ID: 936065954

View in Genome Browser
Species Human (GRCh38)
Location 2:109332340-109332362
Sequence AGGAGCAAGTGCAGCACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936065954 Original CRISPR AGGAGCAAGTGCAGCACCCC TGG (reversed) Intronic
900480672 1:2897543-2897565 AGGAGCATGAGCAGCAGCCCAGG - Intergenic
902500092 1:16905033-16905055 AGGAGCAAGTCCGGGACCGCTGG + Intronic
902639808 1:17759835-17759857 AGGAGCAGCTGCTGCCCCCCAGG - Intronic
902911040 1:19597296-19597318 AGGAGCCGGAGCAGCAGCCCGGG + Intronic
903879774 1:26500794-26500816 AGGAGCGAGGGCCGCACCGCTGG - Intergenic
905535457 1:38718145-38718167 AGGAGCAAGTTCAGAAGCTCAGG - Intergenic
907270347 1:53287553-53287575 AGTAGCCAAGGCAGCACCCCAGG - Intronic
907451513 1:54548478-54548500 AGGAGAAATCGCAGAACCCCTGG + Intronic
908789212 1:67764815-67764837 AGCAGAAACTGCAGCTCCCCAGG + Intronic
912816381 1:112832080-112832102 AGGAGCAAAGGCAGCACACAGGG - Intergenic
913372955 1:118121072-118121094 AGGGGTGAGAGCAGCACCCCTGG + Intronic
914001681 1:143699775-143699797 GGGAGCAAGTCCAGGACCGCTGG - Intergenic
914004521 1:143720789-143720811 AGGAGCAAGTCCAGGACCGCTGG - Intergenic
914096260 1:144546684-144546706 AGGAGCAAGTCCAGGACCACTGG - Intergenic
914514529 1:148362680-148362702 GGGAGCAAGTCCAGGACCGCCGG - Intergenic
914517471 1:148386108-148386130 AGGAGCAAGTCCAGGACTGCTGG - Intergenic
922113460 1:222586102-222586124 AGTAGCAAGGGCAGGTCCCCAGG - Intronic
922681624 1:227603156-227603178 AGGAGAAAGAGCAGCTCCACAGG + Intronic
922715636 1:227869729-227869751 ATGACCCAGTGCAGCAGCCCAGG - Intergenic
923628949 1:235636912-235636934 AGGAGCAAGGACGGCACCCAGGG - Intronic
924588114 1:245377743-245377765 AGGAGCAGGTGCAGCATCCACGG + Intronic
1063419433 10:5899630-5899652 AGGAGCAGCTGCAGGACTCCGGG - Intronic
1067013590 10:42738078-42738100 CTGAGCAAGTACTGCACCCCAGG - Intergenic
1067146073 10:43694800-43694822 AAGGGCAAGTCCAGGACCCCAGG - Intergenic
1067297837 10:44984887-44984909 AGGCCCAAGTGCCGCGCCCCCGG + Exonic
1067310190 10:45105662-45105684 CTGAGCAAGTACTGCACCCCAGG + Intergenic
1067851357 10:49756731-49756753 AGGAGCCAGTGCAGCCTCCCAGG + Intronic
1069939647 10:71945862-71945884 AGGAGCAAGGGCAGCACACAGGG - Intergenic
1071561812 10:86651316-86651338 AGGAGCAAGGGCAGGTCCCTGGG + Intergenic
1074427993 10:113368906-113368928 AGGAGGGAGTGCAGCCCTCCAGG - Intergenic
1075054592 10:119207848-119207870 AGCAGCAGCGGCAGCACCCCAGG + Exonic
1076244155 10:128933082-128933104 AGGAACAAGGCCAGCACCCACGG + Intergenic
