ID: 936065471

View in Genome Browser
Species Human (GRCh38)
Location 2:109328876-109328898
Sequence CAGAGCATGGAGAAGGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 339}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936065471_936065476 -3 Left 936065471 2:109328876-109328898 CCAGTTGCCTTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 33
4: 339
Right 936065476 2:109328896-109328918 CTGAGCAGGGCTGAGAGCTGAGG 0: 1
1: 3
2: 10
3: 92
4: 653
936065471_936065480 18 Left 936065471 2:109328876-109328898 CCAGTTGCCTTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 33
4: 339
Right 936065480 2:109328917-109328939 GGCTTCCCTGGGGTTGTTAACGG 0: 1
1: 0
2: 2
3: 15
4: 161
936065471_936065478 7 Left 936065471 2:109328876-109328898 CCAGTTGCCTTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 33
4: 339
Right 936065478 2:109328906-109328928 CTGAGAGCTGAGGCTTCCCTGGG 0: 1
1: 0
2: 2
3: 35
4: 321
936065471_936065479 8 Left 936065471 2:109328876-109328898 CCAGTTGCCTTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 33
4: 339
Right 936065479 2:109328907-109328929 TGAGAGCTGAGGCTTCCCTGGGG 0: 1
1: 0
2: 7
3: 36
4: 385
936065471_936065482 20 Left 936065471 2:109328876-109328898 CCAGTTGCCTTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 33
4: 339
Right 936065482 2:109328919-109328941 CTTCCCTGGGGTTGTTAACGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
936065471_936065477 6 Left 936065471 2:109328876-109328898 CCAGTTGCCTTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 33
4: 339
Right 936065477 2:109328905-109328927 GCTGAGAGCTGAGGCTTCCCTGG 0: 1
1: 0
2: 6
3: 49
4: 338
936065471_936065484 23 Left 936065471 2:109328876-109328898 CCAGTTGCCTTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 33
4: 339
Right 936065484 2:109328922-109328944 CCCTGGGGTTGTTAACGGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 69
936065471_936065481 19 Left 936065471 2:109328876-109328898 CCAGTTGCCTTCTCCATGCTCTG 0: 1
1: 0
2: 0
3: 33
4: 339
Right 936065481 2:109328918-109328940 GCTTCCCTGGGGTTGTTAACGGG 0: 1
1: 0
2: 0
3: 3
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936065471 Original CRISPR CAGAGCATGGAGAAGGCAAC TGG (reversed) Intronic
901192391 1:7420313-7420335 CAGAGCAAGGAGCAGGGCACTGG - Intronic
901316908 1:8315728-8315750 CAGAGCAAGATGGAGGCAACCGG + Intergenic
902277588 1:15350650-15350672 GAGGGCATGGAGAGGGCAAGGGG - Intronic
902378048 1:16039475-16039497 TAGAACATGGAGAATCCAACAGG + Intergenic
902546799 1:17195334-17195356 CAGAGCATGGGGACAGCGACAGG - Intergenic
902896713 1:19484948-19484970 GAGGCCATGGAGAAGGCAAAGGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
905396321 1:37668978-37669000 CCCAGCATGGAGAAGATAACTGG + Intergenic
905834792 1:41108377-41108399 CAGAGCAAGGGGAAGTCAAGTGG + Intronic
906776683 1:48536114-48536136 GAGAACATGGACAAGGAAACAGG + Intronic
907048460 1:51314189-51314211 CATCACATGGAGAAGGCAACAGG + Intronic
907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG + Intergenic
910700704 1:90071199-90071221 ACGAGCATGGAGAAGGCCACAGG - Intergenic
910807911 1:91206819-91206841 CAGAGCAGGTAGCAGGCAATCGG + Intergenic
911082659 1:93949212-93949234 CAGAGGAGGGAGAGGGCAAGGGG + Intergenic
912980818 1:114369950-114369972 AAGAAAATGGAGAAGGCACCAGG + Intergenic
914017672 1:143835515-143835537 GAGAGAAGGGAGAAGGCAAGGGG - Intergenic
