ID: 936049185

View in Genome Browser
Species Human (GRCh38)
Location 2:109210483-109210505
Sequence CATCCCAGGGAGACAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 453}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936049178_936049185 5 Left 936049178 2:109210455-109210477 CCCAGCAGCCTGGAGACTGCTGG 0: 1
1: 0
2: 0
3: 38
4: 318
Right 936049185 2:109210483-109210505 CATCCCAGGGAGACAGTGGCTGG 0: 1
1: 0
2: 4
3: 55
4: 453
936049181_936049185 -3 Left 936049181 2:109210463-109210485 CCTGGAGACTGCTGGAGCTGCAT 0: 1
1: 0
2: 0
3: 22
4: 174
Right 936049185 2:109210483-109210505 CATCCCAGGGAGACAGTGGCTGG 0: 1
1: 0
2: 4
3: 55
4: 453
936049180_936049185 4 Left 936049180 2:109210456-109210478 CCAGCAGCCTGGAGACTGCTGGA 0: 1
1: 1
2: 0
3: 33
4: 364
Right 936049185 2:109210483-109210505 CATCCCAGGGAGACAGTGGCTGG 0: 1
1: 0
2: 4
3: 55
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936049185 Original CRISPR CATCCCAGGGAGACAGTGGC TGG Intronic
900112327 1:1013641-1013663 CACCCCTGGGAGACCTTGGCTGG - Intronic
900387790 1:2418495-2418517 CGTCCGAGGGAGGCAGTGGGTGG - Intergenic
900909006 1:5580926-5580948 AATCCCAGAGAAACAGAGGCTGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901441040 1:9278693-9278715 CATCCTAGGGAGGCCCTGGCTGG + Intergenic
901924088 1:12554957-12554979 CACCCCAGGGAGAGAGTCCCTGG + Intergenic
902651350 1:17839682-17839704 CAGCCCAGGGAGACAGAAGCAGG - Intergenic
902811857 1:18892539-18892561 CATCCCAGGTAGAAGGAGGCGGG + Intronic
902948423 1:19861084-19861106 CCTCCCAGGGAGCCAGTGGTGGG - Intergenic
902978920 1:20109371-20109393 CAGCCCAGGGACAAAGTGACAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903172026 1:21560332-21560354 CAGCACAGGCAGACACTGGCAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904268358 1:29331225-29331247 CATCCCAGGGAGAGAGTAGGAGG - Intergenic
904291809 1:29490964-29490986 CATGTCAGGCAAACAGTGGCAGG - Intergenic
904360705 1:29969897-29969919 CACCCCAGGGAGAGAGTAGGAGG - Intergenic
904428865 1:30449025-30449047 CACCCCAGGGAGAGAGTAGGAGG + Intergenic
904721634 1:32514301-32514323 AATCCCAGGGAGACTGAGGTAGG + Intronic
904756293 1:32770540-32770562 CTCCCCAGGGAGGCAGTGGGAGG + Exonic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904869620 1:33608297-33608319 CATCACAGGGATTCAGTGGCAGG + Intronic
905043947 1:34982047-34982069 AACCCCAGGCAGACAATGGCTGG + Exonic
905318899 1:37101667-37101689 CTTCACAGGGAGGCAGAGGCAGG - Intergenic
905359278 1:37407674-37407696 CATCCCAAGGAAACTGTGGCAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906646769 1:47480919-47480941 CATCCCAGGGAGAGAGAGGCTGG - Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907516250 1:54995163-54995185 CATGCCTGGGAGAGAGAGGCCGG - Intergenic
908363301 1:63391029-63391051 CCTGCCAGGGGGACAGTTGCTGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910975542 1:92902078-92902100 CATCCCAGGGAAATGGTGCCTGG - Intronic
911269517 1:95783352-95783374 CTTCTCAGGGAGACTTTGGCAGG - Intergenic
912554186 1:110504258-110504280 CATTGCAGGGAGACAGGGGGAGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913034248 1:114946990-114947012 CTTCCCTGGGAGGCAGAGGCAGG - Intronic
914464627 1:147915596-147915618 CATTCCAGGGAGAGAGTGACTGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915498918 1:156301009-156301031 AATCCTAGGCAGACAGGGGCAGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917371926 1:174301991-174302013 AATCCTAGGCAGACAGGGGCAGG - Intronic
918226048 1:182484328-182484350 CATCCCAGGGAAATAGTGCCTGG - Intronic
918318141 1:183340297-183340319 TAACCCAGGGAAACAGTGCCAGG - Intronic
918869007 1:189942210-189942232 AATCCAAGGGAGACTGTGACTGG + Intergenic
919801625 1:201357845-201357867 CAGCCCTGGGTGACAGGGGCGGG - Intergenic
920377828 1:205518845-205518867 CTTCCCAGGGACACAGCAGCCGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923392167 1:233523262-233523284 CATTCCAGGGAGACAAAGGAGGG + Intergenic
923535084 1:234843121-234843143 CACCCCAGGGAGGCAGTGAAGGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063087197 10:2830686-2830708 CATCTCAGTGAGATAGAGGCAGG - Intergenic