1076649943 10:131980997-131981019 TGGGGCAAGTCCTGCACCCCGGG + Intronic
1076895388 10:133308935-133308957 GGGGGCAACTGCATCACCCCGGG - Exonic
1076912619 10:133399303-133399325 AGGAGAAGGCGCAGCGCCCCAGG + Intronic
1077103108 11:830798-830820 TGGGGCACGCGCAGCACCCCGGG + Intronic
1077232450 11:1463955-1463977 AGAAGCAGGTGCAGGACCACAGG - Intergenic
1077391170 11:2301253-2301275 AGGAGCAATTCCAGCACCGAGGG + Intronic
1077404350 11:2376508-2376530 AGCAGTAAGTGCAGCAGGCCTGG + Intronic
1078317760 11:10306495-10306517 AGGAGCAAGATCAGCCCCCAGGG + Exonic
1084292949 11:68187613-68187635 AAGTGCAAGTGCAGCATTCCAGG - Intronic
1084345172 11:68542198-68542220 AGGAGCAAGGGCCACTCCCCTGG + Intronic
1084720917 11:70905093-70905115 AGGAGCAAGGACAGCCCCACAGG + Intronic
1085579215 11:77635940-77635962 AGGACCAAGTGTAGAACCCTAGG - Intronic
1087871231 11:103295240-103295262 AGGAGCATATACAGCAGCCCGGG - Intronic
1087895161 11:103578466-103578488 AGGAGCAAAGGCAGCACACAGGG - Intergenic
1088707870 11:112480087-112480109 AGGGGCAATTGCAGCAACCATGG - Intergenic
1089019616 11:115199477-115199499 AGGAGCAAGTACAGCAAGCTTGG - Intronic
1089674447 11:120080552-120080574 AGCAGCTAGGGCAGCACCCATGG - Intergenic
1089981766 11:122778518-122778540 AGGAGAGAGTGCAGCATCCCAGG - Intronic
1090352306 11:126115275-126115297 AGGAGCCAGAACACCACCCCTGG + Intergenic
1090729623 11:129558343-129558365 AGGGGGAAGTGCAGCCCACCAGG + Intergenic
1090888991 11:130906180-130906202 GGGAGCAAATGCAGCACTCTAGG + Intronic
1091918166 12:4283878-4283900 GGGAGAAAGTGCAGCCCCACAGG - Intronic
1092405366 12:8218261-8218283 AGGCTCAAGGGCAGCATCCCAGG + Intergenic
1093068661 12:14685790-14685812 AAAAGAAAGTGCAACACCCCAGG - Intronic
1093642028 12:21538869-21538891 TAGAGTAAGTTCAGCACCCCAGG - Intronic
1098796338 12:74893075-74893097 TGAAGCAGGGGCAGCACCCCTGG + Intergenic
1099877006 12:88419921-88419943 AGGATAAAGTGCAGAAACCCTGG - Intergenic
1101377718 12:104185102-104185124 AGGATAAATGGCAGCACCCCTGG - Intergenic
1101789388 12:107913475-107913497 AGGAGGAAGTGCAAGACGCCTGG - Intergenic
1105874261 13:24539607-24539629 AGGAGGAAGTGCAGGCCCCAAGG - Intergenic
1105886113 13:24642975-24642997 AATACCAAGTGAAGCACCCCAGG - Intergenic
1106248869 13:27969129-27969151 AGGAGCCAGCGGAGCACCGCGGG - Exonic
1110260220 13:73476481-73476503 AGGAGCTAATGCAGAACCCATGG + Intergenic
1110286615 13:73756880-73756902 AGGAGCCAGGACAGCACCCAGGG - Intronic
1111268718 13:85853320-85853342 AGGTGCAGCTGCAGCAGCCCAGG + Intergenic
1111664789 13:91253627-91253649 AGGAGGAATTGCAGAACCTCAGG + Intergenic
