ID: 936049347

View in Genome Browser
Species Human (GRCh38)
Location 2:109211474-109211496
Sequence GATGGGCGCAACTGCGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936049342_936049347 -3 Left 936049342 2:109211454-109211476 CCGTGTCTGAGAAGAATGCAGAT 0: 1
1: 0
2: 0
3: 15
4: 237
Right 936049347 2:109211474-109211496 GATGGGCGCAACTGCGGTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936049347 Original CRISPR GATGGGCGCAACTGCGGTGG AGG Intronic
900478706 1:2888082-2888104 GATGGGGCCAACGGTGGTGGAGG - Intergenic
902156096 1:14487721-14487743 GGTGGCTGCAACTGAGGTGGTGG + Intergenic
905167051 1:36088904-36088926 GATGGCCGCAGCGGCGATGGCGG + Exonic
906535861 1:46550618-46550640 GATGGACACAGCTGCTGTGGAGG + Intronic
1069604292 10:69730061-69730083 GATGATGGCAACTGAGGTGGGGG + Intergenic
1072190621 10:93074039-93074061 GGAGGGCACAACTGCGGTCGCGG - Exonic
1074008990 10:109457258-109457280 GGTCGTGGCAACTGCGGTGGTGG - Intergenic
1082295825 11:50440133-50440155 GATGAGGGAAACTGAGGTGGAGG - Intergenic
1084674845 11:70628339-70628361 GACGGGCGCAGCAGGGGTGGAGG + Intronic
1089190690 11:116651197-116651219 GCTGGGCGCACCTGAGCTGGAGG - Intergenic
1089397264 11:118144610-118144632 CATTGGCGCGGCTGCGGTGGGGG - Intronic
1091473902 12:753372-753394 GCTGGGCCCAGCTGCGGCGGGGG - Exonic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1104098406 12:125582890-125582912 AATGGGCTCAACTGTGGTGAGGG + Intronic
1104630160 12:130393849-130393871 GATGGGAGCTCCTGCCGTGGGGG - Intergenic
1104828373 12:131731041-131731063 GATGGGTGGGACTGTGGTGGTGG - Intronic
1104961479 12:132490331-132490353 GCTGGGCGCATCGGCGGGGGCGG - Exonic
1106814294 13:33389396-33389418 GGTGGGAGGAACTGTGGTGGAGG + Intergenic
1108346631 13:49552859-49552881 GCTGGACACAACTGCGGTAGTGG + Intronic
1112535540 13:100251049-100251071 GATGGGGGCAACTGTAGTAGTGG + Intronic
1113853414 13:113430823-113430845 GATGGGAGCAGCTGTGGTGGTGG + Intronic
1122938897 14:104972521-104972543 GGTGGGCGTAGCTGGGGTGGGGG - Intronic
1122951544 14:105047772-105047794 GACGGGCGCAGCTGGGGAGGTGG - Intergenic
1124455874 15:29842447-29842469 TGTGGGTGCACCTGCGGTGGGGG - Intronic
1131062928 15:89415395-89415417 CCTGGGCGCAACTTTGGTGGAGG - Intergenic
1135565846 16:23510390-23510412 GATGGCGGCGACCGCGGTGGCGG - Exonic
1136580618 16:31149003-31149025 GAGGGGACCAACTGCGGGGGCGG + Intronic
1140718564 16:77749517-77749539 CATGGGGGCAACTGTGGTGGGGG - Intergenic
1141659732 16:85435494-85435516 GATGGGCGCACCTGCTGCGGGGG - Intergenic
1148070758 17:44907220-44907242 GAGGGGAGCAGCTGGGGTGGTGG + Intronic
1149796893 17:59529139-59529161 GATGGGCACAGGTGGGGTGGGGG - Intergenic
1152903998 17:82960683-82960705 GGGGGGCGCAGCTGCCGTGGAGG - Intronic
1155963903 18:32018700-32018722 GTTGGGCGCAGCGGCGGAGGTGG + Exonic
1160896963 19:1407651-1407673 GATCTGCGCAACGGCGGCGGCGG - Exonic
1163089599 19:15010682-15010704 GATGGGCGCAACAAGGGAGGTGG - Intronic
1165772030 19:38385699-38385721 GATGGGCGCAGCCGCGGGTGCGG + Exonic
1167473253 19:49686827-49686849 GATGGGGGCAGCCGGGGTGGGGG + Intronic
1168319472 19:55500513-55500535 GATGGGCCCAACCGCTGTGCTGG + Exonic
926275842 2:11402635-11402657 GATGGCGGCAGCGGCGGTGGTGG - Intergenic
936049347 2:109211474-109211496 GATGGGCGCAACTGCGGTGGAGG + Intronic
936539777 2:113340791-113340813 CATGGGCGGAAGTGGGGTGGTGG + Intergenic
945436071 2:209819008-209819030 GAAGGTCGCAACTGTGATGGTGG - Exonic
948443053 2:238009918-238009940 GATGGGAGTATCTGTGGTGGTGG - Intronic
948526895 2:238576338-238576360 GAGAGGAGAAACTGCGGTGGGGG - Intergenic
1175246124 20:57583184-57583206 GATCGTCGCAACTGGGGAGGGGG - Intergenic
1176088627 20:63309264-63309286 GACGGGGCCACCTGCGGTGGGGG - Intronic
1182069606 22:27454392-27454414 GATGGTTGCATCTGCAGTGGTGG - Intergenic
953574632 3:44103246-44103268 GATGGGGGAAACTGAGGTAGTGG - Intergenic
953705141 3:45225506-45225528 GGTGGGCGCCCCGGCGGTGGCGG + Exonic
954328638 3:49877416-49877438 GATGGGCGCAGCAGGGGTGGGGG - Intergenic
954351457 3:50047623-50047645 GGTGGGAGCAACAGCGGCGGCGG - Intronic
955254062 3:57311596-57311618 GATGGTCACAACTGTGGTGGGGG + Intronic
955803553 3:62710262-62710284 GCTGGCCTCAACTGGGGTGGGGG + Intronic
961119520 3:124361856-124361878 GATGGTGGCAGCAGCGGTGGTGG + Intronic
962851044 3:139308519-139308541 GATGGGAGAAGCTGGGGTGGAGG + Intronic
977588075 4:98797245-98797267 GATTGACGCAACTGCGTTAGAGG + Intergenic
979582780 4:122379585-122379607 GGTGGGAGCAACGGCGGCGGCGG + Intronic
993776941 5:92011965-92011987 GATGGGAGGAACTGCTGTGAAGG - Intergenic
994681098 5:102888615-102888637 GATGGGAGTAAGTGTGGTGGAGG - Intronic
996487825 5:124057429-124057451 GGTGGGGGCACCTGCTGTGGAGG + Intergenic
998368343 5:141645245-141645267 GATGGGTGCACCTGCCTTGGAGG - Intronic
1003444170 6:6169654-6169676 GATTGTCACAACTGGGGTGGAGG + Intronic
1004660740 6:17706864-17706886 AATAGGCGCAACGGCGGCGGAGG - Intergenic
1005384489 6:25272502-25272524 GATGGTGGCAACTATGGTGGTGG - Intergenic
1006807917 6:36800466-36800488 AGTGGGCGCAAGTTCGGTGGAGG - Intronic
1007748017 6:44055087-44055109 GAAGGCAGCAACTGCGGAGGAGG + Intergenic
1026045105 7:66901761-66901783 GGAGGCAGCAACTGCGGTGGGGG - Intergenic
1035918536 8:3652050-3652072 GATGGGGGTAAGTGCGATGGTGG - Intronic
1037815945 8:22111945-22111967 TATGTGCGCATGTGCGGTGGGGG + Intergenic
1055907783 9:81314238-81314260 GATGGCAGCAGCTGTGGTGGTGG - Intergenic
1058265180 9:102890230-102890252 GATGGGCACACCTGGGGGGGGGG - Intergenic
1062086628 9:134652534-134652556 GATTGTCGCACCTGGGGTGGGGG + Intronic
1062467196 9:136686666-136686688 GATGGGCGCACCTGTGGGGCGGG - Intronic
1189558158 X:42166256-42166278 CATGGGGGAAACTGCAGTGGTGG + Intergenic
1196077814 X:111596432-111596454 GAGGAGGGCAAGTGCGGTGGAGG - Intergenic