ID: 936068474

View in Genome Browser
Species Human (GRCh38)
Location 2:109349676-109349698
Sequence TCCTCCTGTGAGGCCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 316}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936068474_936068487 28 Left 936068474 2:109349676-109349698 CCTCCAGGGGCCTCACAGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 316
Right 936068487 2:109349727-109349749 AACGGGCTGTCGCAGGGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 126
936068474_936068485 21 Left 936068474 2:109349676-109349698 CCTCCAGGGGCCTCACAGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 316
Right 936068485 2:109349720-109349742 CACTGTGAACGGGCTGTCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 53
936068474_936068479 -8 Left 936068474 2:109349676-109349698 CCTCCAGGGGCCTCACAGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 316
Right 936068479 2:109349691-109349713 CAGGAGGAGGCTCTCCACTCGGG 0: 1
1: 0
2: 1
3: 11
4: 203
936068474_936068481 10 Left 936068474 2:109349676-109349698 CCTCCAGGGGCCTCACAGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 316
Right 936068481 2:109349709-109349731 TCGGGAGAACCCACTGTGAACGG 0: 1
1: 0
2: 1
3: 7
4: 98
936068474_936068486 22 Left 936068474 2:109349676-109349698 CCTCCAGGGGCCTCACAGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 316
Right 936068486 2:109349721-109349743 ACTGTGAACGGGCTGTCGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 31
936068474_936068482 11 Left 936068474 2:109349676-109349698 CCTCCAGGGGCCTCACAGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 316
Right 936068482 2:109349710-109349732 CGGGAGAACCCACTGTGAACGGG 0: 1
1: 0
2: 0
3: 8
4: 92
936068474_936068478 -9 Left 936068474 2:109349676-109349698 CCTCCAGGGGCCTCACAGGAGGA 0: 1
1: 0
2: 2
3: 22
4: 316
Right 936068478 2:109349690-109349712 ACAGGAGGAGGCTCTCCACTCGG 0: 1
1: 1
2: 0
3: 43
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936068474 Original CRISPR TCCTCCTGTGAGGCCCCTGG AGG (reversed) Intronic
900010884 1:107008-107030 ATCTAATGTGAGGCCCCTGGAGG - Intergenic
900014720 1:140076-140098 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
900026986 1:283572-283594 ATCTAATGTGAGGCCCCTGGAGG - Intergenic
900044587 1:495278-495300 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
900044986 1:498685-498707 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
900065990 1:730184-730206 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
900066389 1:733593-733615 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
900066785 1:736999-737021 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
900067183 1:740415-740437 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
900155267 1:1201292-1201314 TCCCCCACTGAGACCCCTGGAGG + Intergenic
900371708 1:2335197-2335219 CCCTGCAGTGAGGCCCCTCGTGG - Intronic
900390759 1:2432846-2432868 TGCCCCTGGGAGGCGCCTGGAGG + Intronic
900700607 1:4046582-4046604 ACTTCCTGTGAGGACACTGGCGG + Intergenic
901685584 1:10941790-10941812 TCCTTCTGAGGGGCCTCTGGAGG - Intergenic
902956450 1:19927329-19927351 TCCTCCTCAGAGGCCTCTAGTGG + Intergenic
903298118 1:22358878-22358900 TTCTGCTGTGATGGCCCTGGTGG + Intergenic
903664505 1:24998026-24998048 TCCTCCTCTCAAGCCCCTGCTGG - Intergenic