1063473752 10:6310115-6310137 CAGCCCAGGCAGACAGGAGCAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1066456037 10:35573200-35573222 CGTCCCAGGGAGGCTGAGGCGGG - Intergenic
1066572970 10:36793222-36793244 AATCCCAGGGAGACTGAGGCAGG - Intergenic
1066981599 10:42421667-42421689 AATCCCAGGGATACAGAGACTGG - Intergenic
1067082692 10:43220457-43220479 CATCCCTGGGTGACAGAGCCTGG + Intronic
1067693909 10:48522160-48522182 CCTCCCTGCCAGACAGTGGCTGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069198211 10:65581160-65581182 AATCCTAGGCAGACAGGGGCAGG + Intergenic
1069684847 10:70311338-70311360 AATCCCAGGGAGGCTGAGGCAGG - Intronic
1069718638 10:70536356-70536378 CATTCCAGGGACTCTGTGGCAGG - Intronic
1070254801 10:74804832-74804854 CCTCCCAGGGAGGCAGAGGTGGG + Intergenic
1070718114 10:78737190-78737212 CTGCCCAGGGAGAGAGTGGCAGG + Intergenic
1071068916 10:81669352-81669374 AATCCTAGGCAGACAGGGGCAGG + Intergenic
1071475911 10:86024814-86024836 TAGCCCAGGGAAACAGTGGGTGG + Intronic
1071520923 10:86331059-86331081 CAATCCAGGGAGGCTGTGGCAGG + Intronic
1072110682 10:92317215-92317237 AATCCCAGGGAGGCCGAGGCAGG - Intronic
1072433772 10:95396924-95396946 CATCCCAGGCAGACAGATGCTGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072782917 10:98262311-98262333 AAACCCTGGGAGAAAGTGGCAGG + Intronic
1072810878 10:98460744-98460766 CTTCTCAGGGTGAAAGTGGCTGG - Intronic
1073012283 10:100370856-100370878 CCTCCCTGGGTGGCAGTGGCAGG + Intergenic
1073100491 10:101003901-101003923 CCTCCCACTCAGACAGTGGCCGG + Exonic
1073789040 10:106920956-106920978 CATGCCATGGAGACTGTTGCTGG - Intronic
1075104155 10:119526680-119526702 GCTCCCAGGGAGGGAGTGGCAGG - Intronic
1077329515 11:1977872-1977894 CCTCCCAGAGAGCCAGTGGAGGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078567506 11:12429225-12429247 AATCCCAGGGAGGCAGAGGTGGG - Intronic
1078896164 11:15599125-15599147 CATGCCAGGGAGACAGGAACAGG - Intergenic
1081972405 11:47208706-47208728 AATCCCAGGGAGGCCGAGGCAGG - Intergenic
1082834276 11:57640198-57640220 CAGCCCAGAGAAACAGAGGCTGG - Intergenic
1083727371 11:64635599-64635621 CACCCCAGGGAGAAGTTGGCAGG + Intronic
1083769165 11:64856718-64856740 CTCCCCAGGGACACTGTGGCAGG + Intronic
1083900272 11:65640258-65640280 GTTCCCAGGGAGGCAGCGGCAGG - Exonic
1083943800 11:65912841-65912863 AATCCCAGGGAGATAGAGTCAGG - Intergenic
1084419241 11:69052118-69052140 CATCCCAGGCCAACAGTGGTGGG - Intronic
1084677229 11:70642594-70642616 CCTCCCACGGACACAGAGGCCGG + Intronic
1085040162 11:73322238-73322260 CATCCCAGGGAGACAGGGAAAGG - Intronic
1085290039 11:75391632-75391654 GATCTCAGGGAGGCAGAGGCAGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085509031 11:77076241-77076263 AATCCCAGGGAGGCTGAGGCAGG + Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088287856 11:108206467-108206489 CCTCACAGGGAGCCAGTGCCTGG - Intronic
1088470538 11:110184352-110184374 CATGTCAGGGAGACAGAGGCTGG - Intronic
1089105246 11:115997660-115997682 CATCCCAGGATGCCAGTGACTGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091030144 11:132179326-132179348 AATCCTAGGGAGAGAGGGGCAGG + Intronic
1202812494 11_KI270721v1_random:33051-33073 CCTCCCAGAGAGCCAGTGGAGGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094472933 12:30820018-30820040 CAGCTCAGGGACACAGAGGCTGG + Intergenic
1095987665 12:48010450-48010472 GATTCCATGGAGACAGTGTCAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099001984 12:77188928-77188950 AATCCCAGGGAGAAAATGCCAGG - Intergenic
1099066124 12:77982172-77982194 CTGCCCAAGTAGACAGTGGCTGG - Intronic
1100025590 12:90123747-90123769 AATCCCAGGCAGATAGTGGCAGG + Intergenic
1101261809 12:103039834-103039856 CATAGCAGGGAGACTGTGTCTGG - Intergenic
1102994881 12:117341402-117341424 CATCACAGGGAGAGAGCTGCAGG + Intronic
1103193143 12:119019671-119019693 AATCCCAGGGAGCCCGTGGCAGG - Intronic
1103247260 12:119468472-119468494 CATCCCAGACAGTCAGTTGCAGG - Intronic
1103516546 12:121512109-121512131 GATCCCCCGGAGACAGAGGCTGG - Intronic
1103560207 12:121789643-121789665 TTTCCCAGGGAGACAGGGGCTGG + Intronic
1103728270 12:123009816-123009838 CATGCCAGGTGGGCAGTGGCTGG - Intronic
1104892631 12:132147821-132147843 CCTCCCAGGGAGGCAGGGACTGG + Intronic
1105453169 13:20518323-20518345 CTTCCCAGTGAGACAGTCCCTGG - Intronic