914054940 1:144161331-144161353 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
914124206 1:144805030-144805052 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
914414833 1:147469757-147469779 TGGAGAATGGAGAAGGCAAGAGG - Intergenic
914656282 1:149744050-149744072 GAGAGAAGGGAGAAGGCAAGGGG - Intergenic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
915737402 1:158093786-158093808 CAGAGGGTGGAGAAGGCAGGAGG - Intronic
916986998 1:170202335-170202357 CAGAGCATTGAAAAGGCAGAGGG - Intergenic
917524958 1:175780376-175780398 CTCACCATGGAGAAGGCAAGAGG - Intergenic
918253548 1:182726349-182726371 CAGAGCATGGAGATTGAGACTGG - Intergenic
918664248 1:187129560-187129582 CCGAGCATGGAGAACACAAATGG + Intergenic
919655485 1:200193202-200193224 GAGAGGAAGGAGAGGGCAACAGG + Intergenic
919675764 1:200381008-200381030 CAGAGCATTGAAAAGGAAAAAGG + Intergenic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
920928350 1:210364027-210364049 CAGAGCTGGGAGAAAGGAACAGG - Intronic
921365247 1:214367628-214367650 CAGAGCAGGCACAAGGCTACAGG + Intronic
921518527 1:216128908-216128930 CAGAGCCTGGGGAAGGAAATGGG - Intronic
922608498 1:226906602-226906624 CAGAGCAGGGAAAAGACAAAGGG - Intronic
922758103 1:228107837-228107859 CAGAGCACCGTGAAGGCCACCGG - Exonic
922879704 1:228971433-228971455 CAGATAATGAAGAAGGCACCTGG - Intergenic
922972163 1:229751745-229751767 CAAAGCCTGGAGAAGGCAGAGGG - Intergenic
923547474 1:234933254-234933276 CAGAGCCTGGAGAAAGCATTTGG - Intergenic
923562630 1:235053047-235053069 CAGTGCATGGAAATGGCGACAGG + Intergenic
1063020266 10:2119898-2119920 CACAGTAAGGAGAAGACAACAGG - Intergenic
1066518457 10:36189764-36189786 GAGAGCATGGAGGAGGCCTCAGG + Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067833369 10:49622859-49622881 CAGAGCAAGGAGGGGGCAAGGGG + Intronic
1068724056 10:60280984-60281006 CAGATTAAGGAGTAGGCAACTGG + Intronic
1069756338 10:70776290-70776312 CAGAGAATGGAGAAGGGCCCAGG - Intronic
1070560354 10:77561773-77561795 CAGAGAAGGGATAAGGTAACAGG + Intronic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1072430946 10:95369959-95369981 CAGAGCATGAGGAAGCCAGCAGG - Intronic
1073118813 10:101108698-101108720 CAGGGGATGGAGGAGGCAATGGG + Intronic
1073207866 10:101778272-101778294 CAGAGCAGGGAGTAGGCCCCAGG + Intronic
1074104786 10:110381242-110381264 CAGAGCATGCAGTAGGCACCTGG + Intergenic
1074148592 10:110738782-110738804 CAGAGCATGGAGGCGGGAATGGG + Intronic
1074413730 10:113249308-113249330 CAGAGCATAGTGAGGGGAACAGG + Intergenic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1076409387 10:130234954-130234976 CAGACCCTGGAGAAGGCAGCTGG - Intergenic
1076578631 10:131491402-131491424 CAGGGCATGGAGGATGCAAGGGG + Intergenic
1077244031 11:1527259-1527281 CAGAGCATGGAGACGGCAGTGGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1080440172 11:32286751-32286773 GAGACCATGGAGAAGCAAACAGG + Intergenic
1082061534 11:47865210-47865232 AAGGGAATGGAGAAGGGAACAGG - Intergenic
1083642131 11:64151179-64151201 CAGAGCAGAGCAAAGGCAACAGG + Intronic
1084480299 11:69416071-69416093 CATAGCATGGGGGAGGCAAGGGG - Intergenic
1085124736 11:73992144-73992166 CTGAGTATGGAGAAGGCAAAAGG - Intergenic
1085297751 11:75440441-75440463 CTGAGCATGCAGAAGGCAGGTGG - Intronic
1087625594 11:100592518-100592540 AAGAACATGCAGAAGGCAGCCGG + Intergenic
1087651589 11:100874647-100874669 CAGAGAATGAAAAAGGCAAAAGG - Intronic