904377421 1:30090533-30090555 GCTTCCAGAGAGGCCCCTGGGGG + Intergenic
904697130 1:32336836-32336858 TCCTCCTTTCAGTCCCTTGGTGG + Intergenic
904954406 1:34271052-34271074 TGCTCCTGTGATGTCACTGGAGG + Intergenic
905366408 1:37453993-37454015 GCCTCTTGAGAGGCTCCTGGTGG - Intergenic
906815307 1:48872838-48872860 CCTTCCTGTTAGGCCCCTGGGGG - Intronic
907136334 1:52142445-52142467 GCCGCCTGTGGGGGCCCTGGCGG + Intronic
911235645 1:95409261-95409283 TTCTCCTGTCAGGCCACAGGAGG - Intergenic
912465663 1:109871712-109871734 TAGTCCTGTGAGACCCCTGTTGG + Intergenic
912547464 1:110461229-110461251 TCCCCTTCTGAGGCCCCAGGAGG + Intergenic
912704108 1:111899253-111899275 TCCTCATGAGAAGCCCCTGGGGG - Intronic
913206590 1:116544865-116544887 TCCACACGTGAGGCTCCTGGAGG - Intronic
913333115 1:117683640-117683662 TCCACCTGGCAGGCCCCTCGGGG + Intergenic
915512703 1:156395125-156395147 TCATCCTGAGAGGCTCCTGAAGG + Intergenic
916570739 1:166025097-166025119 TGCTTCTTTGAGGCACCTGGGGG + Intergenic
916728303 1:167543535-167543557 AACGCCTGTGAGGCCCCTGTGGG + Intronic
917117635 1:171618498-171618520 TCTTCCTGTAAGGCCCATGAGGG + Intergenic
917734358 1:177907085-177907107 TCTTCCTGTGAGAACCCAGGTGG + Intergenic
918082080 1:181215440-181215462 TCCTCATTTGAGGCCCCTAGTGG - Intergenic
919800947 1:201354325-201354347 TCCTCCTGTCAGGTCCCAGGTGG + Intergenic
919808487 1:201394953-201394975 TCCTCCTGTGGGGCCCTGGATGG + Intronic
920106701 1:203558363-203558385 TCGACCTCTCAGGCCCCTGGAGG - Intergenic
921228557 1:213045574-213045596 TCCTCCTCAGAGGCCTCTTGCGG + Intergenic
922199393 1:223389267-223389289 TCTTCCTTTGAGGGTCCTGGTGG - Intergenic
922259330 1:223923015-223923037 ATCTAATGTGAGGCCCCTGGAGG - Intergenic
922262214 1:223952669-223952691 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
922767810 1:228165249-228165271 TGCTCCTGTGAGGTCCCTAGAGG + Intergenic
922888122 1:229036246-229036268 CCCTCCTCTGATTCCCCTGGGGG + Intergenic
922929663 1:229378977-229378999 TACTGCTGTGTGGCCACTGGAGG - Intergenic
923087697 1:230713898-230713920 TCCTCCTGTAAGACCCCAGGTGG + Intronic
924340510 1:243025761-243025783 ATCTAATGTGAGGCCCCTGGAGG - Intergenic
924344039 1:243057650-243057672 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
1062768273 10:81476-81498 TCCTTCTGTGGGGCCACAGGAGG + Intergenic
1063036409 10:2290616-2290638 TCCTCCTGTGTGGCCCAGGATGG + Intergenic
1063036440 10:2290754-2290776 TCCTCCTGTGTGGCCCAGGTGGG + Intergenic
1063036475 10:2290890-2290912 TCCTCCTGTGTGGCCCAGGATGG + Intergenic
1063036508 10:2291028-2291050 TCCTCCTGTGTGGCCCAGGATGG + Intergenic
1063087173 10:2830483-2830505 TCCAGCTCTGAGGGCCCTGGTGG + Intergenic
1064430053 10:15262957-15262979 TCCTCCCAGGAGGGCCCTGGTGG - Intronic
1066654426 10:37685237-37685259 TCCTCCTCAGAGGCCTCTTGTGG - Intergenic
1066735988 10:38479838-38479860 ATCTAATGTGAGGCCCCTGGAGG + Intergenic
1069558712 10:69414929-69414951 TCCTCCTGTAAGGCCTCTGGGGG - Exonic
1069870860 10:71532104-71532126 TCCCCATCTTAGGCCCCTGGAGG - Intronic
1070118648 10:73553698-73553720 TTTTCCTGTGAGGTCCCTGATGG + Intronic
1070545902 10:77452251-77452273 TCCTCATGTGAGACCCCAGATGG + Intronic
1070794158 10:79207308-79207330 TCCTCCTGAAGGACCCCTGGAGG - Intronic
1070852437 10:79576826-79576848 TCATCCTGTCTGGCCCCTGGAGG - Intergenic