1108176758 13:47800470-47800492 CATGTCAGGGAGGAAGTGGCAGG - Intergenic
1109212310 13:59548405-59548427 AATCCCAGGGAAACAGTGCCTGG + Intergenic
1110395658 13:75027317-75027339 GAATCCAGGGAGATAGTGGCAGG + Intergenic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113454908 13:110441473-110441495 CAGCCCAGGGAGCCAATGCCAGG + Intronic
1113478035 13:110599224-110599246 CATCCCAGGGAGAGGGTAGCTGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113766654 13:112885805-112885827 CATCCCAGGGAGGCATGGGCTGG - Exonic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115284707 14:31704212-31704234 GGTCCAAGGGAGACAGGGGCAGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115714687 14:36089999-36090021 AATCCCAGGGAGGCTGAGGCGGG + Intergenic
1118278221 14:64405062-64405084 CATGCCAGGCAGAGAGTGACAGG - Intronic
1118366031 14:65096903-65096925 CATCCTATGGTTACAGTGGCTGG + Intronic
1120183345 14:81367698-81367720 CAGGCCATGGAGACAGTGTCTGG - Intronic
1120301267 14:82710391-82710413 CATCCCTGGGAGACAGAAGGAGG + Intergenic
1120854645 14:89202029-89202051 CATCTCAGAGTGACACTGGCAGG + Intronic
1121274453 14:92658003-92658025 CATCCCCTGGAGACAGAGGAGGG + Intronic
1121563592 14:94892638-94892660 GCTCCCAGGGAGTAAGTGGCAGG - Intergenic
1121713998 14:96059855-96059877 CATCCATGGGATACAGTGCCAGG + Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122630014 14:103103462-103103484 CATCCCAGGCAGAGAGCGGGAGG - Intronic
1122684504 14:103494430-103494452 AATCCCAGGGAGACTGAGGCAGG + Intronic
1123110483 14:105864795-105864817 GTTCCCAGGGAGACGGTGGCCGG + Intergenic
1123460160 15:20462573-20462595 CAACCCTGGGAGACAGTGGGAGG - Intergenic
1123657902 15:22537844-22537866 CAACCCTGGGAGACAGTGGGAGG + Intergenic
1124240254 15:28022303-28022325 AGCTCCAGGGAGACAGTGGCGGG - Intronic
1124266383 15:28238344-28238366 CAACCCTGGGAGACAGTAGAAGG - Intronic
1124311813 15:28633043-28633065 CAACCCTGGGAGACAGTGGGAGG + Intergenic
1124412217 15:29445874-29445896 AATTCCAGGCAGACAGTGTCAGG + Intronic
1124504966 15:30264729-30264751 CATCTCAGGGAGCCTGTAGCAGG - Intergenic
1124738586 15:32273906-32273928 CATCTCAGGGAGCCTGTAGCAGG + Intergenic
1125506674 15:40271440-40271462 CATGCCAGGGAGGAAGTGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126485323 15:49173987-49174009 AATCCCAGGGAGACCAAGGCGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128370544 15:67036035-67036057 CAGCCTGGGGAGACTGTGGCTGG - Intergenic
1128461360 15:67870180-67870202 CAGCCTAGGCAGACAGGGGCAGG - Intergenic
1129328296 15:74813412-74813434 CATCCCAGCGGGCCTGTGGCTGG + Intronic
1129758359 15:78112129-78112151 CTTCCAAGTGAGACAGTGCCAGG - Intronic
1131417534 15:92273579-92273601 CACCCCAAGGACACTGTGGCAGG + Intergenic
1131545623 15:93313498-93313520 CTTCCCAGGGAGACAGAGCCTGG + Intergenic
1131568327 15:93506461-93506483 CATCCCAGGCAGGAAGTGGCAGG - Intergenic
1132770811 16:1562015-1562037 CATCCCCAGGAGACTGTGGGAGG + Exonic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1133146835 16:3793851-3793873 CATCCAAGCAAGACAATGGCTGG + Intronic
1133235582 16:4386007-4386029 CACCCCAGGGAGTTAGTGGGGGG + Intronic
1133237057 16:4392304-4392326 CACCTCAGGGTGACAGAGGCAGG - Intronic
1134102612 16:11462539-11462561 AATCCCAGGGAGGCTGAGGCAGG - Intronic
1134516580 16:14892416-14892438 CACACCTGGGAGCCAGTGGCAGG + Intronic
1134704250 16:16291072-16291094 CACACCTGGGAGCCAGTGGCAGG + Intronic
1134963293 16:18421042-18421064 CACACCTGGGAGCCAGTGGCAGG - Intronic
1134967588 16:18503641-18503663 CACACCTGGGAGCCAGTGGCAGG - Intronic
1135249852 16:20891733-20891755 GAGCACAGGGACACAGTGGCTGG - Intronic
1136274695 16:29172121-29172143 TAGCCCAGGGAGACAGAGGGTGG + Intergenic
1136424761 16:30162289-30162311 CCTCCTGGGGAGACTGTGGCAGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136704576 16:32175757-32175779 CAACCCTGGGAGACAGTGGGAGG - Intergenic
1136763337 16:32753649-32753671 CAACCCTGGGAGACAGTGGGAGG + Intergenic
1136804763 16:33116737-33116759 CAACCCTGGGAGACAGTGGGAGG - Intergenic
1137068807 16:35879623-35879645 GATCCCAGAGAGGCAGTGGCAGG - Intergenic
1137412014 16:48236715-48236737 CATCACAGAGATACAGTGACAGG + Intronic