1087716343 11:101613099-101613121 AACAGCATGGAGGAGGCAAAAGG - Intronic
1088415761 11:109587047-109587069 CACAGCATGAAGATGGCAAATGG + Intergenic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089342450 11:117767628-117767650 CAGAGAGTGGAAAAGGCAGCTGG - Intronic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1090806157 11:130203601-130203623 CTGAGCATGGGGAAGGCATGAGG - Intronic
1091328089 11:134707243-134707265 CAGAGCATGGAGAAATCACAAGG + Intergenic
1091351573 11:134901752-134901774 CAGAGCACGGAGCAGGCCAGCGG - Intergenic
1092140733 12:6181795-6181817 CAGGGCATGGGGAAGCCAGCAGG + Intergenic
1092981527 12:13799544-13799566 CAGCACCTGGAGAAGGCAATGGG - Intronic
1094303221 12:28989498-28989520 CAGAGAATAGAAAAGGAAACAGG - Intergenic
1094784337 12:33828724-33828746 AAGAGCATGGTACAGGCAACTGG - Intergenic
1095044283 12:37483105-37483127 CAGAGGAAGCAGAAGGCAATGGG + Intergenic
1095882566 12:47153811-47153833 CAGTTCATGGAGAAGGAAATAGG - Intronic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097565073 12:61257903-61257925 AAGAGCAAAGAGAAGGCAAAAGG - Intergenic
1098882182 12:75927903-75927925 CAGAGCATGAAGAGGAGAACTGG - Intergenic
1098890195 12:76002446-76002468 CATTGCATGGAGAAAGAAACAGG + Intergenic
1101012732 12:100467685-100467707 AAGAGCATGGATAATCCAACTGG - Intergenic
1101364175 12:104056152-104056174 CAAAGCATAGAGAGGGCAGCTGG - Intronic
1101643592 12:106607100-106607122 CAGATCATAAAGAAGGCAATGGG + Intronic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102449577 12:113030833-113030855 GTGAGCATGGAGAAAGCAAGGGG - Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1103968737 12:124656212-124656234 CAGGGCTTTGAGAAGGGAACAGG + Intergenic
1104529533 12:129556079-129556101 CAAAGCATGGAACAGGCCACAGG + Intronic
1105615263 13:22005964-22005986 GAGAGTATAGAGAAGGCCACAGG - Intergenic
1105911811 13:24875709-24875731 CAGAGCATAGTGAAAGCAAGAGG + Intronic
1106080389 13:26495843-26495865 CAGAGCTTGGAGAGGACAGCTGG + Intergenic
1107648796 13:42523386-42523408 CAGAGCATGGATGAGCCAAAGGG - Intergenic
1108185262 13:47882278-47882300 AAGAGCAGGGAGAAGGCATGGGG - Intergenic
1110378030 13:74815793-74815815 CAAAGCATGAAGAACACAACAGG + Intergenic
1110532230 13:76610615-76610637 CATATCATGGAGAAGCCAAATGG - Intergenic
1111788950 13:92828033-92828055 CAAAGCATAGAGAAAGAAACAGG + Intronic
1111990240 13:95109087-95109109 TAGAGCATGGAGCAGTTAACTGG - Intronic
1112313064 13:98336748-98336770 TTGAGGATGGAGAAGGCAACAGG + Intronic
1116867438 14:50042274-50042296 CAGAGCATGGAGAATTACACAGG - Intergenic
1117983372 14:61363738-61363760 CTGAGGATGAAGAAGGCAACGGG + Intronic
1117991362 14:61436898-61436920 TAGAGCAGGGAGAAGGTACCAGG - Intronic
1118153129 14:63211155-63211177 CAGAGCAGGGAGTGGGAAACAGG + Intronic
1119829259 14:77686479-77686501 TAGTGCCTGGAGAAGGCAGCAGG - Intronic
1119865539 14:77970452-77970474 ATGAGCATGGAGATGGTAACTGG + Intergenic
1120546707 14:85820575-85820597 GAGAGCAGGGAGAAGGCCACTGG + Intergenic
1121263081 14:92580749-92580771 AAGAGCATGGAGAAGGCTTGTGG + Intronic
1121674085 14:95738418-95738440 CAGGGCATGGAGCAGCCAAAGGG - Intergenic
1121926094 14:97928604-97928626 CAGAAGATGAAGAAGGGAACAGG + Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1123166362 14:106329099-106329121 CATAAGATGGAGAAGACAACTGG + Intergenic
1124458329 15:29865293-29865315 AAGAGCATGGGGAATGCAGCTGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1127370466 15:58334080-58334102 CAAAGCAAGGAGAGGGCAAAAGG + Intronic