1071646012 10:87361174-87361196 TCCTCATGTGAGTGTCCTGGGGG + Exonic
1071939385 10:90572161-90572183 TCTTTCTCTGAGACCCCTGGTGG + Intergenic
1073588196 10:104731179-104731201 CCTTCTTGTGAGGACCCTGGAGG + Intronic
1074869027 10:117562615-117562637 TCCTCCTGTGAGCCCCTGAGAGG + Intergenic
1076774229 10:132685371-132685393 TGCCCATGTGAGGCCCCAGGTGG - Intronic
1076970918 11:131753-131775 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
1076971314 11:135176-135198 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
1077162639 11:1120741-1120763 TTCTCCTGGGAGGCCCCTCTTGG + Intergenic
1081508855 11:43747495-43747517 TCCTCCTCAGAGGCCTCTTGTGG - Intronic
1081768168 11:45627234-45627256 TGCTCCTGTTGGGCTCCTGGGGG - Intergenic
1081783113 11:45727261-45727283 TCTACCTGTGAGGCCCCTGCTGG + Intergenic
1083397237 11:62400235-62400257 TCCCCCTGTGAGGACCTTTGAGG - Intergenic
1083651733 11:64208196-64208218 TCCTCCTGTGCTGCACATGGTGG - Intronic
1083721792 11:64607142-64607164 CCCTCCTGGGAGGGCCCGGGAGG - Exonic
1084028956 11:66469651-66469673 CCCTCCTGTCAGCCCCCTTGGGG + Intronic
1084029621 11:66473685-66473707 GCCTGCTGGGGGGCCCCTGGGGG + Intronic
1089012724 11:115143905-115143927 CCCCCCTCTCAGGCCCCTGGTGG + Intergenic
1089151125 11:116365155-116365177 TCCTCCTGTGAGATCAGTGGCGG + Intergenic
1089363010 11:117903587-117903609 TCCTCAGGTGGGGACCCTGGAGG - Intronic
1089384690 11:118060033-118060055 CCCACCTGTGAGGGCCCAGGAGG + Intergenic
1090343476 11:126046836-126046858 TCTTTCTGTGAGGCACCTTGAGG + Intronic
1096677100 12:53231907-53231929 TCCTCCGGCGAGGCGGCTGGGGG - Intronic
1098062304 12:66575815-66575837 TTCTCCTTTGAAGCCACTGGAGG - Intronic
1101345291 12:103880589-103880611 ACTTGCTGAGAGGCCCCTGGGGG + Intergenic
1103021082 12:117534772-117534794 TCCTCTTCTGAGGACCCTTGTGG - Intronic
1103210093 12:119159241-119159263 TACCCCTGTGAGGTTCCTGGGGG - Exonic
1104359737 12:128121365-128121387 TCCACCTGTGAGGAGCCTGTTGG - Intergenic
1104475916 12:129070076-129070098 GCCACCTGCGGGGCCCCTGGAGG - Intergenic
1104976759 12:132555620-132555642 TCCTCCTCTGGGGCCTCTGGAGG - Intronic
1105039286 12:132949088-132949110 TCCTCCTCAGAGGCCTCTTGTGG - Intronic
1107148954 13:37090298-37090320 TCCTCCTCAGAGGCCTCTTGTGG - Intergenic
1108681902 13:52787742-52787764 ATTTCCTGTGAGGCCCCAGGGGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114538163 14:23436056-23436078 CCCTGCTGCGAGGCCCCTGATGG + Intergenic
1115509745 14:34127890-34127912 GCCTTCTGTGAGGTCCCAGGGGG - Intronic
1117313995 14:54556284-54556306 TCCTCCTTTGATGCTCTTGGAGG + Intergenic
1119035984 14:71231072-71231094 TGCCCCTGGGAGCCCCCTGGAGG + Intergenic
1119222459 14:72920209-72920231 TGCTCCTTTGAGCCTCCTGGTGG - Intergenic
1119816125 14:77569658-77569680 TCATCCTGAAAGGCCCCTTGAGG - Intronic
1120036747 14:79706519-79706541 TCCTCCTCAGAGGCCTCTTGTGG - Intronic
1120062078 14:79995786-79995808 TGCTCCACTGAAGCCCCTGGGGG + Intergenic
1121788356 14:96680007-96680029 TCCACTTGTCAGGCCCCTGTGGG - Intergenic
1122323564 14:100869353-100869375 TCCTGCTGTGTGGAGCCTGGAGG + Intergenic
1122323751 14:100870395-100870417 TCCTGCTGTGTGGAGCCTGGAGG + Intergenic
1122375373 14:101253528-101253550 TCCACCTCTGAGGCACCAGGCGG + Intergenic
1122828882 14:104385943-104385965 GCCTCCTGTCAGGCTCCCGGAGG + Intergenic
1124254399 15:28129311-28129333 TCGTCCTGTGTGGCTCCTGTGGG - Intronic
1125182948 15:36897973-36897995 GCCTCCTGTGAGCACTCTGGTGG + Intronic
1128315261 15:66655717-66655739 ACCTCCAGTGAGGCCTGTGGGGG + Intronic
1128457331 15:67839000-67839022 TCCTCCTGCGGCGCGCCTGGAGG + Intergenic
1131131548 15:89903724-89903746 TGTTCCTGTGTGGCCCATGGGGG - Intronic
1132322107 15:100933085-100933107 GCCTCCTGGGAGGCTCCTGCAGG + Intronic
1132457173 16:30607-30629 TCCTTCTGTGGGGCCACAGGAGG + Intergenic
1132846638 16:2003853-2003875 TCCTCCTAGGAGGCCCCAGCAGG + Intronic
1133806268 16:9127924-9127946 TTGTCCTGGGAGGTCCCTGGTGG + Intergenic
1134330009 16:13241970-13241992 TCCTCTAGTGAGCCACCTGGTGG + Intergenic
1136545114 16:30950141-30950163 ACTTCCTGTGAGGCCACTGCTGG - Intronic
1137582302 16:49640810-49640832 CCGTCATGTGAGGCCCCCGGGGG - Intronic
1138022287 16:53495559-53495581 TCTTACTGTGGGGCCCCTGCTGG - Intronic
1138418834 16:56886471-56886493 TCATCGTGAGTGGCCCCTGGAGG + Exonic
1138894745 16:61189813-61189835 GCCTCTTCTGATGCCCCTGGAGG - Intergenic
1142038082 16:87874790-87874812 CTCTCCTGTGAGTCCCCTGCCGG + Intergenic
1142420576 16:89967104-89967126 TCCTCTCCTGAGGCCCCTCGTGG - Exonic
1142448939 16:90162346-90162368 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
1142449340 16:90165765-90165787 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
1142453463 16:90199908-90199930 ATCTAATGTGAGGCCCCTGGAGG + Intergenic
1142457756 17:66116-66138 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
1142458157 17:69536-69558 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
1142458551 17:72943-72965 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
1142514655 17:419569-419591 TCTTCCTGTGGGGCCCATGGTGG - Intronic
1145166267 17:20615151-20615173 TCCTCTCCTGAGGCCCCTCGTGG - Intergenic
1145385714 17:22410326-22410348 CCCTCCTGTTATGCCCGTGGCGG + Intergenic
1145822742 17:27852257-27852279 TACTTCTGTGAGTTCCCTGGAGG + Intronic
1146395498 17:32461908-32461930 TCCTCATTGGAGCCCCCTGGTGG - Intronic
1146461130 17:33046838-33046860 TCCACCAGGGAGGCCGCTGGAGG + Intronic
1146726244 17:35158648-35158670 TCCTTCTGTGAGGCTCCAGAGGG - Intronic
1146790455 17:35747833-35747855 TCCCTCTGTGAGTCCCCTGAGGG - Exonic
1147141185 17:38461426-38461448 TGCTCCCCAGAGGCCCCTGGTGG + Intronic
1147947140 17:44086619-44086641 TCCTCCCCTGCTGCCCCTGGGGG - Exonic
1148647354 17:49226613-49226635 TCATCCTAGGAGACCCCTGGAGG + Intronic
1148703611 17:49608327-49608349 TCTTCCTGTGCAGTCCCTGGAGG - Intronic
1149389659 17:56176091-56176113 CCCTGCTGTGAGTCCACTGGGGG + Intronic
1149555175 17:57568507-57568529 TCCTGCTGTGAGGCCCTTTGGGG - Intronic
1149658508 17:58322822-58322844 TCCCCCTGTGAGGGTGCTGGTGG - Intronic
1150777789 17:68095631-68095653 TCCTGACGTGAGGTCCCTGGCGG + Intergenic
1151429338 17:74051840-74051862 TCCACCGCAGAGGCCCCTGGGGG + Intergenic
1152540433 17:80971859-80971881 TCCTCCCTGGAGGGCCCTGGGGG - Intergenic
1152565329 17:81097788-81097810 CCCTCCTGGGAGGCCGCAGGAGG - Intronic
1152925852 17:83087452-83087474 GCCTCTCGTGAGGGCCCTGGAGG - Intronic
1152961159 18:81331-81353 TCCTTCTGTGGGGCCACAGGCGG + Intergenic
1152992857 18:378569-378591 TCCTCCTGATAAGGCCCTGGAGG - Intronic
1154957926 18:21277293-21277315 GCCTCCTGTGAGGCTCGTGCAGG + Intronic
1156513640 18:37661768-37661790 TCAACCTGTGCTGCCCCTGGGGG - Intergenic
1157105617 18:44771776-44771798 TCCTGCTCACAGGCCCCTGGAGG + Intronic
1158222772 18:55167297-55167319 TCATCCAGTGAGCCCCCTGCTGG - Intergenic
1160647869 19:202042-202064 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
1160648267 19:205456-205478 TCCTGCTGTGTGGCTCCTTGCGG + Intergenic
1161027926 19:2045229-2045251 TCATGCTGTGTGGCCTCTGGGGG - Intronic
1162546674 19:11335114-11335136 TCCAACTGTGAGACACCTGGGGG + Intronic
1163613471 19:18312519-18312541 TCCTCCCATGAGGCCCAGGGAGG + Intronic
1163662640 19:18588010-18588032 TCCTCCGGCTGGGCCCCTGGAGG + Intronic
1163677390 19:18662182-18662204 GCCTCCTGTAAAGCCCTTGGAGG - Intronic
1163826388 19:19527087-19527109 CCCTCCTCTCAGGCTCCTGGTGG + Intronic
1165032223 19:33006390-33006412 TCCTCCTGTGTGGCCCAGGCTGG + Intronic
1165375687 19:35440067-35440089 TCCTCTGGTGAGGCCTCTGCAGG + Intergenic
1165556483 19:36636996-36637018 TCCTCCTCAGAGGCCTCTTGTGG + Intergenic
1166312158 19:41969125-41969147 TCCTCCTCCCTGGCCCCTGGTGG - Intronic
1166424781 19:42668017-42668039 TCCTCCTCAGAGGCCTCTTGTGG + Intronic
1166619513 19:44283672-44283694 TCCTCCTCAGAGGCCTCTTGTGG + Intronic
1167118288 19:47500949-47500971 TCCTGCGCTGAGGCTCCTGGTGG + Intronic
1167781754 19:51602854-51602876 TCTTTCTGTAAGGACCCTGGAGG - Intergenic
1167881938 19:52466403-52466425 TCCTCCTCAGAGGCCTCTTGTGG + Intronic
1168490103 19:56802109-56802131 TGCCTCTGTGAGGCACCTGGTGG - Intronic
925412419 2:3647600-3647622 TCCTCTCCTGATGCCCCTGGGGG + Intergenic
925412430 2:3647634-3647656 TCCTCTCCTGATGCCCCTGGGGG + Intergenic
925412441 2:3647668-3647690 TCCTCTCCTGATGCCCCTGGGGG + Intergenic
925412450 2:3647702-3647724 TCCTCTCCTGATGCCCCTGGGGG + Intergenic
928457074 2:31432028-31432050 TCCTCCTGTGAGGCCTGTCTTGG + Intergenic
932436272 2:71704130-71704152 TCCACCTGTGAGGCCAGAGGCGG + Intergenic
933718943 2:85384423-85384445 TCCTCCTCTTGGGCCCGTGGAGG - Intronic
933835909 2:86245272-86245294 TCCTCCTTAGAGGCCTCTTGTGG - Intronic
934557414 2:95294785-95294807 TCCGCCTCTGAGGCCCATGTGGG + Intergenic
934981884 2:98849683-98849705 TCCTTGTGTGAGTCCACTGGTGG - Intronic
936068474 2:109349676-109349698 TCCTCCTGTGAGGCCCCTGGAGG - Intronic
937286958 2:120759993-120760015 TCCTCAGGTGAGAGCCCTGGGGG + Intronic
937909555 2:127068820-127068842 TCCTCCTGCCTGGCCCCAGGTGG - Intronic
938249086 2:129799679-129799701 TCCTCCCTTGAGGCCCTTGCAGG - Intergenic
939859140 2:147396852-147396874 CCCTCCTGGGAAGCCCCTGGAGG - Intergenic
940226737 2:151408933-151408955 TTCTTCTGTTAGGCCCCTGGGGG - Intergenic
942572322 2:177326845-177326867 TCCTCCTGAGTTCCCCCTGGAGG - Intronic
943007221 2:182400562-182400584 TGCTCCTGAGAGTCCTCTGGAGG - Intronic
945425047 2:209690764-209690786 TTCTCATGTGGGGCCCCTGCTGG - Intronic
946833026 2:223744466-223744488 TCCTCCTGTGACACCACTGAAGG - Intergenic
947429187 2:230010755-230010777 TCCTGACGTGAGGGCCCTGGCGG + Exonic
948380215 2:237545311-237545333 TCCTGCTGTCAGGCCCACGGTGG - Intronic
948822322 2:240556268-240556290 TCCTCCTCAGAGGCCTCTTGTGG - Intronic
948846080 2:240683389-240683411 TCCGCCTGGGAGGCCCCTCATGG + Intergenic
948847776 2:240691340-240691362 TCCGCCTGGGAGGCCCCTCATGG - Intergenic
949084905 2:242144559-242144581 ATCTAATGTGAGGCCCCTGGAGG + Intergenic