1137708644 16:50551502-50551524 ACTCCCAAGGAGACAGAGGCCGG - Intronic
1137735484 16:50720130-50720152 CAAGCCAGGGAGAGAGTGGGCGG + Intronic
1138345282 16:56316660-56316682 CACCCCAGGGAGGCAGGGTCTGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140305364 16:73797923-73797945 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
1140673384 16:77301602-77301624 CACCCGAGGGAGACAGAGCCAGG - Intronic
1141403500 16:83771494-83771516 AATGCCAGGAAGACCGTGGCAGG + Intronic
1141523479 16:84596762-84596784 TCTCCCAGGGAGAGAGTGTCAGG - Intronic
1141574353 16:84954525-84954547 AAGCCCAGGGAGACTGAGGCTGG + Intergenic
1141947365 16:87319872-87319894 GATCCCAGGGAGAGAGTTGCAGG + Intronic
1142078989 16:88137879-88137901 TAGCCCAGGGAGACAGAGGGTGG + Intergenic
1203065487 16_KI270728v1_random:1013970-1013992 CAACCCTGGGAGACAGTGGGAGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143024126 17:3930892-3930914 CATCCCAGGGAGGCGGAGGCGGG + Intronic
1143520968 17:7444194-7444216 CGTGCCAGGGAGACAGAGTCTGG + Exonic
1143780171 17:9225141-9225163 AATCCCAGGGAGGCTGAGGCAGG + Intronic
1144033603 17:11343546-11343568 CATCCCAGGCAGACAACGTCAGG - Intronic
1144568324 17:16379067-16379089 GAGCCCATGGTGACAGTGGCCGG - Intergenic
1145208169 17:20995575-20995597 CAGCCCATGGACACAGTGCCCGG + Intergenic
1145866712 17:28246549-28246571 AGTACCAGGGAGACAGTGGGAGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146549518 17:33768585-33768607 AATCCTAGGCAGACAGGGGCAGG + Intronic
1146936268 17:36814321-36814343 CATTCGAGGGAGACAGTGTGCGG + Intergenic
1147607090 17:41780068-41780090 CCTACCATGGAGACAGTAGCAGG - Intronic
1147820055 17:43236049-43236071 CATCACAGGGAGACAGACGTTGG - Intergenic
1147821369 17:43243448-43243470 CATCACAGGGAGACAGACGTTGG - Intergenic
1147822166 17:43247931-43247953 CATCACAGGGAGACAGACGTTGG - Intergenic
1147823090 17:43253377-43253399 CATCACAGGGAGACAGACGTTGG - Intergenic
1147823860 17:43257977-43257999 CATCACAGGGAGACAGACGTTGG - Intergenic
1147824619 17:43262417-43262439 CATCACAGGGAGACAGACGTTGG - Intergenic
1147827795 17:43280241-43280263 CATCACAGGGAGACAGACGTTGG - Intergenic
1147828903 17:43286402-43286424 CATCACAGGGAGACAGACGTTGG - Intergenic
1147829998 17:43292545-43292567 CATCACAGGGAGACAGACGTTGG - Intergenic
1147834974 17:43323594-43323616 CATCACAGGGAGACAGACGTTGG + Intergenic
1147965168 17:44190793-44190815 CCCACCAGGGAGACAGTGGCAGG - Exonic
1148384086 17:47221986-47222008 GAGCCCAGGGAGACAGGGCCTGG - Intronic
1149461319 17:56832432-56832454 CATCCCAGAGAGACAGAGGAAGG - Intronic
1149571792 17:57677406-57677428 CGTCCCAGGGGGATAGAGGCAGG + Intronic
1151894818 17:76972853-76972875 AATCCCTGGGAGACAGTGGATGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152473918 17:80505279-80505301 CATCCTAGGGACACAGTGTCTGG + Intergenic
1152847815 17:82613388-82613410 CATCCCAGGGCCACAGGGGAGGG + Intronic
1153331298 18:3878361-3878383 AAACACAAGGAGACAGTGGCAGG + Intronic
1154038740 18:10833150-10833172 CACCCAAGGAACACAGTGGCAGG + Intronic
1155819799 18:30361471-30361493 GATCCTAGGCAGACAGGGGCCGG + Intergenic
1157682309 18:49616603-49616625 CACCCCAGGTAGGCAGTGACTGG - Intergenic
1158463807 18:57671272-57671294 TATCCCAGGAAGTCAGTGGCAGG + Intronic
1159128474 18:64252927-64252949 AAGCCCAGGGTTACAGTGGCAGG + Intergenic
1159539911 18:69761660-69761682 AGTCCAAGGGAGACAGGGGCAGG + Intronic
1160018390 18:75161805-75161827 CATCCCAGGAAGCCTGTGCCCGG - Intergenic
1160691565 19:462573-462595 TGTCCCTTGGAGACAGTGGCAGG + Intergenic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1160917285 19:1503350-1503372 CAGCCCAGGGGGTCCGTGGCCGG + Intergenic
1161048642 19:2150738-2150760 CCTCCCCGGGAGACCGAGGCAGG - Intronic
1161158079 19:2745000-2745022 CATCCCAGGGAGGCCGAGGGGGG + Intergenic
1162646356 19:12052987-12053009 CTTCCCTGGAGGACAGTGGCAGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162940259 19:14005349-14005371 CCTCCCAGAGAGAAGGTGGCAGG + Intronic
1163426246 19:17242594-17242616 CTTCCCAGGGGCTCAGTGGCTGG - Intronic
1163430327 19:17263431-17263453 CATCCCAGGGTGAGACTGGGAGG + Intronic
1165376666 19:35447797-35447819 CATCCCAGGGAGGCTGACGCAGG + Intronic