1128377355 15:67086792-67086814 CAGAGCATGGAGAGTGGAATGGG + Intronic
1128921054 15:71610535-71610557 AACAGCATGGAGATGACAACAGG + Intronic
1130203912 15:81858325-81858347 CTGAGCTTGGACCAGGCAACTGG - Intergenic
1130360873 15:83184744-83184766 AAGAGCAGGAAGAAGGCAAATGG + Intronic
1131923701 15:97358442-97358464 AAGAGAAAAGAGAAGGCAACAGG - Intergenic
1133293019 16:4735003-4735025 CAGAGCATCCAGAAGGCGAAGGG - Intronic
1134074783 16:11283014-11283036 CAGAGCATGGTGCAGGGCACTGG + Intronic
1134480525 16:14614981-14615003 CCGGGGATGGAGAAGGCTACAGG + Intronic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136547851 16:30965594-30965616 AAGAGCATGGAGAAGCCTGCGGG - Exonic
1137372693 16:47923172-47923194 CTGAACATGTAGAAGGCACCTGG + Intergenic
1138000649 16:53275605-53275627 TAGAGAATGGAGAAGAAAACTGG - Intronic
1138549302 16:57738858-57738880 CAGAGCCTGGGGAGAGCAACAGG + Intronic
1138559790 16:57794708-57794730 CAGAGCTTGGAGAAGGTATTGGG - Intronic
1139646982 16:68338575-68338597 CACAGCCTGGGGAAGGCAGCGGG + Intronic
1140017423 16:71201001-71201023 CTAAGCATGGACAAGGGAACAGG - Intronic
1142159142 16:88547784-88547806 CAGAGGGTGGGGAAGGCGACGGG + Intergenic
1142159150 16:88547808-88547830 CAGAGGGTGGGGAAGGCGACGGG + Intergenic
1142429098 16:90016787-90016809 CAGAGCATCGAGGAGGCACTTGG + Intronic
1143310107 17:5980793-5980815 CAGAGCCAGGAGGAGGCAATGGG - Intronic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1144732608 17:17537305-17537327 CAGGGCAAGGGGAAGGCAAAGGG - Intronic
1146318288 17:31826288-31826310 CAGGGCAGGAAGAAGGCAAGGGG + Intergenic
1147630971 17:41931337-41931359 CAGAGAATGGAGATTGCAAGTGG - Intronic
1147937788 17:44023536-44023558 CAGAGCAAGGTCAAGGCAGCTGG - Intronic
1150375355 17:64676813-64676835 CTGAGAAGGCAGAAGGCAACTGG + Intergenic
1151161799 17:72172211-72172233 CAGAGCAAAGAAAAGGAAACTGG - Intergenic
1152390650 17:80001889-80001911 CAGAGCCTGGAGCAGGAGACGGG - Intronic
1152622549 17:81372539-81372561 CAGAGCATGGAATGGGAAACTGG - Intergenic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156461965 18:37326290-37326312 AAGGGCAAGGAGATGGCAACTGG - Intronic
1157912571 18:51631315-51631337 AAGAAAATGGAGAAGGCACCAGG + Intergenic
1158306812 18:56115248-56115270 CAGAGCAGGGAGAATGCACTGGG - Intergenic
1158371175 18:56806276-56806298 CTGAGCATGGCGAAGGCAGGAGG - Intronic
1159457254 18:68675834-68675856 AAGACAATGGAGAAGGTAACTGG + Exonic
1160013580 18:75124764-75124786 CAAAGCGTGGAGAAGGCCAAAGG - Intergenic
1160106770 18:75985107-75985129 CAGGGCATGGAGGAGGGCACTGG + Intergenic
1160912472 19:1481324-1481346 CAGTCCATGGAGAATGCAGCCGG - Intergenic
1163761050 19:19137082-19137104 GAGAGCCTGGAGGAGGCTACTGG - Intronic
1163830645 19:19545672-19545694 GCCAGCATGGAGAAGGCAGCTGG - Exonic
1164591314 19:29508983-29509005 CAGGGCATGGGAGAGGCAACAGG + Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1165673561 19:37701412-37701434 CAGAGCAGGTAGTAGGTAACTGG - Intronic
1166103624 19:40586700-40586722 CAGGGCAGGGAGAAAGAAACAGG - Intronic
1168651552 19:58095595-58095617 CTGAGCATGGTGGAGGCATCGGG + Intronic
1202694422 1_KI270712v1_random:114006-114028 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
925039657 2:721637-721659 CCGAGCCTGGAGGAGGCAAATGG - Intergenic
925583322 2:5436768-5436790 CAGTGTATGGACAAGGCCACAGG + Intergenic