1112061306 13:95742183-95742205 AGCAGCAAGCCCACCACCCCAGG - Intronic
1112311170 13:98318625-98318647 TGGAGAAAGTGCGGCAGCCCTGG - Intronic
1115087860 14:29539012-29539034 ATGAGAGAGTGCAGCACCCTGGG + Intergenic
1117815531 14:59593734-59593756 AGGACCAAGAGCAGAGCCCCTGG - Intergenic
1117954877 14:61115000-61115022 AGGAGCAAGGGCAGCACACAGGG + Intergenic
1119011339 14:70992811-70992833 AGGATAAAGTGCAGCCCTCCAGG + Intronic
1122272254 14:100573522-100573544 AGGGGCAAGTGCAGGACCCCAGG + Intronic
1122616365 14:103020599-103020621 AGGGGCCAGAGCAGCACCCCAGG + Intronic
1122877905 14:104677313-104677335 AGGAGGAGGGGCCGCACCCCTGG + Intergenic
1122928671 14:104923242-104923264 AGGGGCAAGTGGAGGACCCCAGG - Intergenic
1123977058 15:25563612-25563634 AGCAGCAAGCGCAGCACATCAGG - Intergenic
1123994321 15:25707765-25707787 AGGTGCACGTGCTGCCCCCCAGG - Intronic
1125721550 15:41847466-41847488 AGAGGAAAGTGCAGCACCGCAGG - Exonic
1127692557 15:61412445-61412467 AGGAGGTAGAGCAGCATCCCTGG + Intergenic
1129314558 15:74733482-74733504 AGGAGCAAGTGCAAAGGCCCTGG - Intergenic
1129616658 15:77104270-77104292 AGGAGGAAGAGAACCACCCCTGG - Exonic
1130940303 15:88502608-88502630 GGGAGCATTTGCAGCACCCCAGG - Intergenic
1131639122 15:94270642-94270664 AAGAGCAAGTGCAGAAGGCCAGG - Intronic
1131859894 15:96641286-96641308 TGGAGCAAGTGTACAACCCCTGG - Intergenic
1132061667 15:98697429-98697451 GGGAGTCAGTGCAGCACTCCTGG + Intronic
1132099937 15:99015684-99015706 AGGAGCAAGAGTAGCGCCCTTGG + Intergenic
1132591991 16:730115-730137 AGCAGCAAGGGCAGCACCTGTGG + Exonic
1132759581 16:1502229-1502251 AGCAGCACGGGCGGCACCCCGGG - Intronic
1132843258 16:1988789-1988811 AGGAGAAAGTGCAGCATGTCTGG + Intergenic
1133607880 16:7405980-7406002 AGGATCAATTGCAGCATCTCAGG - Intronic
1136016840 16:27405969-27405991 TGGGGCAAGTGCACCAGCCCGGG + Intronic
1136406343 16:30050019-30050041 AGGAGCACGGGCAGTGCCCCAGG - Intronic
1137028405 16:35500567-35500589 AGGAGCAAGTGCAGTTCCTCTGG - Intergenic
1137769625 16:51005492-51005514 AGGAGCAAGTGCTAAAACCCTGG - Intergenic
1139615427 16:68085651-68085673 AGGAGGAGCTGCAGCACCCTGGG + Exonic
1141905219 16:87020643-87020665 AGATGCAAGTGCTGCATCCCAGG + Intergenic
1142893268 17:2958780-2958802 AGGGGCAAATACAGCACCCACGG + Intronic
1143502589 17:7347851-7347873 AGGAGCAGCAGCAGCTCCCCAGG + Intronic
1144431474 17:15196088-15196110 ATCAGCAAGTGGAGCAGCCCTGG + Intergenic
1144792573 17:17868997-17869019 AGGAGCAGGTGCAGAAGCTCTGG + Intronic
1147361671 17:39934561-39934583 GGGAGCAAGTCTAGCAGCCCAGG - Intergenic
1147924482 17:43938313-43938335 AGCTGCAAGTGCCGCAGCCCAGG + Intergenic
1148151379 17:45398173-45398195 TGGAGCAAGGGCCTCACCCCAGG + Intronic
1148388758 17:47254772-47254794 AGGACCACGGGCAGCAACCCCGG - Intronic
1151517649 17:74606633-74606655 AGCAGCAATTGCAGTTCCCCAGG + Intergenic
1151656746 17:75499735-75499757 AGGAGCAACAGCAGCAGCCTTGG + Exonic
1151871595 17:76840476-76840498 AGCAGCAAATGCAGGAGCCCTGG - Intergenic
1152495630 17:80669300-80669322 TGCAGCAAGGGCAGCACTCCGGG - Intronic
1154126085 18:11693711-11693733 TGGAGCAAGTGCACCTTCCCTGG - Intronic
1157195321 18:45616106-45616128 GGGCACAAGTGGAGCACCCCTGG + Intronic
1157499204 18:48178092-48178114 AAGACCCAGTGCAGTACCCCAGG - Intronic
1158401882 18:57128470-57128492 AGGATCAAGTGCATCAACCTGGG + Intergenic
1158931221 18:62325991-62326013 AGGGTCAAGTCCAGCATCCCCGG - Intronic
1159061160 18:63515349-63515371 AAAAGCAAATTCAGCACCCCTGG - Intergenic
1161053392 19:2177249-2177271 TGGGGCGAGTGCAGCACACCTGG - Intronic
1161155620 19:2730838-2730860 AGGAGCAGGGGCTGAACCCCAGG + Intronic
1161523471 19:4738782-4738804 AAGAGCAAGAGGAGCCCCCCAGG + Intergenic
1161766351 19:6211072-6211094 AGGAGAAAGGCCAGCACCCTGGG + Intergenic
1161967343 19:7555776-7555798 AGGAGGGATTGCTGCACCCCAGG + Intronic
1162833358 19:13300511-13300533 AGGAGCCAGGGTAGCATCCCAGG + Intronic
1164130321 19:22355816-22355838 AGGAGCAAAGGCAGCACACAGGG + Intergenic
1164669920 19:30066718-30066740 AGAAGCAAGTGCAGAGGCCCTGG + Intergenic
1164804022 19:31102384-31102406 AGGAGCAGGTGCGACACCCTTGG - Intergenic
1165155709 19:33786162-33786184 ATGGGCAAGTGCAGCAACTCTGG + Intergenic
1166517692 19:43459846-43459868 AAGACCAACAGCAGCACCCCCGG + Intergenic
1167346091 19:48946588-48946610 AGGAGCAACTGCAGCTGCCCAGG + Intergenic
925201842 2:1973821-1973843 AGCAGCAGATGCAGCTCCCCAGG + Intronic
925912474 2:8582800-8582822 AGGGGCAGGTGCACCAGCCCAGG + Intergenic
926121324 2:10242706-10242728 AGCAGCAAGGGGTGCACCCCAGG - Intergenic
926817785 2:16817312-16817334 AGAAGCAGGTGCGGCACCCAGGG - Intergenic
927140184 2:20124891-20124913 AGGAGCAAGTGGAACAGCCCAGG + Intergenic
927713127 2:25338085-25338107 AGCACCAAGTCCAGGACCCCAGG + Intronic
928021226 2:27706603-27706625 AGGAGCAGGGGCAGCAGCCTGGG - Exonic
929994725 2:46818108-46818130 AGAAACAGGTGCAGCAACCCGGG + Intronic
931058657 2:58501861-58501883 AGAACCAAGTCCAGGACCCCAGG + Intergenic
933718956 2:85384490-85384512 AGGAGCTACTGAAGCACCTCTGG - Intronic
935845410 2:107161082-107161104 AGGAGGTATTGCAGTACCCCAGG - Intergenic
936065954 2:109332340-109332362 AGGAGCAAGTGCAGCACCCCTGG - Intronic
937036895 2:118789485-118789507 AGGAGAATGTGCAGCACCCAAGG - Intergenic
937362687 2:121239864-121239886 TGGAGCAAGTGAAGTACCCAAGG + Intronic
937976724 2:127586947-127586969 AGCACCCAGTGCAGCCCCCCTGG + Intronic
938223063 2:129588073-129588095 AGGGGCACCTGCAGCAGCCCGGG - Intergenic
940161988 2:150723496-150723518 AGCAGCAACTGCAGCACCAGTGG + Intergenic
940911252 2:159211944-159211966 AGGGGCGAGTGCGCCACCCCGGG - Intronic
942512509 2:176717529-176717551 AGGAGCAAGGGCAGCAGGACTGG + Intergenic
943749849 2:191500117-191500139 AGGAGCAGATGCAGAAGCCCAGG - Intergenic
945251781 2:207770211-207770233 AGGAGCGAGTCCTGCACCCAGGG - Intergenic
945622987 2:212165726-212165748 ATGAGCAACTGCACCAGCCCTGG + Intronic
946167533 2:217874086-217874108 AGGAGCAAGTTCACCAGCACTGG + Intronic
946934630 2:224707408-224707430 AAGAGCAAATGCAGAAGCCCTGG - Intergenic
946954977 2:224919887-224919909 TGGAGCAAGTGCAGTGGCCCAGG - Intronic
947984725 2:234438397-234438419 AGGAGGCAGGGCAGCACCCAAGG - Intergenic
948889111 2:240898204-240898226 AGGAGCATGTGGAGTACACCAGG + Intergenic
949007663 2:241658884-241658906 TGGGGCAAGGGCAGGACCCCTGG + Intronic
1168944929 20:1745506-1745528 TGGAGGAAGTGCAGCTGCCCTGG + Intergenic
1171299718 20:24049928-24049950 AAGAGCAGGTGCAGGACACCTGG + Intergenic
1172185391 20:33028218-33028240 AAGAGCAAGAGCAGGACCCAGGG - Intergenic
1172862638 20:38067263-38067285 AAAAGGAAGTGCAGCAGCCCGGG - Intronic
1172950186 20:38718488-38718510 AGGACCACCTGCAGCTCCCCTGG + Intergenic
1174588958 20:51630100-51630122 AGGAGGGTGAGCAGCACCCCTGG - Intronic
1175064258 20:56272152-56272174 AGGTGCCACTGCAGCTCCCCTGG + Intergenic
1175203298 20:57292412-57292434 AGCAGGAAAGGCAGCACCCCAGG + Intergenic
1175216072 20:57392150-57392172 AGGAGCAATGGCTCCACCCCGGG + Intronic
1175411220 20:58770772-58770794 AGGAGCACGGGCTGCACCCCAGG - Intergenic
1175783164 20:61696366-61696388 GGAGGCAGGTGCAGCACCCCTGG + Intronic
1175859941 20:62144416-62144438 AGGAGCAAGAGGGGCAGCCCCGG - Intronic
1175951769 20:62587479-62587501 AGGAGCATGTGGAGCACCCGGGG + Intergenic
1176122745 20:63461553-63461575 AGGACCATGGCCAGCACCCCGGG + Intronic
1179433961 21:41346937-41346959 AGGAGGAAGCCCAGCACCCAAGG + Intronic
1179627604 21:42657517-42657539 AGGAGCAGGTGCTGCAGCCAGGG - Intronic
1179654527 21:42837204-42837226 AGAAGCCAGTGCAGAAGCCCAGG - Intergenic
1180102919 21:45598233-45598255 ATGAGCAAGACCAGCACTCCAGG - Intergenic
1181167600 22:20991942-20991964 AGGAGCAAGGCCAGGACACCTGG + Intronic
1181948996 22:26540893-26540915 AGCAGCTGGTGCTGCACCCCAGG - Exonic
1182066153 22:27433229-27433251 AGGACGAAATGCAGCAGCCCAGG + Intergenic
1182270798 22:29152144-29152166 AGGAGCAAGGGCAGTCCCCTGGG + Intronic
1182395670 22:30034118-30034140 AGGAGGAAGAGCAGCACTACTGG - Intergenic
1183293387 22:37016443-37016465 AGGAGGAACTTCAGCATCCCGGG + Intronic
1183949394 22:41344280-41344302 AGGAGCAAGTTCAGGAGGCCTGG - Intronic
1184233168 22:43169262-43169284 AGGGGCATGTGGGGCACCCCTGG - Intronic
1184245657 22:43234643-43234665 AGGTGCAAAAGCTGCACCCCAGG - Intronic
1184571503 22:45327923-45327945 AGGATCGACTGCAGCACCACAGG - Exonic
1185377054 22:50487509-50487531 AAGGGCAAGTGCTGCTCCCCAGG - Intronic
1185387953 22:50545014-50545036 AGGAGCAGGTGGAGGAGCCCAGG + Intergenic
950365105 3:12477619-12477641 AGGAGCAGGTGCAGGGGCCCTGG - Intergenic
951369649 3:21829666-21829688 AGGAGCAGCTGCAGTAGCCCAGG + Intronic
954266437 3:49473473-49473495 AAGAGGAAATGCAGTACCCCAGG - Intronic
954294380 3:49666014-49666036 AGGAGGAAGTGCATCATCCTGGG + Intronic
954733555 3:52685814-52685836 AGGAGCAATAGCAGCAGCCGTGG - Exonic
956744438 3:72300359-72300381 AGGAGCAAAGGCAGGAACCCAGG + Intergenic
956780217 3:72597630-72597652 AGCAGCAAGTACAGAAGCCCTGG + Intergenic
968568815 4:1328770-1328792 AGGAGCCGGAGCAGGACCCCGGG - Intronic
969219735 4:5751934-5751956 GAGATCAAGTCCAGCACCCCAGG - Intronic
969373848 4:6750329-6750351 AGGAGTAAGTGAACCACTCCTGG - Intergenic
969696306 4:8737072-8737094 AGAAACAACTGCAGCAGCCCGGG + Intergenic
969760751 4:9179710-9179732 AGGCTCAAGGGCAGCATCCCAGG - Intergenic
969864716 4:10067244-10067266 AGAAGCAGGTGCAGGACCCCAGG + Intergenic
969992699 4:11280345-11280367 AGGAGCAAGTGAAGCTCCTATGG - Intergenic
976764778 4:88588831-88588853 AGGTAGAAGTGCAGCAGCCCTGG + Intronic
978234157 4:106437742-106437764 AACAGAAAGTGCTGCACCCCAGG + Intergenic
979649792 4:123115517-123115539 GTGCGCAACTGCAGCACCCCTGG + Intronic
980740963 4:136949391-136949413 AGGAGCAATGGCAGCACCAGTGG + Intergenic
983646167 4:169993654-169993676 AGGAGGAACTGTAGAACCCCGGG - Intronic
985902615 5:2808481-2808503 AGGAGCGAGGGAACCACCCCAGG + Intergenic
986780555 5:11061522-11061544 AGCAGCAAGAGCAAAACCCCTGG - Intronic
987283559 5:16435347-16435369 ATGAGCAAGTGCAGTAGCCATGG - Intergenic
987288816 5:16488378-16488400 GGGAGCAGGGGCAGCAACCCAGG + Intronic
989758578 5:44986061-44986083 AGGAACACGTGGCGCACCCCAGG + Intergenic
990879446 5:60522929-60522951 AGGAGAAAGTGCACTAGCCCGGG + Intergenic
995476332 5:112552198-112552220 AAGAGCAAGTGCAGCAGCCCTGG + Intergenic
996603420 5:125292990-125293012 AGGGGGTGGTGCAGCACCCCGGG + Intergenic
997355800 5:133262189-133262211 TGGAACAACTGCAGCTCCCCTGG + Intronic
997377278 5:133406206-133406228 AGGAGAGAGTGGAGCACCCTTGG + Intronic
1002197711 5:177510164-177510186 AGGAGCCTGGGCTGCACCCCAGG - Intronic
1002783646 6:385071-385093 ATGTGGAGGTGCAGCACCCCTGG + Intergenic
1003300892 6:4882118-4882140 GGGAGCAAGCGCAGTACCCAGGG - Intronic
1006238849 6:32660231-32660253 AGGAGTCAGTGCAGAAGCCCTGG + Exonic
1007246013 6:40463343-40463365 AGGAGCTATTGCAGCAGTCCAGG - Intronic
1007596090 6:43052289-43052311 ATGAGCAAGTCCAGGACCCTTGG + Exonic
1008563047 6:52740559-52740581 AGCAGCAGGTGCCGGACCCCTGG - Intergenic
1012310595 6:97719763-97719785 AGGAATAAGTGCAACAACCCAGG - Intergenic
1015257806 6:131199712-131199734 AGGAGCATCCTCAGCACCCCTGG - Intronic
1015592465 6:134835278-134835300 AGGAACAAGAGCAGGACCCCTGG + Intergenic
1016473309 6:144398151-144398173 AAGAGCAGGTACACCACCCCAGG - Intronic
1018818489 6:167354287-167354309 AGGAGCTAGTGCAGCCTGCCAGG + Intronic
1018865775 6:167746139-167746161 AGGAGCAGCTCCAGCAGCCCAGG + Intergenic
1018928297 6:168222397-168222419 AGGAGCAGGTGCAGCCACCACGG - Intergenic
1019196339 6:170285340-170285362 AAGAGCAAGTGTAGCTCCCCTGG + Exonic
1019399653 7:844911-844933 CGGCTCACGTGCAGCACCCCCGG - Intronic
1019956831 7:4422294-4422316 ATGAGAAAGGGCAGCACTCCAGG - Intergenic
1022511461 7:30937351-30937373 AGGAGAAAGTGAAGTACCCAGGG - Intergenic
1023352340 7:39333127-39333149 CTGAGCAGGTGCAGCTCCCCTGG + Intronic
1024944057 7:54791245-54791267 ACAGGCAAGAGCAGCACCCCTGG + Intergenic
1025000839 7:55313294-55313316 GAGAGAAATTGCAGCACCCCTGG - Intergenic
1027180990 7:75939148-75939170 AGGAGCACCTGCTGCACTCCAGG - Intronic
1028472521 7:91220473-91220495 AGAAGTGAGTGCAGCACTCCAGG + Intergenic
1029283784 7:99452770-99452792 AGGAGCAAGAGCAGCAGACACGG - Intronic
1030060261 7:105615936-105615958 AGTAGCAGCAGCAGCACCCCAGG - Intronic
1030560860 7:111084125-111084147 AGGAGAAATTGCAGCAGCCAAGG + Intronic
1034351119 7:150415327-150415349 AGGAGCAGGAGCAGCGTCCCAGG - Intergenic
1036270860 8:7301561-7301583 AGGCTCAAGGGCAGCATCCCAGG - Intergenic
1036350490 8:8008783-8008805 AGGCTCAAGGGCAGCATCCCAGG + Intergenic
1036845755 8:12169208-12169230 AGGCTCAAGGGCAGCATCCCAGG + Intergenic
1036867121 8:12411527-12411549 AGGCTCAAGGGCAGCATCCCAGG + Intergenic
1039646424 8:39289621-39289643 TGGAGCAACAGCAGCAGCCCAGG - Intergenic
1040412366 8:47167424-47167446 AGGAGAAAGTGAAGCACTCCAGG - Intergenic
1040617166 8:49048282-49048304 AGAAACAGGTGCAGCACTCCTGG + Intergenic
1040989635 8:53335952-53335974 ATGAGCAAGTGCAGGAGCACAGG - Intergenic
1041091948 8:54310242-54310264 AGGAGGAAGTCCATCAGCCCAGG + Intergenic
1043867775 8:85395211-85395233 AGGAGAAAGGACAGCCCCCCTGG - Intronic
1044475375 8:92619152-92619174 AGGAGCAAGAGCAGGACAGCAGG - Intergenic
1044923863 8:97193071-97193093 TGGAGCAAGTGCAGCATGGCTGG - Intergenic
1045857584 8:106781902-106781924 AGGAGCAAGGGCAGCAAGTCTGG - Intergenic
1047387779 8:124425833-124425855 TGGGGCAAGGGCAGCTCCCCAGG - Intergenic
1047785361 8:128149071-128149093 AGGAGGAAGTGCTGCTCTCCTGG + Intergenic
1049022241 8:139965365-139965387 GGGAGCTGCTGCAGCACCCCAGG - Intronic
1049331809 8:142058614-142058636 AGGAGCAAGTGCAGAGGCCTGGG - Intergenic
1049382711 8:142325443-142325465 AGGAGACAGTGCAGGAGCCCAGG + Intronic
1049594788 8:143478298-143478320 GGGAGCAAGTGCTGCAGCCCGGG - Intronic
1049811926 8:144579509-144579531 AGGAGCCACTGGAGCACACCGGG - Intronic
1050591471 9:7164603-7164625 AGGAGCACCTGCAGCACGGCGGG - Intergenic
1052084020 9:24241589-24241611 AGCAGCAAGTGCGAAACCCCTGG + Intergenic
1053933178 9:43127202-43127224 AGGAGCAGGAGCAGCACTCGAGG - Intergenic
1055675639 9:78657563-78657585 TGGAGTAGGTGCTGCACCCCAGG + Intergenic
1055761984 9:79618763-79618785 ATGTGCAAGTGCAGGCCCCCAGG - Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1060520741 9:124292575-124292597 AGGACCAAGTGGAACAGCCCCGG - Intronic
1060728882 9:126024770-126024792 AGGAGCAGCTGAGGCACCCCTGG - Intergenic
1062159658 9:135073345-135073367 TGGGGCACGCGCAGCACCCCAGG - Intergenic
1062613400 9:137385276-137385298 CGGAGCAAGTGCATCAGCCCCGG + Intronic
1062653765 9:137591308-137591330 AGGAGCCTGTGCAGCTCCTCAGG - Intergenic
1190626428 X:52342617-52342639 AACAGCAAGTGCAACAGCCCTGG + Intergenic
1190701578 X:52993221-52993243 AACAGCAAGTGCAACAGCCCTGG - Intronic
1192564119 X:72148788-72148810 AGCAGCAACAGCAGCATCCCTGG + Intergenic
1193286819 X:79723734-79723756 AGGAGCCACTGCAGTTCCCCAGG + Intergenic
1195460361 X:105116562-105116584 AGAAGCAAGTCCAGGACCCAAGG + Intronic
1195916756 X:109943571-109943593 GGGAGGACGTGCAGCACTCCAGG + Intergenic
1196692204 X:118571910-118571932 AGTAGCAAGTGCAAAAGCCCCGG + Intronic
1199533076 X:148871377-148871399 AGGAGAAACTGCTGCAACCCAGG + Intronic
1199533299 X:148873346-148873368 AGGAGAAACTGCTGCAACCCAGG + Intronic
1200209691 X:154341734-154341756 GGGCGCAAGTGAAGCGCCCCGGG - Intergenic
1200221161 X:154390358-154390380 GGGCGCAAGTGAAGCGCCCCGGG + Intronic