ID: 936063593

View in Genome Browser
Species Human (GRCh38)
Location 2:109313892-109313914
Sequence AGATATTTGAAAGGTGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936063587_936063593 12 Left 936063587 2:109313857-109313879 CCAGAGCAGAGGGATTTGAAGAG 0: 1
1: 0
2: 1
3: 12
4: 211
Right 936063593 2:109313892-109313914 AGATATTTGAAAGGTGTGTTGGG 0: 1
1: 0
2: 1
3: 20
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936063593 Original CRISPR AGATATTTGAAAGGTGTGTT GGG Intronic
902025172 1:13377654-13377676 ATATATTAGCCAGGTGTGTTGGG + Intergenic
903527621 1:24004048-24004070 AGACATATACAAGGTGTGTTTGG + Intergenic
907012098 1:50972930-50972952 AGATATTTAATGGGTGTTTTGGG - Intronic
907378999 1:54069814-54069836 AGATATTTAAAAGGTAAGTCAGG + Intronic
907610291 1:55862444-55862466 AGTCATTTGAAAGGCCTGTTTGG + Intergenic
908971396 1:69837739-69837761 AGATATTTTAAAGATATCTTTGG - Intronic
909717458 1:78726717-78726739 TGATATTTCAAAGGATTGTTTGG - Intergenic
909952984 1:81741659-81741681 AAATATTTAAAAGTTGTCTTTGG - Intronic
909955547 1:81774220-81774242 AGACATTTGAAATGTATTTTAGG - Intronic
909984999 1:82150672-82150694 AGAAATTTGAGAGGTGAGCTTGG - Intergenic
910341987 1:86199150-86199172 AGATCCTTGAAAGATGTCTTGGG - Intergenic
911790861 1:102014037-102014059 AAGCATTTGAAAGGTGAGTTGGG + Intergenic
912015712 1:105032879-105032901 AAATATATCAAAGGGGTGTTAGG - Intergenic
913050120 1:115110111-115110133 AGAAATTTAAAAGATGTTTTGGG - Intergenic
913195998 1:116456499-116456521 AAATATTTGAAAGCTGGGTAAGG + Intergenic
913666130 1:121050486-121050508 AGATATTTCAAAGGTCAGTAAGG + Intergenic
914017531 1:143833762-143833784 AGATATTTCAAAGGTCAGTAAGG + Intergenic
914656142 1:149742294-149742316 AGATATTTCAAAGGTCAGTAAGG + Intergenic
915202164 1:154239140-154239162 GGATATTTTAAAGGTAGGTTTGG - Intronic
917368898 1:174266531-174266553 AGAAATTTGAACCATGTGTTTGG - Intronic
918354635 1:183695847-183695869 ATATATTTTAAAGTTTTGTTCGG + Intronic
918679838 1:187339723-187339745 AGATAAATGAAAGATGTGTGTGG + Intergenic
918735667 1:188059836-188059858 AAATACTTCAAAGGTGTTTTAGG - Intergenic
919533971 1:198763136-198763158 TGATATTTGCAAGGTGGATTAGG - Intergenic
920585091 1:207151381-207151403 AGAAATCTGAAAGTTGTATTGGG + Intergenic
921155772 1:212437382-212437404 AGATTTTAGAAAGGTGTTATGGG - Intronic
922086877 1:222357582-222357604 AGACATTTGAAGGGTGAGTAAGG - Intergenic
923078653 1:230633015-230633037 AGAGATAGGGAAGGTGTGTTAGG + Intergenic
923742810 1:236671423-236671445 TGATCTTTGAAAGATGTGCTTGG + Intergenic
924118963 1:240777295-240777317 AGAAATTTGAAACGTTTGATCGG + Intronic
924402011 1:243693301-243693323 AGGTATTTCTAAGGTATGTTGGG - Intronic
1063564341 10:7159853-7159875 AGCTCTTAGAAAGGGGTGTTTGG + Exonic
1063626840 10:7698161-7698183 AGAAATTTGACACGTGTGTATGG - Intergenic
1064246075 10:13668663-13668685 AGATGCGTGAAAGGTGTGGTGGG + Intronic
1065958659 10:30715551-30715573 AAATATTTAAAAAGTGTATTAGG + Intergenic
1066660260 10:37731621-37731643 TGGTCTTTGAAAGGTGTGATGGG + Intergenic
1067547038 10:47199867-47199889 TGATATTTAAAAGTTGTTTTTGG - Intergenic
1068472892 10:57487885-57487907 AGATATCTGTTAGGTCTGTTTGG + Intergenic
1068510491 10:57959283-57959305 AGAAATTTGAAATATCTGTTGGG + Intergenic
1072793727 10:98338150-98338172 GGAGGTTTGAAAGGTGCGTTGGG - Intergenic
1073309384 10:102529152-102529174 AGACATTTGAAAATGGTGTTGGG - Intronic
1073517750 10:104092721-104092743 AGTTCTTTGAAATTTGTGTTAGG + Intergenic
1073578881 10:104645866-104645888 AGCTATTTGAAAAATCTGTTTGG - Intronic
1074717425 10:116233023-116233045 TGTTATTTAAAAGGTATGTTTGG + Intronic
1078559497 11:12358114-12358136 AGAGATGAGAAAGGTGTGTGCGG - Intronic
1080555307 11:33410814-33410836 AGGGATTTGCAAGATGTGTTTGG + Intergenic
1080820643 11:35802871-35802893 AGATATTTGAAGGGTATTTGGGG + Intronic
1081366806 11:42244933-42244955 CGATATTTCATAGATGTGTTGGG - Intergenic
1082715807 11:56612001-56612023 AGATATTTACAAGATGGGTTTGG + Intergenic
1082899538 11:58230862-58230884 ATATGTTTGAAATATGTGTTTGG - Intergenic
1082929279 11:58582210-58582232 AGATATGTCAAATGTGTGTATGG + Intronic
1084909341 11:72375119-72375141 AGATATTTTAAATGTTTTTTTGG + Intronic
1085379692 11:76103394-76103416 ATATACGTGAAAGGTGTGATTGG - Intronic
1086681639 11:89680393-89680415 AGATTTTTGAGAGGTGAGCTGGG + Intergenic
1086838431 11:91654354-91654376 ATGTATTTTAAAGGTGAGTTTGG + Intergenic
1088994284 11:114982890-114982912 AGATATTTGCAAGGTATCTGAGG - Intergenic
1089168145 11:116493478-116493500 AGAAATTCCACAGGTGTGTTGGG + Intergenic
1090045786 11:123331732-123331754 AAATATTTTAAAGTTATGTTTGG + Intergenic
1091667460 12:2429696-2429718 AGAAATTTGCAAGGGGTGCTTGG + Intronic
1092500995 12:9047243-9047265 AGACATGTGAAAGGTGTGACAGG + Intergenic
1092539485 12:9412043-9412065 ACATTTTTGAAAGGTGTGGGTGG + Intergenic
1094522532 12:31207964-31207986 AGAATTTTGTAGGGTGTGTTTGG - Intergenic
1094663929 12:32499415-32499437 AGATCTATGAAAGGTGAGTAAGG - Intronic
1095075172 12:37911758-37911780 AGATATTTGAAAGCACCGTTAGG - Intergenic
1095380339 12:41583337-41583359 AGATATTAAAAAGGTATGCTTGG - Intergenic
1096201640 12:49687850-49687872 AGATATTTGGAGGGAATGTTAGG - Intronic
1096682816 12:53268263-53268285 GGATATTTGAAAGGAGGGTCTGG + Intergenic
1100127777 12:91451108-91451130 AGACATTTGAAGGCTGTGTTTGG - Intergenic
1100233982 12:92638892-92638914 AAATACTTGAAAGGTAAGTTGGG - Intergenic
1103632596 12:122274406-122274428 AGAAATCTGAAAGGTGTGAGGGG - Intronic
1103959047 12:124596246-124596268 AGATATTTCAAACATTTGTTAGG - Intergenic
1105420402 13:20247216-20247238 AGATCTTTGTTAGCTGTGTTTGG + Intergenic
1106518717 13:30477688-30477710 AGATATTTGTCAGGTCTGCTAGG - Intronic
1107028782 13:35830089-35830111 AGAAATTTAAAACGTGGGTTGGG + Intronic
1107127948 13:36864699-36864721 AGACATTTTGAAGGTATGTTAGG + Intronic
1107507760 13:41052050-41052072 AGCTACTTGAAGGGTGTGTCAGG - Intronic
1107626845 13:42295443-42295465 ATATATTTGAAATATGTTTTGGG + Intronic
1108107820 13:47031602-47031624 ATATATTTTAAGGCTGTGTTGGG - Intergenic
1108891613 13:55267774-55267796 AGATAATTGAATGGTAAGTTTGG - Intergenic
1109005284 13:56867522-56867544 AGTCATATGAAAGGTGTGATTGG - Intergenic
1109947326 13:69453799-69453821 AGATTTTTGAAAATTGTGTGTGG - Intergenic
1111765789 13:92526771-92526793 AAAGATTTGAAATGTGTTTTAGG + Intronic
1112838126 13:103541964-103541986 AAACATTTGAAAAGTATGTTGGG - Intergenic
1113423672 13:110189653-110189675 ATTTACTTGAAAGGTGTTTTGGG + Intronic
1113569715 13:111345254-111345276 AGATGTTAGAAATGTGTTTTGGG + Intergenic
1115020319 14:28672261-28672283 TAATATGAGAAAGGTGTGTTTGG + Intergenic
1118042563 14:61933043-61933065 ATATCTTTGACAGGTGAGTTTGG + Intergenic
1118986443 14:70759715-70759737 GTATATTTAAAAGGTGTGTATGG - Intronic
1120139763 14:80915815-80915837 AGATATTTGAAATATGTGATAGG - Intronic
1120142934 14:80948605-80948627 AAATATTAGAAAGTGGTGTTTGG - Intronic
1120299213 14:82684181-82684203 ACATATTTAAAAGGTATTTTAGG + Intergenic
1120957961 14:90099527-90099549 AGTTATTAGAAAGGTGTTTCTGG + Intronic
1122440179 14:101726448-101726470 AGATATTTGGAAGCTGAGTCGGG + Intergenic
1123568994 15:21582803-21582825 AAAGATTTGAAGGGAGTGTTAGG + Intergenic
1123605103 15:22018124-22018146 AAAGATTTGAAGGGAGTGTTAGG + Intergenic
1124087994 15:26569764-26569786 TCATATTTGCAAGGTGTGCTAGG - Intronic
1124919385 15:34011023-34011045 CGATATTTGAAAAGTGTGCTAGG + Intronic
1125980298 15:43995165-43995187 AGATATTTAAAATGTGTGGGAGG - Intronic
1127127782 15:55830197-55830219 AGACATTTGGAAGATGTGGTGGG - Intronic
1127890864 15:63249832-63249854 AGACATTTAAAAGGTTTTTTGGG + Intronic
1129013289 15:72442446-72442468 AGATGTTTGCAAGGTGTTCTAGG + Intergenic
1130034851 15:80349490-80349512 TGATATTTAAAATGTGTGTGTGG + Intronic
1202977348 15_KI270727v1_random:309893-309915 AAAGATTTGAAGGGAGTGTTAGG + Intergenic
1133078634 16:3300270-3300292 AGAGATTTGCACGGTGTTTTGGG - Exonic
1134484342 16:14645458-14645480 AGCTATCTGAAAGGTGGCTTTGG - Intronic
1136119388 16:28121339-28121361 AGAGACTGGATAGGTGTGTTGGG - Intronic
1136637766 16:31536852-31536874 AGATTTTTGAAACTTGTTTTTGG - Intergenic
1137466836 16:48717548-48717570 TGATATTTTAAAGGAGAGTTGGG - Intergenic
1139233862 16:65314037-65314059 TCATATTTAAAAGTTGTGTTGGG - Intergenic
1147025891 17:37582921-37582943 AGAAATTTAAAAGGTGCCTTTGG + Intronic
1149153885 17:53602995-53603017 AGATATTTGTTAGGTCTGTCAGG + Intergenic
1149303455 17:55326738-55326760 AGAAAGGTGAAAGGTGGGTTGGG - Intergenic
1151939531 17:77283744-77283766 AGATTTTAGAAGGATGTGTTGGG + Intronic
1152416084 17:80162936-80162958 AGAGATTTGAAAGGATTTTTTGG - Intergenic
1156147622 18:34204689-34204711 AGATAATGGAAAGATGTCTTAGG - Intronic
1156378955 18:36540116-36540138 AGATATTAGACAGGTTTGTAGGG + Intronic
1159202364 18:65203947-65203969 AGGTATTTGAAATGCATGTTTGG + Intergenic
1159308991 18:66683628-66683650 AGGTATTTGCAAGGGGTATTTGG - Intergenic
1159709973 18:71745813-71745835 AGAGATTTTATATGTGTGTTAGG - Intronic
1159999505 18:75003128-75003150 AAATAATTGAAATGTTTGTTAGG - Intronic
1162651982 19:12095560-12095582 AGATATTTCACAGCTGTGTTTGG + Intronic
1162699524 19:12503328-12503350 AGATATTTCGGAGTTGTGTTTGG - Intronic
1162923341 19:13917172-13917194 ATATATTTAAAAAGTGAGTTGGG + Intronic
1164605825 19:29597361-29597383 AGATTTTTGACAGGTGTGGAGGG + Intergenic
1165814914 19:38635942-38635964 AGGTGTTTTAAAGATGTGTTTGG + Intronic
1166788681 19:45384913-45384935 ATATATTTGAAAGGTGAGCCTGG - Intronic
925127634 2:1471706-1471728 TGATATTTGAAGTGTGTGTAGGG + Intronic
925457466 2:4028133-4028155 GGAAATTTGAATGTTGTGTTGGG - Intergenic
928752722 2:34489218-34489240 AAATATTTAAAATGTGTATTTGG + Intergenic
932237600 2:70133465-70133487 AGATGTCTGCCAGGTGTGTTCGG + Intergenic
933345935 2:81085819-81085841 AGATTTTTTTCAGGTGTGTTTGG - Intergenic
934137785 2:89014768-89014790 AGGTATATACAAGGTGTGTTGGG + Intergenic
934231463 2:90185859-90185881 GGATATATACAAGGTGTGTTGGG - Intergenic
935292278 2:101620765-101620787 AGATATTTGAGAGATTTATTTGG + Intergenic
935909331 2:107878147-107878169 AGATAAGTGAAAGGTGTATGAGG - Intronic
936063593 2:109313892-109313914 AGATATTTGAAAGGTGTGTTGGG + Intronic
936715991 2:115188257-115188279 AAATAATTGAAAGATGTGTATGG + Intronic
939758663 2:146146814-146146836 AGAAATTTCAAAGGTGTGTCAGG - Intergenic
939856002 2:147359417-147359439 AGATATATGAAAGGTTTTTCTGG - Intergenic
939916515 2:148050683-148050705 AGATTTTTGACAGGAGTGCTAGG - Intronic
940040861 2:149359106-149359128 ACATATTTTAAAGGAGTGTTTGG + Intronic
940808185 2:158211218-158211240 AGATATTTGAAAGTTTTTGTTGG - Intronic
941560915 2:167042850-167042872 AGATGTCTGATAGGTCTGTTCGG - Intronic
941722800 2:168829790-168829812 AGATGTTTGTAAGCTGTGGTAGG + Intronic
943727692 2:191268808-191268830 AGATCTTTGGAAGCTTTGTTTGG + Intronic
944390035 2:199208455-199208477 TGAAATTTGAAAGGAGTGCTGGG - Intergenic
945237133 2:207641639-207641661 ATATATTTGAAAGGCATGCTTGG + Intergenic
945642543 2:212446882-212446904 ATATATTTGAAAAGTGTCATTGG + Intronic
946844752 2:223849402-223849424 AGATAATTGAAACGTGGGGTTGG + Intergenic
946889892 2:224264430-224264452 AGATCCTTGGAAAGTGTGTTTGG + Intergenic
948044330 2:234931661-234931683 AAATATTTGGAAGGCATGTTTGG + Intergenic