1166128902 19:40733623-40733645 ATGCCCAGGGAGACAGAGGCAGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166569324 19:43783811-43783833 CATGACAGAGAGACAGTGACGGG - Intergenic
1167681918 19:50928800-50928822 CAGCTCAGGGAGACAGAGTCAGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168513866 19:56994516-56994538 CATCCCAGTGAGACCTGGGCGGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926238378 2:11067254-11067276 CATGCCAGGGACACTGAGGCAGG + Intergenic
927891487 2:26753092-26753114 CTCCCCAGGGAGTCAGGGGCTGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929076197 2:38080901-38080923 CAGCCAAGGGAGACAGGGGTGGG + Intronic
929580005 2:43076070-43076092 CCTCCCAGGGAGACATTTGCAGG - Intergenic
929700352 2:44157293-44157315 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930818359 2:55621210-55621232 AATCCTAGGCAGACAGGGGCAGG + Intergenic
931207194 2:60159391-60159413 CTCTCCAGGGGGACAGTGGCAGG - Intergenic
932082453 2:68727408-68727430 CATTCCTGGGAGACTGTGCCAGG - Intronic
932672989 2:73754282-73754304 CATCACAGGGAGACAGGGTCAGG - Intergenic
933943800 2:87267078-87267100 CATGGGAGGGACACAGTGGCAGG + Intergenic
934536743 2:95140499-95140521 AATCCCAGGGAGGCTGAGGCAGG + Intronic
934654968 2:96112616-96112638 CCTCCCAGGGAGCCAGTCTCAGG + Intergenic
935010314 2:99128992-99129014 AATCCCAGGGAGACCTAGGCGGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936049185 2:109210483-109210505 CATCCCAGGGAGACAGTGGCTGG + Intronic
936336420 2:111594501-111594523 CATGGGAGGGACACAGTGGCAGG - Intergenic
936561199 2:113541473-113541495 ACTCCCAGGGAGACAGGGGACGG + Intergenic
937278406 2:120701281-120701303 CACCCTGGGGTGACAGTGGCGGG + Intergenic
937854052 2:126660093-126660115 CAACCCAAGGAGAGAGTTGCAGG + Intronic
938089610 2:128422670-128422692 AATCCTAGGCAGACAGGGGCAGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938645689 2:133327879-133327901 CATACCTGGGAGAGAGGGGCTGG + Intronic
938895643 2:135747534-135747556 AATCCAAGGTAGACAGAGGCAGG - Intronic
939317229 2:140566912-140566934 CATCCCAGGGAAACAGTTCCTGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940858306 2:158747089-158747111 CATCCCAGGGAGAAAGGGATTGG + Intergenic
941000504 2:160197728-160197750 TAACCAAGGGAAACAGTGGCTGG + Intronic
942118588 2:172753982-172754004 CTTCCCAGGAGGAAAGTGGCAGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944196868 2:197063177-197063199 CAGCCCAGGCAAACAGGGGCTGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945545410 2:211144565-211144587 CATCCTAGGCAGACAGGGACAGG + Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946013785 2:216588009-216588031 CATCCCAGGGAGACAGTCGGGGG - Intergenic
947304173 2:228725036-228725058 CATCTCAGGGCTACAGTGGGTGG - Intergenic
947501945 2:230677262-230677284 CATCCCAAGAAGAAAGTGACTGG - Intergenic
948595295 2:239075912-239075934 CTTCCCAGGGAGACAGAGCTGGG + Intronic
948634512 2:239326783-239326805 CATCCCAGCGAGCCAGCAGCTGG + Intronic
948783716 2:240340257-240340279 CATCCCGGGCAGACACTGGAAGG - Intergenic
949042856 2:241857535-241857557 CATCCCAGGGAGACGACTGCGGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169220121 20:3817506-3817528 TATCCCAGGGAGGCAATGACTGG - Intergenic
1169843457 20:9964867-9964889 CATCCCAGGAAGAAAAAGGCAGG + Intergenic
1170797714 20:19564119-19564141 GATCCCAGGTAAACACTGGCTGG - Intronic
1171990808 20:31694821-31694843 AATCCCAGGAAGATAGAGGCGGG + Intronic
1174208127 20:48856144-48856166 GAACCCAGGGAGACAGTGGTAGG + Intergenic
1174945703 20:54982964-54982986 AATCCCAGAGAGACCGAGGCGGG - Intergenic
1176415788 21:6474090-6474112 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
1179041017 21:37802253-37802275 CAGGCCTGGGAGACTGTGGCAGG + Intronic
1179184684 21:39076058-39076080 AATCCCAAGGAGACTGTTGCGGG - Intergenic
1179691288 21:43082424-43082446 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
1179718402 21:43301874-43301896 AATCACAGGGAGATGGTGGCTGG + Intergenic
1179722950 21:43325708-43325730 CAGCCCGGGGAGCCAGTGCCTGG - Intergenic
1180708881 22:17826332-17826354 CATGCCAGGGCGGCAGAGGCGGG - Intronic
1180756898 22:18168638-18168660 AATCCCAGGGAGGCTGAGGCAGG - Intronic
1180946578 22:19697122-19697144 CATTCCAGGCAGACAGTGGCTGG - Intergenic
