ID: 936048107

View in Genome Browser
Species Human (GRCh38)
Location 2:109202267-109202289
Sequence GACGCTGCCGAGATGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936048107_936048115 3 Left 936048107 2:109202267-109202289 CCCAGGTCCATCTCGGCAGCGTC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 936048115 2:109202293-109202315 ACCCCCTCGGAGGGGAGCGATGG 0: 1
1: 0
2: 0
3: 8
4: 86
936048107_936048113 -6 Left 936048107 2:109202267-109202289 CCCAGGTCCATCTCGGCAGCGTC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 936048113 2:109202284-109202306 AGCGTCTGGACCCCCTCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 50
936048107_936048120 21 Left 936048107 2:109202267-109202289 CCCAGGTCCATCTCGGCAGCGTC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 936048120 2:109202311-109202333 GATGGATAATGAAACTCCCTAGG 0: 1
1: 0
2: 2
3: 10
4: 97
936048107_936048111 -10 Left 936048107 2:109202267-109202289 CCCAGGTCCATCTCGGCAGCGTC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 936048111 2:109202280-109202302 CGGCAGCGTCTGGACCCCCTCGG 0: 1
1: 0
2: 2
3: 7
4: 111
936048107_936048112 -7 Left 936048107 2:109202267-109202289 CCCAGGTCCATCTCGGCAGCGTC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 936048112 2:109202283-109202305 CAGCGTCTGGACCCCCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 90
936048107_936048114 -5 Left 936048107 2:109202267-109202289 CCCAGGTCCATCTCGGCAGCGTC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 936048114 2:109202285-109202307 GCGTCTGGACCCCCTCGGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936048107 Original CRISPR GACGCTGCCGAGATGGACCT GGG (reversed) Intronic
904866204 1:33580882-33580904 GACTCTGTCCTGATGGACCTGGG + Exonic
912570287 1:110616307-110616329 GACCCTGACTAGATGAACCTGGG - Intronic
914313754 1:146489390-146489412 GGAGCTGCAGAGAGGGACCTCGG + Intergenic
914500595 1:148243991-148244013 GGAGCTGCAGAGAGGGACCTCGG - Intergenic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1079093699 11:17497557-17497579 GAAGCTGACCAGATGGGCCTGGG - Intronic
1089993017 11:122879407-122879429 GACGCTGCTGAGCTAGACATAGG + Intergenic
1091568461 12:1663967-1663989 CAAGCTGCTGAGATGGACCATGG + Intergenic
1095261757 12:40106002-40106024 GACGCTGCGGAGTTGGAGCCCGG + Intronic
1114463847 14:22906301-22906323 GACACTGCCGACCTGGACTTCGG + Exonic
1121104079 14:91269560-91269582 GAGGCTGCAGAGATGGTCCTGGG + Intergenic
1122154569 14:99742464-99742486 GAGGCTGGTGAGATGGTCCTGGG + Intronic
1123019468 14:105390894-105390916 GACGCTGGTGAGAGGGACCTTGG - Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1129695364 15:77737921-77737943 GAGGCTGGTGAGAGGGACCTGGG - Intronic
1132699047 16:1214504-1214526 GGTACTGCCCAGATGGACCTGGG - Intronic
1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG + Intergenic
1139872062 16:70115502-70115524 GAATCTGCCGAGGTGGACCGTGG + Intronic
1140363857 16:74366972-74366994 GAATCTGCCGAGGTGGACCGTGG - Intergenic
1151282963 17:73090150-73090172 GACGCTGCCTCGATTGACCCTGG + Intronic
1151868539 17:76820892-76820914 TATGCTGCCGAGAGGGGCCTTGG + Intergenic
1152446388 17:80347003-80347025 GACCCTGCCAAGATGAACCGGGG + Exonic
1154145305 18:11861679-11861701 GACCCTTCCGAGAGGGAGCTGGG - Intronic
1154379615 18:13837479-13837501 GCCCCTGCCGCGAGGGACCTGGG + Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168724839 19:58575463-58575485 TTCGCGGCCGAGATGGACCCTGG + Intergenic
925046528 2:777138-777160 GACGCTTCCCAGCTGGGCCTCGG + Intergenic
925479398 2:4253220-4253242 GGCGATGCAGAGATGGGCCTTGG - Intergenic
929261293 2:39869369-39869391 GGCTCTGCCCATATGGACCTGGG - Intergenic
933767634 2:85721094-85721116 GACGCTTCCAAAATGTACCTTGG - Intergenic
936048107 2:109202267-109202289 GACGCTGCCGAGATGGACCTGGG - Intronic
1168958053 20:1848565-1848587 GGCTCTGGGGAGATGGACCTTGG - Intergenic
1176111313 20:63412022-63412044 GACGCCGCCTCGCTGGACCTTGG + Intronic
1182003029 22:26936594-26936616 GAGGCTGCTGAAATGGTCCTGGG - Intergenic
1182050138 22:27306368-27306390 GAGGCTGCTGAGCTGGACATTGG + Intergenic
1182428133 22:30285662-30285684 GACGCTGCCGATACCGTCCTCGG + Exonic
1183324476 22:37183970-37183992 TAGGCTGCCGTGAGGGACCTCGG - Intronic
1185104832 22:48861745-48861767 GATGCTTCCGTGAGGGACCTAGG - Intergenic
954063584 3:48088775-48088797 GCCGCCGCCGAGACGGAGCTGGG + Exonic
962677925 3:137770122-137770144 GACGCTGCAGGGATGGGCATCGG + Intergenic
1002060387 5:176622126-176622148 GACGCTGCCTGGATGGAGCTGGG - Intronic
1011356015 6:86473949-86473971 GACGCTGGGGAGCTGAACCTTGG + Intergenic
1013318308 6:108962268-108962290 CAGGATGCCAAGATGGACCTAGG + Intronic
1017501064 6:155023430-155023452 GACGCAGCCGAAAAGGACCAGGG - Intronic
1020001672 7:4759559-4759581 GGCGCAGCCGTGCTGGACCTGGG + Exonic
1039382467 8:37099173-37099195 GACTCTGCCGGGAGAGACCTAGG + Intergenic
1041209856 8:55538211-55538233 GAGGCTGGAGAGATGGACCAGGG - Exonic
1061043240 9:128151457-128151479 CACCCAGCCGAGATGGGCCTGGG - Intronic
1189321917 X:40092084-40092106 GGGGCGGCCGAGATGGACCCAGG + Intronic
1201379602 Y:13359885-13359907 GCCGCAGCCTGGATGGACCTAGG - Exonic