925664736 2:6240640-6240662 CGGAGCACAGAGAAGGCAACGGG + Intergenic
925887946 2:8409856-8409878 CACATCATGGAGGAGGAAACTGG - Intergenic
926280087 2:11438946-11438968 CTGAGTATGGAAAAGGGAACTGG - Intergenic
926500675 2:13649181-13649203 GAGAGGATGGAGAAGGAAACAGG + Intergenic
926620112 2:15039848-15039870 CAGAGCTTGGAGGAGGCACCAGG - Intergenic
928279901 2:29936397-29936419 CAAAGCCTGGTGAAGGCAAGAGG + Intergenic
930058756 2:47272018-47272040 CAGAGCCTGCAGAAGTAAACAGG + Intergenic
930564273 2:52999837-52999859 CAGAGGATAAAGAGGGCAACAGG + Intergenic
931814256 2:65885202-65885224 CAGAGCATGGAAGAGGTAAGAGG + Intergenic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932467680 2:71934050-71934072 CAGGGCTTGCAGAAGGCACCAGG + Intergenic
932720823 2:74138062-74138084 GAGAGCAGGGAGAAGGCATCAGG - Intronic
933480292 2:82848397-82848419 AAGAGCATGGTGCTGGCAACTGG + Intergenic
933952139 2:87340558-87340580 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934236383 2:90236896-90236918 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934475306 2:94589504-94589526 CAGAGCAAGGAGAGGGGAATTGG - Intronic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
938755681 2:134376921-134376943 CAGAGCATGGAGATGGTTAGTGG - Intronic
941314707 2:163978183-163978205 CAGAGCTTGGAGGCAGCAACTGG + Intergenic
942166912 2:173250370-173250392 CACAGCAGGGAGAAGGAAATAGG + Intronic
944425702 2:199580497-199580519 GAGAGCAAGGAGAAGGCTAGTGG - Intergenic
944975100 2:205040954-205040976 GAAAGCATGGAGAAGGGAACTGG - Intronic
945570378 2:211459671-211459693 CATATCATGCAGAAGGCAAAAGG - Intronic
945987243 2:216364691-216364713 CAGAGCTTGGACAAGCCAGCAGG + Intronic
946020997 2:216640027-216640049 GACAGCATGGAGAAGGCAGGAGG - Intronic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947514895 2:230794648-230794670 AGTAGCATGGAGAATGCAACTGG + Intronic
947597908 2:231425634-231425656 CAGAGGTTGCAGAAAGCAACAGG + Intergenic
1168961489 20:1873011-1873033 AAGAGCATGGAGCTGGCATCTGG - Intergenic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170353553 20:15468405-15468427 CAGAGCATGAGGAATGGAACAGG - Intronic
1172408350 20:34705117-34705139 CAGTGCATGGAAGGGGCAACAGG + Intronic
1172780947 20:37436816-37436838 TAGAGCAAGGAGGAGGCAAAGGG - Intergenic
1173451429 20:43167583-43167605 CAGAGCATGGTAAAGGTGACGGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173869581 20:46332914-46332936 CAGAGCATGAGGGAGGCATCGGG + Intergenic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174518299 20:51110239-51110261 CAGAGAAGGAAAAAGGCAACAGG - Intergenic
1174583573 20:51590660-51590682 CAGACAAAGGAGAAGGCAAAGGG - Intergenic
1175137796 20:56838105-56838127 CACACCTTGGAGGAGGCAACAGG - Intergenic
1175290003 20:57869429-57869451 TAGAGGAAGGAGAAGGCAAGGGG - Intergenic
1175383967 20:58582443-58582465 CAGAACAGAGAGAAGGCAAAGGG - Intergenic
1178889482 21:36509281-36509303 CACAGGCTGGAGAACGCAACTGG + Intronic
1178891087 21:36521710-36521732 CATAGACTGGAGAAGGCAAATGG + Intronic
1178929258 21:36803300-36803322 GAGACCATGGAGAAGGAAGCTGG - Intronic
1179275139 21:39885378-39885400 CAGAGCAGAGGGAGGGCAACCGG - Intronic
1179531199 21:42020743-42020765 CAGGGCATGAAGAAGGAAAGTGG - Intergenic
1180588341 22:16913998-16914020 CACAGCCTGGGGAAGGCATCAGG - Intergenic
1181513253 22:23398163-23398185 CAGAGGACGGAGGAGGCAACAGG + Intergenic
1182696357 22:32201762-32201784 CAGAGCAGGGACAATGCAAGAGG - Intronic