1180949241 22:19713929-19713951 CAGCCCAGGAAGAGAGAGGCCGG + Intergenic
1181553418 22:23653843-23653865 CACCCCAAGGAGATGGTGGCAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181590278 22:23879965-23879987 AATCCCAGGGAGGCTGAGGCGGG + Intronic
1181716521 22:24734519-24734541 CTTCCCAGGGAAACAGTTCCTGG + Intronic
1182090089 22:27588610-27588632 CACCTCTGGGAGGCAGTGGCTGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
1183475535 22:38034000-38034022 CATCCCAGGGGTCAAGTGGCTGG + Intronic
1183727040 22:39595907-39595929 CATGTCAGCAAGACAGTGGCAGG + Intronic
1183783093 22:40011301-40011323 AATCCCAGGGAGGCTGAGGCAGG - Intronic
1184190167 22:42889238-42889260 CATCCCAGGAAGACCATGCCAGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184362273 22:44025508-44025530 CATCCCTGGGAGAAAATGTCTGG - Intronic
1184724009 22:46332497-46332519 CATCCTATGGAGAAAGGGGCTGG - Intronic
1184781609 22:46652409-46652431 CAGCCCAGGGAGACCCAGGCTGG + Intronic
1184887260 22:47354019-47354041 CACCCCAGGCAGATAGTGGTGGG + Intergenic
949156106 3:829388-829410 AATCCTAGGCAGACAGAGGCAGG + Intergenic
949359546 3:3216984-3217006 CCTCACAGGGAGGCAGTTGCGGG - Intergenic
950278021 3:11680550-11680572 AATCCCAGGAAGACAGCGGGAGG + Intronic
951301200 3:20999327-20999349 CATCCCTAGGAGGCAGTGTCAGG + Intergenic
952007122 3:28854780-28854802 AATCCCAGGATGACAGTGGAGGG + Intergenic
952108399 3:30094555-30094577 CATCAATGAGAGACAGTGGCAGG - Intergenic
952442060 3:33340778-33340800 GATCCTAGGGAGACTGAGGCAGG + Intronic
952473631 3:33683359-33683381 AATTCCAGGGAGACTGAGGCGGG + Intronic
952750913 3:36824214-36824236 CACTCCAGGGAAACAGAGGCAGG + Intergenic
953460396 3:43077377-43077399 GCTTCCTGGGAGACAGTGGCGGG + Intergenic
953914040 3:46906640-46906662 GATCCCAGGGAGGGAGGGGCAGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954559251 3:51542555-51542577 AATCCCAGGGAGGCTGAGGCGGG - Intronic
954580937 3:51702595-51702617 AACACCATGGAGACAGTGGCTGG + Intronic
954605864 3:51908728-51908750 CAGCACAGGGAGCCAGGGGCTGG + Intergenic
955271297 3:57502151-57502173 CAACCCAGGGAGGCCGAGGCGGG - Intronic
955348988 3:58180282-58180304 CACCCAAGGGAGACAGAGTCTGG + Intergenic
956707440 3:72011509-72011531 CCACCCAGGGAGTCTGTGGCTGG - Intergenic
958697611 3:97547332-97547354 AAACCCAGGGAGACAGGGTCTGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959806719 3:110562899-110562921 CATGCCAGGCAGCCAGTGCCAGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961346486 3:126266760-126266782 CAGCCCAGGGAGCCAGGGGCTGG + Intergenic
961388571 3:126538336-126538358 CATCCCAGGCAGAAAGTGAGTGG + Intronic
961652669 3:128424932-128424954 TTTCTCAGGGAGGCAGTGGCGGG + Intergenic
961765524 3:129207552-129207574 CAGCCTCTGGAGACAGTGGCTGG - Intergenic
963458162 3:145573471-145573493 GGTCCAAGGGAGACAGGGGCAGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963878786 3:150504555-150504577 CATTCCAGGGAAATGGTGGCTGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964392686 3:156213919-156213941 CCTCCCTGGTAGACAGTGGATGG - Intronic
965009026 3:163062689-163062711 CTTCCCAGGGAAACAGTGAGTGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966997069 3:185293362-185293384 AATCCCAGGGAGGCTGAGGCAGG - Intronic
967221600 3:187252192-187252214 CAGCTCAGGGACACAGTGACAGG + Intronic
967736428 3:192957449-192957471 CACAACAGGGAGACAGTGACAGG + Intergenic
967932509 3:194700560-194700582 CATCTCAGGGGGGCCGTGGCAGG - Intergenic
968298552 3:197595723-197595745 CATCACAGGGAGGAAGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968647518 4:1748049-1748071 CAGCCCAGGGAGGCAGCTGCAGG - Intergenic
969277863 4:6149062-6149084 CACCCCCAGGAAACAGTGGCCGG + Intronic
969511591 4:7620985-7621007 AGGCCCAGGGAGGCAGTGGCTGG + Intronic
969593286 4:8133816-8133838 CAACCCAGGCAGCCAATGGCTGG + Intronic
969699943 4:8762427-8762449 CATCCCCGGGGGTCTGTGGCTGG - Intergenic
969954697 4:10876891-10876913 AATGCAAGGGAGACAGTGGCTGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970445307 4:16118991-16119013 AATCCCAGGGAGGCTGAGGCGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975819481 4:78255004-78255026 CATCCCAGGAAGCCAGCAGCAGG + Intronic