1170154718 20:13258806-13258828 TCCTCCTGTGAGGGTCCTTATGG - Intronic
1170906468 20:20519446-20519468 TCCTTTTGTGAGGCCCTTAGTGG - Intronic
1172450811 20:35021317-35021339 TTCTCCTCAGAAGCCCCTGGAGG + Exonic
1172592661 20:36128479-36128501 TCCTCATTTGAGGTCCCTGGAGG - Intronic
1173952304 20:47002964-47002986 ACCTGCTGTGAGGCCTCAGGTGG + Intronic
1174452106 20:50626626-50626648 TCCTCCTGCCAGGCCTGTGGGGG - Intronic
1175481897 20:59317854-59317876 GCCTTGTGTGAGGCCCATGGTGG + Intronic
1175984703 20:62758876-62758898 TCGTCCTGTGAGGCTCCTCTGGG - Intronic
1176113799 20:63422451-63422473 TCCTCCTGGGACGCCTGTGGTGG - Intronic
1178301496 21:31457176-31457198 TCCTCCTCTGAGCTCCCTGCCGG - Intronic
1179279885 21:39925231-39925253 GCCTCCTTGGAGGCCCCTTGAGG + Intronic
1179780656 21:43698592-43698614 TCCTCCTCAGAGGCCTCTTGTGG - Intergenic
1179787597 21:43738520-43738542 TCCTCCTCAGAGGCCTCTTGTGG - Intronic
1179890300 21:44331778-44331800 TCCCCGTGGGAGGACCCTGGGGG + Intronic
1181052886 22:20246075-20246097 TCCTCCGGGGAGGTCCCAGGAGG - Intronic
1181165563 22:20981175-20981197 CCCTCCTGGGAGGCCTCTGCTGG + Exonic
1182524580 22:30907253-30907275 TCATCCTAGGAGGCCCCTAGGGG + Exonic
1182889179 22:33802508-33802530 TCCTCCTGTGAGTTCCCCGAAGG - Intronic
1184506824 22:44908673-44908695 TCCTCCTGTGACGTTTCTGGGGG + Intronic
1184796546 22:46736596-46736618 TCCTTGTGTGTGGGCCCTGGTGG + Intronic
1184808276 22:46810896-46810918 TCCTCATGTGAGTTCTCTGGGGG + Intronic
1185181268 22:49364719-49364741 TCCTCCCTTGGAGCCCCTGGGGG + Intergenic
950083297 3:10238997-10239019 TCCTCCTCTGAGGCCTGTGTTGG + Exonic
950211341 3:11125857-11125879 TGATACTGTGCGGCCCCTGGAGG - Intergenic
950469820 3:13177613-13177635 TCTTTTTGTGTGGCCCCTGGGGG + Intergenic
950630136 3:14276743-14276765 TCTTCCTGGGAGGCCCCAGCAGG + Intergenic
952032791 3:29164404-29164426 TCCTACTGTGAAGCTTCTGGAGG + Intergenic
953350267 3:42210072-42210094 TCCTCCTCCGTGGCCGCTGGCGG - Intronic
954258831 3:49424365-49424387 TCTTCCTGTGTGTCCCCTAGTGG - Exonic
954795261 3:53158151-53158173 TCCTTCTGTGGGCCTCCTGGAGG - Intronic
954806626 3:53224459-53224481 TCCTCTTTTGAGGGCCCTAGGGG + Intergenic
957761457 3:84562897-84562919 TCCTGCTGTGAGAATCCTGGAGG - Intergenic
960405360 3:117253042-117253064 TCCTTCTCTGAAGCCCCTTGAGG + Intergenic
962030215 3:131591599-131591621 TGCTGCTGAGAGGCCCCTGATGG - Intronic
962351494 3:134659795-134659817 TCCTCCCGCCAGGCCCCTGGGGG - Intronic
962969021 3:140381706-140381728 TCCACCTGGGAGGTCCCTGCTGG - Intronic
963752558 3:149197911-149197933 TCCTGCTGTGTGGCCCATGGGGG + Intronic
963849846 3:150200355-150200377 TCCTCATGGGAGGCTCCTGTGGG + Intergenic
964045741 3:152324080-152324102 TCCTCTTGTGTTGCCCCTTGAGG + Intronic
967451782 3:189632543-189632565 TCTTCCTGTGAGGTTTCTGGTGG + Intronic
968369579 3:198214659-198214681 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
968369978 3:198218073-198218095 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
968471935 4:786428-786450 TCCTCCGCGGAGGCCCCTGAGGG - Exonic
968639989 4:1709328-1709350 TCCTCCTCAGAGGCCTCTTGTGG - Intronic
968791131 4:2663187-2663209 TCTTCCTTCGGGGCCCCTGGGGG - Exonic
968947665 4:3674073-3674095 TCCTCCTGTGAGGAGCCTTACGG + Intergenic
969095214 4:4727732-4727754 TCCTTCTCTGAGGCCAGTGGAGG + Intergenic
969159035 4:5239215-5239237 TCATTCTGGGAGGCCACTGGAGG + Intronic
969345101 4:6564977-6564999 GGCTCCTGGGAGGACCCTGGAGG - Intergenic
969364909 4:6688765-6688787 TCCTGCTCTGAGGCCCCAGAAGG + Intergenic
969647700 4:8442188-8442210 TCCTCCTCAGAGGCCTCTTGTGG + Intronic
972957978 4:44415890-44415912 TCCACCTGACAGTCCCCTGGTGG - Intronic
973037640 4:45426147-45426169 ACCTCCTGTCAGACCACTGGTGG - Intergenic
974703912 4:65487068-65487090 GCTTCTTGTGAGGCCCCAGGAGG - Intronic
978749657 4:112232211-112232233 TCCTCCTCTTCGGCCCCCGGCGG + Intronic
979262340 4:118662800-118662822 ATCTAATGTGAGGCCCCTGGAGG + Intergenic
980710592 4:136561868-136561890 ACCATCTGTGTGGCCCCTGGAGG - Intergenic
981354903 4:143777849-143777871 TCCTCCTCAGAGGCCTCTTGTGG - Intergenic
981516921 4:145619493-145619515 TCCTCCGGGGCGCCCCCTGGAGG + Intronic
981599718 4:146472632-146472654 GCCTCCTGTGCAGACCCTGGTGG + Intronic
983149498 4:164260527-164260549 ATCTAATGTGAGGCCCCTGGAGG - Intronic
984928489 4:184826420-184826442 TTCTGCTGCGAGGGCCCTGGAGG + Intronic
986461697 5:7979310-7979332 TCCTCATATGAGCCCCCGGGAGG - Intergenic
986495638 5:8339103-8339125 CCCACCTGTGATGCCCCTTGGGG + Intergenic
987322834 5:16786113-16786135 TGCTCCTCTCCGGCCCCTGGTGG - Intronic
988481886 5:31638593-31638615 TCCCCCAGTTAAGCCCCTGGGGG - Intergenic
988589868 5:32539375-32539397 TCCCCTGGTGGGGCCCCTGGTGG - Intronic
989257526 5:39381460-39381482 TGCCCCAGTGGGGCCCCTGGTGG - Exonic
992586502 5:78245482-78245504 TCCTCCTCAGAGGCCTCTTGTGG + Intronic
998132775 5:139659665-139659687 TCCTCCTGGGAGGTTCCGGGGGG + Intronic
998433751 5:142089212-142089234 TCCTCCTCAGAGGCCTCTTGTGG + Intergenic
999306194 5:150521184-150521206 TCCTCCTGTGTGGGGCCTTGGGG + Exonic
1000925149 5:167185043-167185065 TCCTGCTGTGTGGCCCCTGGGGG + Intergenic
1001963259 5:175893420-175893442 TCCTCCTGAGAGCCTCCAGGAGG + Intergenic
1002096517 5:176834465-176834487 TTCTCCTGTGAGGACCCTAAGGG + Intronic
1002728858 5:181320244-181320266 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
1002729257 5:181323651-181323673 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
1004291435 6:14370972-14370994 TAATCTTGTGAGGGCCCTGGAGG - Intergenic
1007351262 6:41275201-41275223 TCCCCCTGGGAGGCTTCTGGAGG - Exonic
1013807484 6:114011509-114011531 TCCTCCTCAGAGGCCTCTTGTGG - Intergenic
1014526253 6:122505301-122505323 TCCTCCTCAGAGGCCTCTTGTGG + Intronic
1014526940 6:122511999-122512021 TCCTCCTCAGAGGCCTCTTGTGG + Intronic
1015787201 6:136930183-136930205 ACCACCTGTGGGGCTCCTGGAGG + Intergenic
1016936819 6:149454093-149454115 TCCTCCTCTGCGCACCCTGGGGG + Intronic
1017816905 6:158022579-158022601 TCCTCCTGGGAGGCCCAGAGAGG + Intronic
1018700228 6:166420464-166420486 CACTCCTATGAGGTCCCTGGAGG - Intronic
1019503145 7:1375633-1375655 TCCGCCTGGGCTGCCCCTGGGGG - Intergenic
1019809890 7:3157657-3157679 GTCTCCTGTGATCCCCCTGGTGG - Intronic
1021637933 7:22709586-22709608 TCCACCTGTGATTCCCCGGGTGG - Intergenic
1024551521 7:50566355-50566377 AGCTCCTGTGAGACCCCAGGCGG - Intergenic
1024623744 7:51186770-51186792 GCCTCCTATGAGGCCTCTAGAGG + Intronic
1028315469 7:89396654-89396676 CCCTACTGTGAGGTTCCTGGTGG + Intergenic
1029572398 7:101378918-101378940 TGCGGCTGTGCGGCCCCTGGAGG + Intronic