1182955546 22:34421889-34421911 AAGATCATGATGAAGGCAACTGG - Intergenic
1183511960 22:38241161-38241183 CAGCACAGGGAGAAGGCACCAGG + Intronic
1183742266 22:39675373-39675395 CAGAGCATGGGGAAGGGGAGAGG - Intronic
1183781829 22:40003668-40003690 CAGAGAATGAACAAGGAAACTGG - Intronic
950930514 3:16784306-16784328 CAGAGCATGGAGCATACAAAAGG + Intergenic
951595987 3:24318617-24318639 CTGGGCATTGAGAAAGCAACAGG - Intronic
951743856 3:25954782-25954804 CAGAGCATGGAGAATCCTAGAGG + Intergenic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
953381520 3:42476236-42476258 CAGAGGATGGAGAAGTCAGGAGG + Intergenic
953719380 3:45341965-45341987 CAGAGCAGTGAGGAGGCAAACGG + Intergenic
954176482 3:48849286-48849308 CAGAGCATTCAAAAGGCATCTGG + Intergenic
954810041 3:53241994-53242016 ACGAGCAGGGAGAAGGCACCTGG + Intronic
955444009 3:58988494-58988516 CAGAGCATTGAGATGGGAACAGG + Intronic
956174413 3:66459460-66459482 CAGAGCCTCAAGAAGGGAACAGG - Intronic
956447444 3:69339463-69339485 CACAGAACTGAGAAGGCAACAGG + Intronic
957185822 3:76939956-76939978 CAGAGGAAGGACAAAGCAACAGG + Intronic
958165849 3:89877229-89877251 CAGAGGCTGGAGGAGGCCACAGG + Intergenic
958916777 3:100058938-100058960 GACAGCATGGAGAAGGCATTTGG + Intronic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
960583418 3:119299536-119299558 AAGAACAAGGATAAGGCAACGGG + Intronic
961076965 3:123991781-123991803 CAGGGCAAGGGGAAGGCAAGGGG - Intronic
961825559 3:129597402-129597424 CAGAGGCTGGAGAAGGGCACAGG + Intronic
963916352 3:150862115-150862137 CAGAGCCTGGAGCAGGCAGCAGG - Intergenic
964094349 3:152914298-152914320 CAGAGCATGGAGTAGGTGAGAGG - Intergenic
964967352 3:162512780-162512802 CAGAGCCTGGAAAAGGTCACTGG + Intergenic
965838104 3:172873471-172873493 CAGAGCATGGTGCTGGCATCTGG + Intergenic
967683814 3:192396859-192396881 CTGAGCATGAAAAAGACAACAGG + Intronic
967774292 3:193370333-193370355 GAGAGCTTCTAGAAGGCAACAGG - Intronic
968814050 4:2812611-2812633 CTGAGCCTGCAAAAGGCAACAGG + Intronic
968931491 4:3581793-3581815 GAGAGCCTGGAGGAGGCAGCTGG - Intronic
969566521 4:7982004-7982026 CAGAGAGGGGAGAAGGCACCAGG - Intronic
969583881 4:8080969-8080991 TGGAGCATAGGGAAGGCAACTGG + Intronic
969651154 4:8469123-8469145 CAAAGGATGAAGAAGGAAACGGG - Intronic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
971504535 4:27351848-27351870 CTAAGCATAGAGAAAGCAACAGG - Intergenic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
975627453 4:76363898-76363920 GAGACCAGTGAGAAGGCAACTGG + Intronic
975681830 4:76885172-76885194 CAGCACATGGTGAAGGCCACTGG - Intergenic
979010308 4:115358460-115358482 CAGAGCAAAGAGAGGGCCACAGG - Intergenic
980897481 4:138874112-138874134 AGCAGCATGGAGAAGGCAGCTGG - Intergenic
981120133 4:141040031-141040053 GATAGCATGGAGAAGGAAAAAGG - Intronic
985024827 4:185730650-185730672 CAGGCCATGGAGAGGACAACCGG + Intronic
985669494 5:1200288-1200310 CAGAGGCTGAAGGAGGCAACGGG + Intergenic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
986236412 5:5914635-5914657 CAGAGCAGGTAGAAGGCATCCGG - Intergenic
986632034 5:9783093-9783115 TAAGGCAAGGAGAAGGCAACGGG - Intergenic
989280597 5:39638481-39638503 GAGAGCTTGGAGAAGGAAGCAGG - Intergenic
989434804 5:41398329-41398351 CAGAGCATGGGAGAGGAAACAGG - Intronic
990384497 5:55246393-55246415 CAGAGGAAGGAGAAGCCAACAGG + Intergenic
992962802 5:81972330-81972352 CAGAGCCGGGAGGAGACAACCGG - Intronic