975839371 4:78457313-78457335 CACCACAGGGGGGCAGTGGCAGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983017039 4:162626364-162626386 AATCCCAGGGAGGCCGAGGCTGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984873265 4:184345863-184345885 AACCCCTGGGAGACACTGGCAGG - Intergenic
985719448 5:1481542-1481564 CACCCCAGGGTGACGGTGTCTGG - Intronic
986106353 5:4663036-4663058 CATCCCAGGGAGGTAGTCACCGG + Intergenic
986164804 5:5264269-5264291 AATCCTAGGCAGACAGGGGCAGG - Intronic
986283160 5:6339836-6339858 TAACCCAGGGGGACAGTGCCGGG + Intergenic
986499867 5:8387546-8387568 CATCCCAGACAGACATGGGCAGG - Intergenic
987261826 5:16211927-16211949 CACACCTTGGAGACAGTGGCTGG - Intergenic
987468881 5:18306390-18306412 CAGCTGAAGGAGACAGTGGCAGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991720900 5:69493415-69493437 TATCCCGGGGAGACGGGGGCTGG + Intronic
992171668 5:74107911-74107933 CATCCCAGGGAGCAGGTTGCTGG + Intergenic
992384755 5:76273757-76273779 CATCCCAGGGAGAGAGTCCAGGG - Intronic
995420580 5:111962534-111962556 AATCCTAGGCAGACAGGGGCAGG + Intronic
995469380 5:112484419-112484441 CATCCCAGGGAGAGAGGAGCGGG + Intergenic
995870014 5:116734663-116734685 CAGCCCAAGGAGGCAGAGGCAGG + Intergenic
996118757 5:119647875-119647897 AATCCAAGGGAGAGAGTGGCTGG + Intergenic
996385001 5:122901699-122901721 CATCCAAGGGAGAGAATGGAGGG - Intronic
997206861 5:132055251-132055273 CCTCCCAGGGAGAGAGGGGAAGG - Intergenic
997531265 5:134582694-134582716 CCTCTGAGGGAGAAAGTGGCAGG - Exonic
997718732 5:136061653-136061675 CAGCCAAGGAAGACAGGGGCTGG - Intronic
998026327 5:138819589-138819611 CATCCCAAGGAATCAGTGCCTGG - Intronic
998494278 5:142573879-142573901 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
999120535 5:149206232-149206254 CATTCCAGGGTGACCGTGTCAGG + Intronic
999506158 5:152198715-152198737 CATCCCACCGATACAATGGCAGG - Intergenic
1001199060 5:169699432-169699454 CCTCCAAGGGGGACAGTGGAGGG + Exonic
1001694634 5:173660843-173660865 CTCCCCAGGGAGACAGAGGCAGG + Intergenic
1001866185 5:175107646-175107668 CATCCCTGGGAGATGCTGGCAGG + Intergenic
1002568690 5:180128222-180128244 CACCCCAGGGAGAGGGAGGCTGG - Intronic
1005567687 6:27113227-27113249 CATGCAAGGGAAACATTGGCTGG - Intergenic
1006844254 6:37051566-37051588 CGTCTCAGGGACACCGTGGCAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1010272380 6:73929112-73929134 CATCCCAGGGATAAAGTGCCTGG - Intergenic
1011482154 6:87805780-87805802 GATCCCAGGGAGGCTGAGGCAGG - Intergenic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1012258996 6:97065866-97065888 CTTCCCAGGGAGACAGTGTGAGG + Intronic
1013663379 6:112321964-112321986 CATCCCATGGAGAAAATGGATGG - Intergenic
1013983080 6:116156935-116156957 CTTGCCAGGGAGTGAGTGGCTGG - Intronic
1016541416 6:145170271-145170293 CAACCCAGTGAGACACTAGCTGG + Intergenic
1016921635 6:149300734-149300756 CATCCTAAGGAGGCAATGGCAGG + Intronic
1018218913 6:161559457-161559479 CATCCCAGAGAAACAGTGTTAGG + Intronic
1018255399 6:161913060-161913082 CCTCCCAGGGAGGCTGAGGCAGG + Intronic
1018758251 6:166867983-166868005 AATCCCAGGGAGGCAGAGGCAGG + Intronic
1019364850 7:628016-628038 CATCACAGGGGGACAGCGGTGGG + Intronic
1019376377 7:694709-694731 CATCTCAGAGACACAGTGCCAGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019670612 7:2276172-2276194 CCTGCCAGGGAGCCAGCGGCTGG - Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019748051 7:2711665-2711687 CAGCACAGGGAGGCAGAGGCAGG - Intronic
1020430673 7:8113493-8113515 CCTCCAAGGGGGACAGAGGCTGG + Exonic
1021512705 7:21451610-21451632 GGTCCAAGGGAGACAGGGGCAGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021813567 7:24426387-24426409 GATCCTAGGCAGACAGGGGCGGG - Intergenic
1022106492 7:27200701-27200723 CTTTCCAGGGAAACAGTGGCAGG + Intergenic
1022809381 7:33853970-33853992 CATCCAAGGGTGACAGGGTCTGG - Intergenic
1023551636 7:41376257-41376279 GATAGCAGGGAGACAGTGGCAGG - Intergenic
1024005326 7:45221349-45221371 CTTTCCAGAGAGACAGTGGTGGG - Intergenic
1024008098 7:45242000-45242022 CATCATAGGGAGGCAGTGGTGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026797604 7:73376485-73376507 GATCCCAGAGAGACAGATGCTGG - Intergenic
1028833758 7:95351818-95351840 GGTCCAAGGGAGACAGGGGCAGG - Intergenic