1035351159 7:158247306-158247328 TTCTCCTGTGAGACCCCACGTGG - Intronic
1035731735 8:1858241-1858263 TCCCCAGGTGAGTCCCCTGGGGG + Intronic
1036205846 8:6805332-6805354 TTCTCCTGCCAGGTCCCTGGGGG + Intergenic
1036236646 8:7044724-7044746 CTCTCCTCTGATGCCCCTGGAGG + Intergenic
1037311183 8:17558391-17558413 TCCTCAGGTGAGTCACCTGGTGG + Exonic
1037826752 8:22164664-22164686 TCCTCCGGAGACGCCGCTGGAGG - Intergenic
1037831989 8:22195230-22195252 TCCTCATGTGAAGCCTGTGGCGG - Intronic
1037945217 8:22985550-22985572 TCCTCCTCAGAGGCCTCTTGTGG + Intronic
1039843951 8:41312465-41312487 GCCACCTGGGAGGCACCTGGGGG - Intergenic
1040338773 8:46429460-46429482 CCCACCTGGGAGGGCCCTGGTGG - Intergenic
1041225880 8:55697703-55697725 TCCACCTGTCAGATCCCTGGTGG - Intronic
1041691720 8:60693858-60693880 TTCTCCTGTGAGCCCCCATGGGG + Intronic
1044924609 8:97199608-97199630 TCCTCCAGTCAGTCCCCAGGTGG - Intergenic
1047097908 8:121643207-121643229 TCTAGCTGTGAGGCCCCAGGGGG + Intergenic
1049103683 8:140597932-140597954 ATCTACTGTGAGGCCCCTGGTGG - Intronic
1049392384 8:142378891-142378913 AGCTCCTCTGAGGCCCCGGGTGG + Intronic
1049424587 8:142532433-142532455 GGCTGCTGTGAGGCTCCTGGAGG + Intronic
1049595512 8:143481531-143481553 CCCTGCTGTGGAGCCCCTGGCGG - Intronic
1049612861 8:143563464-143563486 ACCTCCTGTGTGGCCCCAGGAGG - Intergenic
1049639582 8:143708766-143708788 TCCTTCGGTGAGGCCCCCGTGGG + Intronic
1053352938 9:37425148-37425170 TCCTGCTGTGAACCCCTTGGCGG + Intronic
1053466953 9:38315786-38315808 TGCTCCTTGGAGGCCCCTGGGGG - Intergenic
1055279638 9:74659459-74659481 GCCTGCTGTGAGTCCCCTGAAGG - Intronic
1056578102 9:87870980-87871002 GCCTGATGTCAGGCCCCTGGAGG - Intergenic
1056593466 9:87984627-87984649 TCCTCCTCAGAGGCCTCTTGTGG + Intergenic
1057929419 9:99180742-99180764 TCCTTCTGTGAAGGCCCTGGTGG - Intergenic
1061278430 9:129583178-129583200 TCCACCTGTCAGGCCCCTGCAGG - Intergenic
1061419482 9:130465650-130465672 AACTCCTGTGAGCCCCTTGGGGG - Intronic
1061621938 9:131816254-131816276 TGGGTCTGTGAGGCCCCTGGAGG - Intergenic
1062198531 9:135288035-135288057 TCCTCCTGTGAGGCAGCTGAAGG - Intergenic
1062737000 9:138142805-138142827 TCCTTCTGTGGGGCCACAGGCGG - Intergenic
1062753918 9:138277343-138277365 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
1203576437 Un_KI270745v1:12122-12144 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
1203576834 Un_KI270745v1:15531-15553 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
1203577236 Un_KI270745v1:18953-18975 TCCTGCTGTGTGGCTCCTTGCGG - Intergenic
1185944133 X:4355563-4355585 TCCTCCCGTGAGTCCCGTAGTGG + Intergenic
1190556009 X:51636579-51636601 TCCTCCTCAGAGGCCTCTTGTGG - Intergenic
1191848865 X:65570826-65570848 TCCTACACTGAGGCCCCTGCTGG - Intergenic
1192924118 X:75737693-75737715 TTCTCTTGGGAGGCCCTTGGGGG - Intergenic
1195295266 X:103470313-103470335 TCCTCCTCAGAGGCCTCTTGTGG + Intergenic
1198712249 X:139517830-139517852 TCCTCCTCAGAGGCCTCTTGTGG - Intergenic
1200399185 X:156008778-156008800 TCCTTCTGTGGGGCCACAGGAGG - Intronic
1201346878 Y:12994335-12994357 TCCTCCTCAGAGGCCTCTTGTGG + Intergenic
1201347526 Y:13000999-13001021 TCCTCCTCAGAGGCCTCTTGTGG + Intergenic
1202384411 Y:24311291-24311313 ATCTAATGTGAGGCCCCTGGAGG + Intergenic
1202486372 Y:25358831-25358853 ATCTAATGTGAGGCCCCTGGAGG - Intergenic