993746034 5:91598250-91598272 CAGAGCATGGAGACGAGAAATGG - Intergenic
996122016 5:119683284-119683306 GAGAAGTTGGAGAAGGCAACTGG + Intergenic
996393313 5:122987105-122987127 CAGAGAATGCAGAAGCCACCTGG - Intronic
996829455 5:127723703-127723725 CAGAGAATGCAGGTGGCAACAGG + Intergenic
997779576 5:136643321-136643343 TAGAGCACAGAGAAGGCAAAAGG + Intergenic
999631437 5:153575698-153575720 CAGATCATGGGAAAGGCCACAGG - Intronic
1002194447 5:177494631-177494653 CAGAGCGTGGGGAGGGCAGCAGG + Intronic
1002607379 5:180391206-180391228 CAGAGGATGCAGATGGCCACTGG - Intergenic
1002776594 6:333185-333207 CAGAGACAGGAGGAGGCAACTGG + Intronic
1004192774 6:13478616-13478638 CTGAGCAGGGAGAAAGCATCTGG + Intronic
1005132273 6:22522974-22522996 CAGAGCATGGCAGTGGCAACAGG - Intergenic
1005380148 6:25225395-25225417 CAGCCCATGGTGAAGGCAACTGG - Intergenic
1006486538 6:34347487-34347509 CAGAGCAGGCAGAAATCAACAGG + Intronic
1006878430 6:37318325-37318347 CAGTTTATGGAGAAGGCTACAGG + Intronic
1006947807 6:37797068-37797090 CAGACAAGGGAGAAGGCAAAAGG - Intergenic
1007355685 6:41314132-41314154 CAGAGAATAGTGAAGGCAACTGG + Intergenic
1008712364 6:54243346-54243368 CAGAGCATTGAAGAAGCAACTGG + Intronic
1011327338 6:86163580-86163602 AAGAGCATGATGAATGCAACAGG + Intergenic
1011896558 6:92234421-92234443 CAGATCATGAAGAAGGAAAAGGG - Intergenic
1013895118 6:115078724-115078746 CAGAGAAGGGAGTGGGCAACAGG + Intergenic
1014817249 6:125949753-125949775 CAGAAAAAGGAGAAGCCAACAGG - Intergenic
1014946870 6:127509300-127509322 GAGAGGATGGAGTAGGCACCTGG - Intronic
1015747010 6:136520888-136520910 AAGAGGATGGAGAAGGCAAAAGG + Intronic
1016915636 6:149241971-149241993 CAGAGCCTGGGGAAGGCAGTGGG - Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017788203 6:157773676-157773698 AAGATCAGGGAGGAGGCAACTGG + Intronic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018789533 6:167136378-167136400 CAGATCAAGGAGTAGGCAATCGG - Exonic
1018916654 6:168136541-168136563 CAGAGCATGGGGAAGGTTGCAGG + Intergenic
1022622517 7:31999482-31999504 CAGAGCCTGGAAAAAGCACCAGG + Intronic
1022633498 7:32108829-32108851 CAGAGCATGGAGATTGTAAATGG + Intronic
1022634406 7:32118601-32118623 CAGAGCATGGTGCTGGCATCTGG + Intronic
1026392232 7:69913042-69913064 CAGAGAGTGGGAAAGGCAACTGG - Intronic
1026403167 7:70036890-70036912 CAAAGGATGCAAAAGGCAACAGG + Intronic
1026867689 7:73833494-73833516 CAGAGGGTGGAGAAGGGAAAAGG - Intergenic
1026876036 7:73879624-73879646 AACAGCATGGAGGAGGCATCCGG - Intergenic
1028116365 7:87002321-87002343 GAGAGCAAGGAGAAAGCAATGGG + Intronic
1029551861 7:101240794-101240816 CAGAGGAGGGTGAAGGGAACGGG + Intronic
1032372510 7:131371933-131371955 CAGAAAATCAAGAAGGCAACAGG - Intronic
1032447664 7:131998623-131998645 CAGGGCATGGAGAAGGAGAGGGG + Intergenic
1033601619 7:142892820-142892842 CAGAGAATGGAAAAGGGAACAGG - Intergenic
1034544124 7:151778546-151778568 CAGGGCTTGGAGAAGGCATGGGG - Intronic
1034670003 7:152850554-152850576 CAGAGCAGGAAGAATGAAACGGG - Intronic
1037751038 8:21682626-21682648 CAGGCCCTGGAGAAGGAAACGGG - Intergenic
1037852193 8:22340592-22340614 CACAGACGGGAGAAGGCAACAGG + Intronic
1040981973 8:53253104-53253126 CAGAGCATTGAGAAGCCCTCAGG + Intergenic
1041437360 8:57857076-57857098 AAGAGCAGGGAGATGGCACCAGG + Intergenic
1041931087 8:63287353-63287375 TAGGGCATGGAGAAGACAAGGGG - Intergenic
1042711681 8:71724242-71724264 CAGAGCAGGCAGTAGGGAACTGG - Intergenic
1043476483 8:80610692-80610714 CAGATTATGGAGAAGAGAACTGG + Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1047439168 8:124861249-124861271 CAGAAGATGGAGATGGCCACTGG + Intergenic
1047808831 8:128385928-128385950 CAGAGGAGGGAGAAGCCATCTGG - Intergenic
1048160978 8:132021704-132021726 CAAACCCTAGAGAAGGCAACAGG + Intergenic
1048725655 8:137380618-137380640 AAGAACATAGAGAAGGCAAGAGG - Intergenic
1048870621 8:138794025-138794047 CAGGGTATGAAGAAGGCACCCGG - Intronic
1049273226 8:141707188-141707210 GAGAGGAGGGAGAAGGCAAGTGG - Intergenic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050377376 9:4986538-4986560 CTGAGTATGGAGAAGGAAACTGG + Intronic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1052040723 9:23735875-23735897 CAGAGCAAGGAGAGGAAAACAGG + Intronic
1052175208 9:25452908-25452930 AAGAGGATGGAGAAGGTCACGGG - Intergenic
1052854741 9:33400277-33400299 CAGAGCAAGGAGAGGGGAATTGG + Intronic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1053682761 9:40496558-40496580 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054280953 9:63128371-63128393 CAGAGCAAGGAGAGGGGAATTGG - Intergenic
1054295861 9:63332072-63332094 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054393878 9:64636567-64636589 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054428527 9:65141780-65141802 CAGAGCAAGGAGAGGGGAATTGG + Intergenic
1054458638 9:65450136-65450158 GAGAGCCTGGAGGAGGCAGCTGG + Intergenic
1054501852 9:65879765-65879787 CAGAGCAAGGAGAGGGGAATTGG - Intronic
1056056445 9:82828817-82828839 CAGATCATGGACAAGACAAGGGG + Intergenic
1057917370 9:99067086-99067108 CAATGCATGCAGAAGGCAATGGG - Intronic
1058487050 9:105452159-105452181 CATAGCTTGGAGCAGGAAACTGG - Intronic
1058679770 9:107430746-107430768 CAGAGGAGTGAGAAGGCCACAGG + Intergenic
1059218784 9:112592096-112592118 CAGAGCAGGTAGCAGGTAACTGG + Intronic
1059804484 9:117783875-117783897 CAGAGCATGGATGAGGGAAATGG - Intergenic
1059927041 9:119219922-119219944 AAGAGCATGGAAAAGGCCACGGG + Intronic
1060028307 9:120191800-120191822 CAGGGCATGGAGAATACATCTGG + Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062537338 9:137026818-137026840 CAGAGCAGGGCCAAGGGAACAGG - Intronic
1186661438 X:11671476-11671498 GAGAGAAAGGAGAAGGCAAATGG + Intergenic
1187239834 X:17502380-17502402 TAGAGCATGGAGAAGGTTCCAGG - Intronic
1188260247 X:28015619-28015641 CTGAGCATGGACAAGGCCAGGGG - Intergenic
1189348176 X:40258303-40258325 TAGAGCAGGGAGAGAGCAACTGG + Intergenic
1190304025 X:49072372-49072394 CAGAGCATGCTTAAGGCACCAGG - Intronic
1192639111 X:72846327-72846349 CATAGCATTGAAAAGGGAACGGG + Intronic
1192642600 X:72874478-72874500 CATAGCATTGAAAAGGGAACGGG - Intronic
1193006031 X:76618726-76618748 CAGAGCATTGAGAGGGAAAATGG + Intergenic
1193038215 X:76976579-76976601 CAGAACATGGAGAAACAAACTGG + Intergenic
1193319181 X:80099941-80099963 AAGAAAATGGAGAAGGCACCAGG + Intergenic
1193756137 X:85410690-85410712 CAGAGAATGGGGAGGGCAAAAGG - Intergenic
1193998419 X:88395431-88395453 GAAAGCATGGAGAAGGAACCTGG - Intergenic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1195453091 X:105037586-105037608 CAGAGCATGGATATGGAATCAGG - Intronic
1195957619 X:110349423-110349445 CAGACCTTTGAGAGGGCAACTGG - Intronic
1196188439 X:112770038-112770060 CAGAGGATGGGGAAGGTAAGAGG + Intergenic
1198316191 X:135468977-135468999 GAGAGCATGTAGAAAGCTACTGG + Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic