ID: 936047015

View in Genome Browser
Species Human (GRCh38)
Location 2:109196135-109196157
Sequence ACGTCCCACTCAGGGTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936047009_936047015 13 Left 936047009 2:109196099-109196121 CCTTTAATGGGACGAGGGACAGA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 936047015 2:109196135-109196157 ACGTCCCACTCAGGGTCACATGG 0: 1
1: 0
2: 1
3: 10
4: 113
936047008_936047015 16 Left 936047008 2:109196096-109196118 CCTCCTTTAATGGGACGAGGGAC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 936047015 2:109196135-109196157 ACGTCCCACTCAGGGTCACATGG 0: 1
1: 0
2: 1
3: 10
4: 113
936047003_936047015 28 Left 936047003 2:109196084-109196106 CCTGGCTCTAAGCCTCCTTTAAT 0: 1
1: 0
2: 2
3: 19
4: 169
Right 936047015 2:109196135-109196157 ACGTCCCACTCAGGGTCACATGG 0: 1
1: 0
2: 1
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936047015 Original CRISPR ACGTCCCACTCAGGGTCACA TGG Intronic
900911255 1:5598491-5598513 AACTTCCCCTCAGGGTCACATGG - Intergenic
901639497 1:10686191-10686213 TCTTCCCTCTCAAGGTCACAGGG + Intronic
906096553 1:43228133-43228155 AAGTCCCAGTCAGGCCCACAAGG + Intronic
910914186 1:92271757-92271779 AGGTCCCACTCACGCTCAAAGGG - Intronic
911591645 1:99754639-99754661 ACGTTCCTCTCAAGCTCACATGG + Intronic
916207005 1:162324923-162324945 ACATCCCAGTCATGGTGACAAGG + Intronic
917056792 1:170991345-170991367 AGGTCCCACTTAGAATCACATGG - Intronic
917489726 1:175487914-175487936 ACTTGCCACTCAAGGACACAGGG + Intronic
921163815 1:212491586-212491608 TCCACTCACTCAGGGTCACACGG - Intergenic
1063903550 10:10760345-10760367 AGGTGCCAGTCTGGGTCACATGG - Intergenic
1070526971 10:77303673-77303695 AGGTCACACTCAGGGTGGCAAGG - Intronic
1072325048 10:94289283-94289305 GAGAGCCACTCAGGGTCACACGG - Intronic
1073001628 10:100290129-100290151 AAATCCCACACAGGCTCACAAGG - Exonic
1074292227 10:112146587-112146609 ACACCCCACACAGGGCCACATGG - Intergenic
1077812678 11:5654514-5654536 ACGTGCTCCCCAGGGTCACAAGG - Intergenic
1078387337 11:10903988-10904010 AGGTCCCACTCAGGGACTCCTGG + Intergenic
1078577291 11:12513200-12513222 ACGCGCCTCTCAAGGTCACAAGG - Intronic
1085189385 11:74605406-74605428 ATGTCCCTCTCAGGGGCACAGGG + Intronic
1086931336 11:92696303-92696325 ATATCCCACTCAGAGTAACATGG - Intronic
1088373577 11:109117295-109117317 GGGACCCACTCAGAGTCACAGGG + Intergenic
1091366085 11:135021944-135021966 ACGACCCATGCAGGGCCACATGG + Intergenic
1101251217 12:102938365-102938387 AGCTACCACTCAGGCTCACATGG + Intronic
1104876110 12:132035967-132035989 ACGACACACCCAGGTTCACACGG + Intronic
1105706756 13:22971971-22971993 CCGTCCCACCCAGACTCACACGG + Intergenic
1106047921 13:26162414-26162436 ACATGCCATACAGGGTCACAGGG - Intronic
1106354797 13:28970866-28970888 ACGCCGCACTCAGGGTTATAGGG + Intronic
1110172165 13:72514349-72514371 GCCTCCCACACAGGGTCAAAAGG - Intergenic
1111447109 13:88361076-88361098 ACTTGCCACTCAGGGCCATATGG - Intergenic
1111839491 13:93432237-93432259 ACCTACCCCTCAGGTTCACAGGG - Intronic
1113626233 13:111849904-111849926 GCTTCCCACTCAGGGTCCCCTGG - Intergenic
1113727985 13:112619282-112619304 ACGTGCCAACCAGGGTCAAAAGG - Intergenic
1114991694 14:28296593-28296615 ACCTCCCAGTCAGGGTCTCCAGG - Intergenic
1116942608 14:50805390-50805412 ACCTCCCTCTCAGGCTCACTGGG + Intronic
1121368166 14:93333116-93333138 TCGTCCCGCTCAGGGTCACGTGG + Intergenic
1121730886 14:96186260-96186282 AGCTCCTCCTCAGGGTCACACGG + Intergenic
1121763983 14:96469621-96469643 ACTTCCCAGTAAGGTTCACAGGG - Intronic
1122142051 14:99668425-99668447 ACGTCCCTCTCTGGGCCTCAGGG - Intronic
1123738408 15:23209601-23209623 GAGTTACACTCAGGGTCACATGG + Intergenic
1128143154 15:65316386-65316408 CCGTCCCACTCAGGGAGGCAGGG + Intergenic
1129155530 15:73714964-73714986 ATGTCCTGCTCAGGGTCATAGGG - Intergenic
1129409131 15:75339169-75339191 AGGTACACCTCAGGGTCACAGGG - Intronic
1131837886 15:96408882-96408904 ACGTCCAGCTCAGGGGCACTTGG + Intergenic
1132725534 16:1336752-1336774 ACCGCCCACTCAGGCTCTCACGG - Intronic
1136073331 16:27802074-27802096 TCATCCCACTCAGGATGACATGG - Intronic
1137702684 16:50508179-50508201 AAGTCTCACCCAGGATCACACGG + Intergenic
1141556478 16:84839787-84839809 ACGTCCCAGCCTGGGTAACATGG + Intronic
1142170442 16:88619333-88619355 ACGTCCCACACGTGGTAACATGG + Intronic
1142768976 17:2083029-2083051 ACACCTCGCTCAGGGTCACATGG + Intronic
1143322573 17:6077606-6077628 ACATCTCACACAGGGTCCCAAGG - Intronic
1143477598 17:7211652-7211674 ACGTACCACGCAGAGACACATGG + Intronic
1146287619 17:31584830-31584852 ACCTACCTCTCAGGGTCCCAGGG - Intergenic
1154363436 18:13684754-13684776 ACATTCCACTCAAGTTCACATGG + Intronic
1156459877 18:37315720-37315742 ACGTCCTCCCCAGGGACACAGGG + Intronic
1158542411 18:58369290-58369312 AGGAACCACTCAGGGTCTCAAGG + Intronic
1159529267 18:69635160-69635182 AAGTACCCATCAGGGTCACATGG - Intronic
1160981438 19:1818357-1818379 CCATCCCACTCAGGGTCCCTGGG - Intronic
1161004775 19:1929793-1929815 ACGTCCCCTTCAGGGTCACAGGG + Intergenic
1163251005 19:16126284-16126306 ACAGCCCTCTCAGGGTCACTGGG - Intronic
1164680080 19:30128382-30128404 CCGACCCACTTAGGGGCACAGGG - Intergenic
1165305731 19:35001354-35001376 ACGTCACACTCAGACACACAGGG - Intronic
1168242642 19:55095208-55095230 TGGTCTCACTCAGGATCACACGG + Intronic
1168599377 19:57705830-57705852 ATGTACCACACAGGGTCACATGG + Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
931931639 2:67144026-67144048 ACATCCCACTTAGGATCACAAGG + Intergenic
935585962 2:104800599-104800621 ACCTGCCTCACAGGGTCACAAGG - Intergenic
935681892 2:105645317-105645339 TCCTCCCACTCGGGCTCACAGGG + Intergenic
936047015 2:109196135-109196157 ACGTCCCACTCAGGGTCACATGG + Intronic
937885815 2:126899367-126899389 ACCTCCCACCCATGGCCACATGG - Intronic
944732801 2:202534523-202534545 GTGTCCCACTCAGGGTTAAATGG - Intronic
944857660 2:203784110-203784132 ACATCCCCCTCAGGCCCACAGGG - Intergenic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG + Intronic
1169746965 20:8952482-8952504 ACATCCTACTGAGAGTCACAGGG + Intronic
1170244286 20:14204013-14204035 ATGTACCACTCAGGGGCCCAAGG - Intronic
1173188436 20:40858640-40858662 AGATCCCACTCAGAGTCTCAAGG + Intergenic
1174195864 20:48772406-48772428 ACGTCTCACCCAGTGTCACAGGG - Intronic
1175387611 20:58607455-58607477 ACATCTCACTCAAGGTCACACGG + Intergenic
1175876845 20:62234321-62234343 CCTTCCCACTCAGGTGCACATGG - Intronic
1181565713 22:23735993-23736015 CCGTACTACTCAGGATCACATGG - Intergenic
1181730513 22:24843082-24843104 CCGGACCACTCAAGGTCACAGGG - Intronic
1182444261 22:30380942-30380964 ACTTCCCACCCACGGTCAGAGGG + Intronic
1182458792 22:30469959-30469981 ACGTACCACTCAAGGTCACTGGG - Intronic
1184873424 22:47257081-47257103 ACAACACACACAGGGTCACACGG - Intergenic
1185164495 22:49252846-49252868 CGGACCCACTCGGGGTCACATGG + Intergenic
950033651 3:9868519-9868541 ACCTGCCACCCAGGGTCATAAGG + Intronic
950055290 3:10019314-10019336 ACCTGCCACCCAGGGTCATAAGG + Intergenic
953722103 3:45365335-45365357 GCATCCCTTTCAGGGTCACAAGG - Intergenic
954034085 3:47841157-47841179 ACGCTCCACTCAGGGACTCAAGG + Exonic
963259416 3:143177620-143177642 TCTTGCCCCTCAGGGTCACAGGG + Intergenic
968817890 4:2831216-2831238 ACAGCCCACTCAGAGCCACAGGG - Intronic
982877041 4:160663158-160663180 GAGTTCCACTCATGGTCACAGGG - Intergenic
984204471 4:176769294-176769316 GCATGCCACACAGGGTCACAGGG - Intronic
984683263 4:182635894-182635916 ATGTGCAACTCAGGGTCAGAAGG + Intronic
996445885 5:123549698-123549720 GCATGCCACACAGGGTCACAGGG - Intronic
997358685 5:133280681-133280703 AAGGCCCACTCAGAGCCACAGGG + Intronic
997438856 5:133894472-133894494 ACGTCCCCCTCAGGGTCCCCAGG + Intergenic
1002639074 5:180622071-180622093 AAGTCCCACTGAGGGTGACAAGG - Intronic
1002964683 6:1951940-1951962 GTGGCCCACTCAGTGTCACAGGG + Intronic
1003829916 6:9996879-9996901 ACGTGGCACTCAGGTGCACAAGG - Intronic
1004473298 6:15947950-15947972 ACGGCCCACTGGGGGTCCCAAGG + Intergenic
1005681019 6:28208140-28208162 AGGTGCCACCCAGGGTCACGCGG - Intergenic
1006186857 6:32186359-32186381 TCTTGCCCCTCAGGGTCACAGGG - Exonic
1006421526 6:33937034-33937056 ATGTCCTCCTCATGGTCACATGG - Intergenic
1007490928 6:42221264-42221286 ATGACTCACTCAGGGTCATATGG + Intergenic
1010694195 6:78949630-78949652 ACATGCCACACAGGGCCACAGGG - Intronic
1016265306 6:142226012-142226034 ACGTGTCATTCAGGGTCATAAGG - Intergenic
1018093164 6:160362912-160362934 ACGTCCCATCCAGGGACCCACGG + Intronic
1018904447 6:168066995-168067017 ACGTCCCACTCAGGGTTCTCCGG - Intronic
1024149418 7:46554842-46554864 ACATACCACACAGGGCCACAGGG - Intergenic
1027944302 7:84725293-84725315 ACGTTCTTCTCAGTGTCACATGG + Intergenic
1037433392 8:18838161-18838183 AAGTCCCACTCAGGGTTGTAAGG - Intronic
1041554820 8:59141782-59141804 TCGTGCCATGCAGGGTCACAAGG + Intergenic
1044625669 8:94233620-94233642 ACGACACACTCGGGGTCACAGGG + Intergenic
1049344938 8:142133852-142133874 ACATCCCACAGAGGGTCAGATGG + Intergenic
1051842739 9:21416561-21416583 ATGACCCACACAGAGTCACATGG - Intronic
1057016578 9:91657657-91657679 ACGTCCCACCCAGCAGCACAGGG + Intronic
1060522116 9:124299912-124299934 ACGCCCAACTCAGGGTCAGGGGG - Intronic
1061575682 9:131504272-131504294 CCATCCCAGTCAGGGCCACAAGG - Exonic
1061899158 9:133664194-133664216 ATGTCCAACTCAAGATCACATGG - Intronic
1062010245 9:134263255-134263277 CCTTCCCACACAGGGTCAGAGGG + Intergenic
1062167044 9:135113112-135113134 AGGCCTCTCTCAGGGTCACATGG - Intronic
1062431232 9:136527708-136527730 GCGTCCCTCTTAGGGTCACCCGG + Intronic
1195062361 X:101208689-101208711 ACCTCCCACTTAGGGTAAGAAGG - Intergenic
1195737124 X:108023734-108023756 TCATGCCACACAGGGTCACATGG + Intergenic
1201631008 Y:16072067-16072089 GAGTTCCACTCATGGTCACAGGG - Intergenic