1169960894 20:11159040-11159062 GGATATTTGCAAGGTGGCTTTGG + Intergenic
1169974444 20:11307604-11307626 AGATATTTTAAAGGTGAATTTGG + Intergenic
1170282009 20:14659918-14659940 AAATATTTGAAAGGTTTTTTAGG - Intronic
1172453202 20:35044093-35044115 AGATATTTAAAAGGGGTGCTAGG + Intronic
1173039103 20:39443640-39443662 AGCTATTTGATAGATGTTTTAGG - Intergenic
1173197943 20:40931419-40931441 AGATGGCTGAAAGGTGGGTTTGG + Intergenic
1174093480 20:48068489-48068511 AGACATTCGAAAGATGTTTTTGG + Intergenic
1174757277 20:53172432-53172454 AAATATTTAAAAGATGTCTTAGG + Intronic
1174997322 20:55585019-55585041 AGATATTTCAAAGTTGTAATAGG - Intergenic
1175305202 20:57971163-57971185 AGATATTTGACATCTGTGTCTGG + Intergenic
1176217898 20:63956841-63956863 AGATGTTTCAACGGTGAGTTCGG - Exonic
1178088016 21:29132481-29132503 AGATATTTTAAAGTGGTTTTTGG + Intronic
1179398606 21:41063449-41063471 AGATATTTGAAAGTATGGTTGGG + Intergenic
1180936457 22:19628437-19628459 AGACGTGTGAAAGGTGTCTTTGG + Intergenic
949195242 3:1297876-1297898 TGATATTTAACAGGTGTGATGGG + Exonic
949513008 3:4783030-4783052 AGACAGTTGAAAGGAGTCTTAGG + Intronic
951103727 3:18719169-18719191 AGATCTGTGAAAGGTAAGTTGGG + Intergenic
953350001 3:42208395-42208417 AGTTATTTCCAAGGGGTGTTTGG + Intronic
953599897 3:44351788-44351810 AAATATTAAAAAGGTGGGTTGGG - Intronic
954471156 3:50696602-50696624 AGATTTGTGCAAGGTGTTTTGGG + Intronic
955012185 3:55028916-55028938 AGATAAATGAAAGGTGCGTGGGG - Intronic
955678054 3:61470029-61470051 AGTTTTTTGAAATGTGTTTTGGG + Intergenic
955855922 3:63273583-63273605 AGATTTTTGTAAGTTATGTTAGG - Intronic
956497339 3:69842578-69842600 AGATGTTTGAAGTGTGTGCTTGG + Intronic
956688179 3:71851602-71851624 AGATTTTTGAGAAGTGTGCTAGG + Intergenic
957507519 3:81142547-81142569 AGATATTTCAAACTTGTGTATGG + Intergenic
957656667 3:83087103-83087125 AGGTATTTGGATGGTGTATTAGG - Intergenic
957957292 3:87204289-87204311 TTATATTTGAATGTTGTGTTTGG - Intergenic
958054921 3:88397064-88397086 AGATATATGATAAGTGTGCTTGG + Intergenic
958551818 3:95623514-95623536 AGGAATTTGACAGGTGTCTTTGG - Intergenic
958593183 3:96186952-96186974 AAATATATGAAAATTGTGTTAGG - Intergenic
958959683 3:100497107-100497129 AAATATTTGAAAAATGTTTTAGG + Intronic
961014079 3:123454054-123454076 AGATATAAGCAAGGTGTGCTGGG - Intergenic
962188316 3:133283627-133283649 AGAGGCTTGAAAGGTGTTTTTGG - Intronic
962637310 3:137344498-137344520 AGATAATTGGAAGTTTTGTTGGG - Intergenic
963483957 3:145912561-145912583 AGATTTTTAAAAAATGTGTTTGG - Intergenic
964184764 3:153929718-153929740 AGAAATTTGAAATGAGTATTAGG - Intergenic
964424451 3:156536251-156536273 AGATACTTGACAGTTGTTTTTGG - Intronic
965277065 3:166698263-166698285 AGATAATTGAAGTGTCTGTTAGG - Intergenic
965331162 3:167376294-167376316 AGGTTTTTGAAAGGTGCCTTTGG - Intronic
966006798 3:175023815-175023837 AGATTTTTGAGATGTCTGTTTGG + Intronic
967546381 3:190733759-190733781 AGACATTTCAAAGATGTGCTGGG + Intergenic
968784134 4:2606348-2606370 AGATATTAAAGAGGTTTGTTAGG - Intronic
970373492 4:15432927-15432949 AGAAATTTTAAAGATGTGATTGG - Intronic
970861164 4:20704131-20704153 AGATTTCTGAAAGGAGTGGTTGG - Intronic
971653569 4:29311152-29311174 AGATATCTGGAAGTTATGTTGGG + Intergenic
971778452 4:30998821-30998843 AGATATATGAAAGAAGAGTTAGG + Intronic
972498841 4:39658903-39658925 AGATATAAGAAATTTGTGTTAGG + Intergenic
972507986 4:39739332-39739354 AGATTTTTAAAAAGTGTTTTGGG - Intronic
974618344 4:64320759-64320781 AGATTTTAGAAAAGAGTGTTTGG - Intronic
975108912 4:70601389-70601411 AGAAATTTGAAAAGAGTGTTAGG - Intronic
975397691 4:73896034-73896056 AAATATTTGAAAGGTTTGAAGGG + Intergenic
976672467 4:87668807-87668829 AGAGATTGGAAAGGTGAGCTGGG + Intergenic
978645168 4:110921800-110921822 CTATATTAGAAAGGTTTGTTTGG - Intergenic
979595367 4:122528629-122528651 ATATATATGAAGGGTATGTTTGG - Intergenic
979692895 4:123579318-123579340 TAATATTGGAAAGGTGTTTTGGG + Intergenic
981189378 4:141842794-141842816 AGTTATTTGAAAACTGTGATGGG - Intergenic
981832085 4:149013600-149013622 AAATATTTGTGAGGTTTGTTAGG + Intergenic
983866161 4:172769279-172769301 AGATATTTTAAAGATATTTTAGG + Intronic
984633004 4:182080155-182080177 AGAGTTTTGAAACGTGGGTTAGG - Intergenic
984779530 4:183512459-183512481 AGATAGTTTAAAGGTGAGTTTGG + Intergenic
986441278 5:7784222-7784244 GGAGATTTGAAACTTGTGTTTGG + Intronic
986898113 5:12395869-12395891 ACTTATTTGACAGGTGTGATAGG - Intergenic
987048731 5:14131444-14131466 ATATATTTGAAGGGTGTGTAAGG + Intergenic
987419151 5:17697996-17698018 GGGAATGTGAAAGGTGTGTTTGG - Intergenic
989006650 5:36822006-36822028 AAATATTTAAAAGGTGTGTTTGG - Intergenic
989717641 5:44483060-44483082 AGTTATTTGACAGGTGTGACTGG - Intergenic
989839330 5:46041924-46041946 GGATATTTGAAAGTGGAGTTAGG + Intergenic
990529866 5:56662590-56662612 TGATATTGGATAGGGGTGTTTGG + Intergenic
991919072 5:71636405-71636427 ACATACTTGAAAAATGTGTTGGG + Intronic
992171907 5:74110254-74110276 AGGAAATTGAATGGTGTGTTAGG - Intergenic
992543668 5:77788486-77788508 AGAGACTTGAAAGGTGTTTTTGG + Intronic
992996822 5:82342271-82342293 AGAAATTTGAAAGATGGTTTTGG + Intronic
994426651 5:99597524-99597546 ATATATTTAAATGGTGTATTTGG - Intergenic
994619107 5:102141814-102141836 AGACATTTGTAAAGTGTGTATGG - Intergenic
994741454 5:103624780-103624802 AGACATTTGAAAGATGGGTGGGG - Intergenic
995896849 5:117022932-117022954 ACATATTTAAAGGGTGTGTAAGG - Intergenic
996225405 5:120987296-120987318 GGATAATTGAGAGGGGTGTTGGG + Intergenic
997178237 5:131800915-131800937 AGATGTTTGCAAGGTGTGCTAGG + Intergenic
999478455 5:151923788-151923810 AGAGTTTGGAAAGGTGGGTTGGG + Intronic
999911253 5:156202430-156202452 AGATTATTGAAAGAGGTGTTAGG + Intronic
999944993 5:156585839-156585861 ATATAATTGAAAGCTGTATTAGG - Intronic
1001777942 5:174343292-174343314 ATATTCTGGAAAGGTGTGTTAGG + Intergenic
1003870545 6:10399319-10399341 AGATAATTCAAAGTAGTGTTTGG + Intronic
1003966971 6:11261975-11261997 AGGAATTTGAAAGGTGTTTAAGG - Intronic
1004313092 6:14563248-14563270 AGATGTTTGATATGTGTGTGTGG + Intergenic
1007162844 6:39806217-39806239 AGATATTTGAAAAATATCTTAGG + Intronic
1008201513 6:48596834-48596856 AGGTATTCTAAAGGTCTGTTAGG + Intergenic
1009260028 6:61474324-61474346 AGAAACTGGAAAGGTGTATTTGG + Intergenic
1009422196 6:63475668-63475690 AGATATTAGAAACGTGTTTTTGG - Intergenic
1009535296 6:64874784-64874806 AGTTGTTTGAAGGGTGTCTTAGG + Intronic
1009707431 6:67270725-67270747 AGAGTTTTGACAGGTGTGATTGG - Intergenic
1010369785 6:75094432-75094454 AAATATTTGTAATGAGTGTTGGG - Intronic
1010392894 6:75357089-75357111 ACTTATTTGAAAGTTGTGTTTGG + Intronic
1011868225 6:91859071-91859093 GGATATTTGAGAGCTATGTTTGG - Intergenic
1011960621 6:93084640-93084662 AGAAATTTTTATGGTGTGTTTGG + Intergenic
1012180087 6:96141981-96142003 ACATATTTTATAGGTGTGTTTGG - Intronic
1013930650 6:115528318-115528340 AGATGTTTGAAAGGTGGGAGAGG - Intergenic
1015002725 6:128239044-128239066 AGATAGGTGAAAGTAGTGTTGGG - Intronic
1015693126 6:135948758-135948780 GGATATTTGAAATGGGTGTATGG - Intronic
1016008227 6:139111247-139111269 ACATGTTTTAAAGTTGTGTTTGG + Intergenic
1017313716 6:153003471-153003493 AGATATCTGAAGGCTTTGTTGGG - Intergenic
1017315037 6:153021038-153021060 AGCTATTGAAAAGGTCTGTTAGG - Intronic
1018518108 6:164610768-164610790 AGAGATTTCAAAGGTTTGTTGGG + Intergenic
1020067075 7:5196513-5196535 AGATATTTGGAAGCTGATTTAGG - Intronic
1020700497 7:11476194-11476216 AAATATTTTAAAGTTATGTTAGG - Intronic
1020876433 7:13700533-13700555 AGTTCTTAGAAATGTGTGTTAGG + Intergenic
1021476571 7:21068317-21068339 TGATATTTGAACGGGGTATTTGG - Intergenic
1022958199 7:35400658-35400680 AGATATTTGAGATGTTTGTGTGG + Intergenic
1023206337 7:37754196-37754218 AGCTATTTGAAGGATGTGTGTGG + Intronic
1024349521 7:48349554-48349576 CCATGTTTGAAAGGGGTGTTGGG - Intronic
1024412702 7:49064263-49064285 AGATATTTGTAATATGTGTTAGG - Intergenic
1024763089 7:52624057-52624079 AAATATTTGAAAGGTCACTTTGG + Intergenic
1027766934 7:82355905-82355927 ACATATTTGAAAGGAATGGTAGG - Intronic
1027930633 7:84529681-84529703 ACATATATTAAATGTGTGTTTGG + Intergenic
1028009262 7:85619900-85619922 ATGTATTTGACAAGTGTGTTAGG - Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028219413 7:88178589-88178611 AAATATGTCGAAGGTGTGTTAGG - Intronic
1028873043 7:95789693-95789715 TGACATTTGCAAGGTATGTTAGG - Intronic
1028960646 7:96746166-96746188 AGATTTTTAAAAATTGTGTTAGG + Intergenic
1030798060 7:113814402-113814424 ATTCATTTGGAAGGTGTGTTTGG + Intergenic
1032257336 7:130307749-130307771 AGACTTTTAAAAGGTGTGTGTGG - Intronic
1033164101 7:139023882-139023904 AAATATTTGAAAGGTTTTTGAGG + Intergenic
1035584352 8:760494-760516 ATATATTTGAAAGTTTGGTTGGG + Intergenic
1037227918 8:16617381-16617403 AAATATTTAAAAGATGTGTATGG - Intergenic
1039004711 8:33021538-33021560 AGAGTTTTGAAAGGTGGGTGTGG + Intergenic
1039866367 8:41507273-41507295 TGATATTTAAAATGTGTATTCGG + Intronic
1041723995 8:61001518-61001540 AGAAAACTGTAAGGTGTGTTTGG - Intergenic
1043275889 8:78392149-78392171 AGCTATTTGATATGTGTGTAAGG + Intergenic
1045785951 8:105920456-105920478 AGATATCTTTTAGGTGTGTTTGG - Intergenic
1046743084 8:117848864-117848886 TGACATTTGAAAGTTGTCTTTGG - Intronic
1047814539 8:128448455-128448477 AGATATTTGAAAGATGCCATTGG - Intergenic
1047891697 8:129319043-129319065 AGATATCTGAAAGTTGACTTTGG - Intergenic
1047997584 8:130351437-130351459 ATATATATATAAGGTGTGTTAGG + Intronic
1048206425 8:132418829-132418851 AGATAGTTGTAAGTGGTGTTGGG + Intronic
1048692254 8:136980250-136980272 AAATCTTTGAAGGGAGTGTTTGG - Intergenic
1053467503 9:38320088-38320110 AAATATTTGAAATGTCTGTAAGG + Intergenic
1055202771 9:73686561-73686583 AGATATTTTTAATCTGTGTTTGG + Intergenic
1055955842 9:81772923-81772945 AGTTATTTAAAAAGTGTGTATGG + Intergenic
1056991283 9:91413751-91413773 GGAGATTTGAAAGGTGCCTTGGG - Intronic
1058588467 9:106535212-106535234 AGATATCTTAAAGGGATGTTTGG + Intergenic
1058871600 9:109206748-109206770 AGATGTTTGAAAGGTGGACTTGG - Intronic
1059785689 9:117580755-117580777 AGCTTTTTTAAAGGTGTGTGTGG + Intergenic
1060084343 9:120683059-120683081 ACATATTAGAAAGGTATATTAGG + Intronic
1060205010 9:121677368-121677390 AAAAATTAGATAGGTGTGTTGGG + Intronic
1188358357 X:29221333-29221355 TGATCTTTGGAAGGTGTGTTTGG - Intronic
1188372478 X:29386006-29386028 AAATTTTTAAAAAGTGTGTTGGG - Intronic
1188975093 X:36663219-36663241 AGAGATTTGAAAGGGTAGTTGGG + Intergenic
1189746976 X:44178979-44179001 ATAAATTAGAAAGGTGTTTTGGG + Intronic
1190485799 X:50923734-50923756 AGAAAGCTGAAAGATGTGTTGGG + Intergenic
1190877552 X:54470573-54470595 AGAAGTTTGAAAGGTGAGTCTGG - Exonic
1193398998 X:81020431-81020453 AGATATTTAAAAAGTATTTTTGG + Intergenic
1193448257 X:81633506-81633528 ACATATTTGACAGTTTTGTTAGG + Intergenic
1193772499 X:85604646-85604668 GGATATATTATAGGTGTGTTAGG + Intergenic
1195113437 X:101670131-101670153 AGATTTTAGGAAGGTGTCTTTGG - Intergenic
1195327325 X:103768447-103768469 AGCTATCTGAAATGTGTCTTAGG - Intergenic
1196071777 X:111532209-111532231 AGATATTTGAAAGATATTTAAGG - Intergenic
1196534204 X:116822442-116822464 AGATATTTAAAAGGTAGATTGGG + Intergenic
1197310017 X:124893433-124893455 AAAGATATGAAAAGTGTGTTTGG + Intronic
1198244228 X:134814048-134814070 AGATTTTTCACAGATGTGTTTGG - Intronic