1029121414 7:98270652-98270674 CAGACCAGGGAGGCAGTGGAGGG + Intronic
1031162220 7:118182383-118182405 TATACCAGGGAGGCAGAGGCAGG - Intergenic
1033224336 7:139548691-139548713 CATCCCAGGGAGGCTGGAGCTGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034186556 7:149182272-149182294 CATCCCAGAGAGACGGAAGCAGG + Intronic
1034345577 7:150383563-150383585 CATGGCAGGGAGGCATTGGCTGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035568002 8:654647-654669 CATCTCTGGTAGACAGTGGGAGG - Intronic
1035894579 8:3384034-3384056 CAACCCTGGGAGGCAGTGACTGG + Intronic
1036211494 8:6844591-6844613 CTTACCAGGGAGACAGTGAAAGG - Intergenic
1036709351 8:11068313-11068335 CATCCCTGGGATACGGTGGGTGG + Intronic
1037409782 8:18584186-18584208 TATCCCAGTGAAAGAGTGGCTGG + Intronic
1037439778 8:18903730-18903752 CATCCTAGGGAAACTGTGCCTGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039983688 8:42429849-42429871 CATCTCAGGGACGCTGTGGCTGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040683440 8:49841910-49841932 AATTCTAGGTAGACAGTGGCAGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042228282 8:66532327-66532349 AATCCCAGGGAGGCTGAGGCAGG - Intergenic
1042637500 8:70894592-70894614 CATCCCAGGGAAATGGTGCCTGG - Intergenic
1044841138 8:96338132-96338154 CATCCCAGGGCGTCAGAGCCTGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046387855 8:113526634-113526656 GATCCAAGGGAGACAAGGGCAGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047165431 8:122432969-122432991 CATCCCAGGGAGACACTAAGAGG - Intergenic
1047554248 8:125911640-125911662 CCTCCCAGGGAGACTGGGGGAGG - Intergenic
1047615940 8:126562571-126562593 CATCCCAGGCAGATGGAGGCTGG + Intergenic
1048054556 8:130851163-130851185 CTTCCCAGGTATACAGTGGCAGG + Intronic
1048888712 8:138929731-138929753 CATCCCAGGGCCACAGAGCCTGG - Intergenic
1049099188 8:140567231-140567253 CATCCCACGTCCACAGTGGCTGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050979856 9:11996630-11996652 CATACCAGGGAAACAGTGCCTGG + Intergenic
1051720237 9:20029261-20029283 CGTCCCAGGCAGTAAGTGGCAGG + Intergenic
1056008694 9:82302525-82302547 CATCCCGAGGAAACAGTGCCTGG - Intergenic
1056019275 9:82424417-82424439 CATCCCAGGGAGACAGGGAGTGG - Intergenic
1056059511 9:82869851-82869873 CATTCTAGGCAGACAGGGGCAGG + Intergenic
1056517888 9:87372142-87372164 AATCCCAGGGAGACTGAGGTGGG + Intergenic
1057227881 9:93302046-93302068 CAGCCCAGGGGCACAGAGGCAGG - Intronic
1059141534 9:111857581-111857603 GATCCCAGGGAGCAAGAGGCAGG - Intergenic
1059424946 9:114215142-114215164 CACCCCAGGGAGTCGGTGCCAGG - Intronic
1059994733 9:119897637-119897659 AAGCCCAGGGAGACACTGACAGG + Intergenic
1061080183 9:128365216-128365238 GCTCGCAGGGAGACAATGGCAGG - Intergenic
1061191765 9:129086356-129086378 CTTCCCAGGGAGACAGGGGCTGG - Intronic
1061675661 9:132214234-132214256 CCTCCCAGGGAGAGAGGAGCGGG - Intronic
1062044055 9:134417097-134417119 CTTCCCTGGGAGCCACTGGCCGG + Intronic
1062315803 9:135966521-135966543 CAGCCCAGGGAGGCAGCGTCGGG - Intergenic
1062475674 9:136725788-136725810 CATCCCAGGGGGGCGGGGGCGGG - Intergenic
1186568599 X:10690985-10691007 AATCACAAGGAGACAGTGGTAGG - Intronic
1187224320 X:17361278-17361300 CATCAAAGGGGCACAGTGGCAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190336431 X:49265546-49265568 CTTCCCAGTGGGACAGTGGCTGG - Intergenic
1191608715 X:63088703-63088725 CATCCAAGAGAGATAGGGGCAGG - Intergenic
1192261256 X:69506857-69506879 CACCCCATGGTGACAGTGGGGGG + Intronic
1193330100 X:80226389-80226411 CATGGCAGGGATATAGTGGCAGG - Intergenic
1193637373 X:83969021-83969043 CAGCCAAGGGAGACAGTGAATGG + Intergenic
1193863735 X:86703087-86703109 CATCCCAGTGATACAGTGATGGG + Intronic
1194159504 X:90433172-90433194 GGTCCTAGGGAGACAGCGGCAGG + Intergenic
1194621400 X:96176985-96177007 TACCCAAGGGACACAGTGGCTGG + Intergenic
1195219448 X:102732327-102732349 GATCCAAGGGAGTCAGGGGCAGG + Intronic
1195716932 X:107826651-107826673 CGTCCCAGGAGGGCAGTGGCAGG - Intronic
1196985959 X:121271124-121271146 CATGTCAGGGAGACAGGGGGAGG + Intergenic
1200505805 Y:4010142-4010164 GGTCCTAGGGAGACAGGGGCAGG + Intergenic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic