGAGGCATCCTATGG + Intronic
1146824900 17:36013592-36013614 TGCCCTGCAGGATCTTCCTAAGG + Intronic
1147726911 17:42571537-42571559 TCTCCCGCAGGGTCTGGCGAGGG - Exonic
1148795533 17:50194982-50195004 TTTCCCTCAGGGGGCTCCTAGGG + Intronic
1152879485 17:82807055-82807077 TGTCCATCAGGGTCTTCCCAGGG + Intronic
1154400442 18:14031932-14031954 TTCCCTGCATGGTCTTCTTAAGG + Intergenic
1156622491 18:38869218-38869240 CTAACCGCAGGGTCTTCCAAGGG - Intergenic
1165543449 19:36511775-36511797 TTTTCAGCACGGTCTTCCCAAGG + Exonic
927454901 2:23240975-23240997 TTTCCTGCTGTGTCTTCCCATGG + Intergenic
934047859 2:88186832-88186854 TTTCCCACAGGGTCTCCATCTGG - Intergenic
936045758 2:109186649-109186671 TTTCCCGCAGGGTCTTCCTAGGG - Intronic
941000724 2:160201036-160201058 TTTCCCCCAGGGTGTTCTTCAGG + Intronic
946013140 2:216582701-216582723 TTTCCCTCAGGGCCTCCCAAGGG - Intergenic
947220337 2:227785685-227785707 TTTCCCTCAGTGCTTTCCTATGG - Intergenic
949020475 2:241738397-241738419 TTACCCGCACGGTGTTCCTGAGG - Intronic
1170139713 20:13113207-13113229 TTTCCCGTAGGATTTTCCAAAGG + Intronic
1170871251 20:20208738-20208760 CTTCTCGCAGGTCCTTCCTATGG - Intronic
1179890303 21:44331781-44331803 TGTCCCCCAGGGTCCTCCCACGG - Intronic
1182600031 22:31455234-31455256 TTTTCAGCATGGTCTTCCAATGG + Exonic
1182804333 22:33057944-33057966 TTTCCCGCAAGCTCTTCCCCGGG + Intronic
951893114 3:27585179-27585201 TTTGACGCAGCCTCTTCCTAGGG - Intergenic
952495182 3:33909574-33909596 TTTCCTGCGAGGTTTTCCTAAGG - Intergenic
955331565 3:58051581-58051603 TTTCCAGCTGGGTCTACCTTCGG - Intronic
963665672 3:148182859-148182881 TTTCTTGCAGAGTCTTCCCATGG + Intergenic
964668196 3:159196618-159196640 CTCTCCACAGGGTCTTCCTAAGG + Intronic
967917986 3:194592995-194593017 CTTCCAGGAGGGACTTCCTATGG - Intronic
968193795 3:196690477-196690499 TCTCCCGAAGGGTCTGCCTGCGG + Intronic
969598517 4:8162159-8162181 TTTCCCCCAGGGTCCTACTGGGG - Intergenic
970502299 4:16690443-16690465 CTTCCTGCAGGGTCTTCCTCCGG - Intronic
975611740 4:76210590-76210612 TTTCCCACACCCTCTTCCTAGGG - Intronic
978091185 4:104717704-104717726 TTTCCCGCAAAGTCTTTCTGTGG - Intergenic
980965809 4:139519733-139519755 TTTCCCTAAGTGTCTGCCTAAGG - Intronic
984279196 4:177647847-177647869 TTTCCAGTAGGGTCTTGCTATGG - Intergenic
985883212 5:2656599-2656621 TTTCCCCTGTGGTCTTCCTAAGG - Intergenic
987027384 5:13940975-13940997 ATTCCCCCAGGGTCTAGCTATGG + Intronic
997393036 5:133532544-133532566 TGTCTAGCAGGGTCTTCCTTGGG - Intronic
1000171443 5:158706686-158706708 TTTCCCACAGTGTCTTCCCTTGG - Intronic
1001290242 5:170452082-170452104 TTTCCCTCTGGGTCTTTCCATGG - Intronic
1001799731 5:174532535-174532557 TTTTCCAAAGGGTCTTTCTAAGG + Intergenic
1002759787 6:192448-192470 TTTCCCGCAGCCTCTTCCAGTGG + Intergenic
1007224284 6:40302039-40302061 TGTCCCACATGGTCTTCCAAAGG - Intergenic
1008006076 6:46410681-46410703 TTTCCTGCAGGTTATTCCTATGG - Intronic
1013086167 6:106859667-106859689 ATTTCCACAGGGTCTTCATATGG - Intergenic
1013286267 6:108684835-108684857 TTTCTCTCAAGGTCTTCCTGTGG + Intergenic
1013660697 6:112293704-112293726 TTTCCAGCAGGATTTTCATATGG + Intergenic
1013798401 6:113911030-113911052 TTTCCCGCATGCTGTTCTTATGG - Intergenic
1017501364 6:155026342-155026364 CTTCCCCCAGGTTCTTCCCAAGG + Intronic
1022047974 7:26638535-26638557 TACCCAGCAGGGGCTTCCTAAGG - Exonic
1024154470 7:46606114-46606136 TTTCCTACAGTGTCTTTCTATGG + Intergenic
1029283627 7:99451996-99452018 CTCCCCGCAGGGTCTTACTCTGG - Intronic
1030220317 7:107091757-107091779 TCTCCAGCAGTGGCTTCCTATGG + Intronic
1030319650 7:108151901-108151923 TTTCCAGCAGTGTATTCCTTGGG - Intronic
1038308973 8:26430804-26430826 TTGCCTGCTGGGTCTTCCCAAGG + Intronic
1050815538 9:9806951-9806973 TTTTCCCCAGGTTCTTCCTTTGG - Intronic
1052511816 9:29431900-29431922 TTTTCCCCACTGTCTTCCTATGG + Intergenic
1056279644 9:85028789-85028811 TCTCCCGCAGAGCCTTCCAAGGG - Intergenic
1056833736 9:89937036-89937058 TTTCTCACTGGTTCTTCCTAAGG + Intergenic
1060074616 9:120580141-120580163 TTTCCCGGCGCTTCTTCCTACGG + Exonic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1201683568 Y:16677018-16677040 TTGCCCTCAGGGTCTTCCACTGG - Intergenic