ID: 936069095

View in Genome Browser
Species Human (GRCh38)
Location 2:109353505-109353527
Sequence CCCCTTGCTGCCCTATGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936069095_936069102 -6 Left 936069095 2:109353505-109353527 CCCCAACATAGGGCAGCAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 936069102 2:109353522-109353544 AAGGGGCGCCTGGAGGGACGTGG 0: 1
1: 0
2: 2
3: 22
4: 356
936069095_936069109 20 Left 936069095 2:109353505-109353527 CCCCAACATAGGGCAGCAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 936069109 2:109353548-109353570 GAAGCCCTAACAGTGGAGTGGGG 0: 1
1: 0
2: 2
3: 5
4: 129
936069095_936069107 18 Left 936069095 2:109353505-109353527 CCCCAACATAGGGCAGCAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 936069107 2:109353546-109353568 GGGAAGCCCTAACAGTGGAGTGG 0: 1
1: 0
2: 1
3: 18
4: 157
936069095_936069106 13 Left 936069095 2:109353505-109353527 CCCCAACATAGGGCAGCAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 936069106 2:109353541-109353563 GTGGAGGGAAGCCCTAACAGTGG 0: 1
1: 1
2: 2
3: 8
4: 140
936069095_936069103 -3 Left 936069095 2:109353505-109353527 CCCCAACATAGGGCAGCAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 936069103 2:109353525-109353547 GGGCGCCTGGAGGGACGTGGAGG 0: 1
1: 0
2: 3
3: 32
4: 374
936069095_936069104 -2 Left 936069095 2:109353505-109353527 CCCCAACATAGGGCAGCAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 936069104 2:109353526-109353548 GGCGCCTGGAGGGACGTGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 480
936069095_936069108 19 Left 936069095 2:109353505-109353527 CCCCAACATAGGGCAGCAAGGGG 0: 1
1: 0
2: 1
3: 7
4: 97
Right 936069108 2:109353547-109353569 GGAAGCCCTAACAGTGGAGTGGG 0: 1
1: 0
2: 1
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936069095 Original CRISPR CCCCTTGCTGCCCTATGTTG GGG (reversed) Intronic
900097499 1:945956-945978 CCCCAGGCTGCACTAGGTTGGGG - Intronic
901875376 1:12164412-12164434 CCCCCTGCTGCCCTTTGGAGCGG + Intergenic
904368405 1:30033323-30033345 CCCCTTGCTGGCCTAGGGAGAGG + Intergenic
904482870 1:30805216-30805238 CACCTTGCTGGCCTATCTGGGGG + Intergenic
906061492 1:42952047-42952069 CCCCTGCCTGCCCCATGCTGTGG - Intronic
908813809 1:68011339-68011361 TCCCCTGATCCCCTATGTTGTGG + Intergenic
910724200 1:90321435-90321457 CCCTTTGCAGCCTCATGTTGTGG - Intergenic
911528972 1:99020980-99021002 CCCCATGCTCCCCTCTGTTTTGG - Intergenic
920555084 1:206898801-206898823 CCCCTTGCTCCCTTGTGATGAGG + Intronic
922870135 1:228896028-228896050 CCCCTGCCTGCCCCATGCTGTGG + Intergenic
922892484 1:229072573-229072595 CCCCCGGCTGCCCTGTGTGGAGG - Intergenic
923544320 1:234913213-234913235 CCCTTTGCTGCCCTCTGTGGGGG - Intergenic
924646079 1:245878348-245878370 CCCCTTGCTGCCCCATCTGTTGG - Intronic
1064092470 10:12396481-12396503 CCCCTTTTTGCCATATGCTGTGG + Intronic
1072191111 10:93076745-93076767 CCTCTTTCTTCCCTATGCTGTGG + Intronic
1075145988 10:119883477-119883499 GCCTTGGCAGCCCTATGTTGAGG + Intronic
1075399706 10:122152021-122152043 CCCCTTACTGCCCAAGGCTGGGG + Intronic
1076140647 10:128076370-128076392 CTCCTTTCTGCCATATGTTAAGG + Intronic
1077050892 11:566303-566325 CCCCCTGCTGGCCTATGTGACGG - Intergenic
1077061425 11:619384-619406 CCCCTTCCTGCCCCAGGTTGAGG - Exonic
1078170539 11:8925926-8925948 CCCCTTGCTGCTCTCTGCTAGGG - Exonic
1078882668 11:15467276-15467298 CCCCTTTCTGCCATAAGTTTTGG + Intergenic
1079049957 11:17145438-17145460 TCTCTTGCTGCCCTATGAAGAGG + Intronic
1079080322 11:17409341-17409363 CCCCCTCCCGCCCTATGCTGGGG + Intronic
1079837308 11:25350691-25350713 TCCCTTACTGCCCTTGGTTGGGG - Intergenic
1081177413 11:39946276-39946298 CTCCTTGCTTCCCTGGGTTGGGG - Intergenic
1081536760 11:44002249-44002271 CCCCATGCTGCCCTGAGCTGTGG + Intergenic
1082791625 11:57349822-57349844 ACCCTTTCTGCCCCATCTTGCGG + Exonic
1083762147 11:64824458-64824480 CTCCTTGATGCCCTCTGTTAGGG - Exonic
1084493367 11:69490030-69490052 CCCCTTTCTGACCTATGCTGTGG - Intergenic
1089781761 11:120878110-120878132 TCCCTTGCTGGCCTGGGTTGGGG - Intronic
1102310613 12:111842096-111842118 CCCCTTGCTGCCTTCCGCTGGGG - Intronic
1106114087 13:26801977-26801999 CCCCTTGTAGCTCCATGTTGTGG - Intergenic
1106407020 13:29483210-29483232 GCCCCTGCTGCCAGATGTTGGGG - Intronic
1107803303 13:44130896-44130918 CCCCTTCCTGCCGTGTGCTGGGG + Intergenic
1113713919 13:112489252-112489274 CCCTGTGCTCCCCTGTGTTGGGG - Intronic
1113713935 13:112489295-112489317 CCCAGTGCTCCCCTGTGTTGGGG - Intronic
1120516934 14:85482007-85482029 CCACAGGCTTCCCTATGTTGAGG + Intergenic
1127656098 15:61057678-61057700 CCCCTTGCTTCCCTGTGTTGAGG - Intronic
1136265995 16:29118793-29118815 CCCCATGCTTCCCTCTGCTGGGG + Intergenic
1137805209 16:51298254-51298276 TCAATTGTTGCCCTATGTTGTGG + Intergenic
1138951935 16:61922658-61922680 CCCACTACTGTCCTATGTTGAGG + Intronic
1139701363 16:68710047-68710069 GCCCTAGCTGCCCTGTGTTCTGG + Intronic
1140282595 16:73568370-73568392 CCCCTAGCTGCCTTATTTAGGGG - Intergenic
1142054805 16:87986701-87986723 CCCCATGCTTCCCTCTGCTGGGG + Intronic
1142308096 16:89296864-89296886 CCCATTCCTGCCCTCTGGTGGGG - Intronic
1142711479 17:1726099-1726121 CCCCGTGCTGCCCTGGGTGGTGG + Exonic
1150443050 17:65207167-65207189 TCCCTTTCTGCCCTGTGTTTTGG - Intronic
1151419438 17:73987553-73987575 CGCCCAGCTGCTCTATGTTGGGG + Intergenic
1151713167 17:75818185-75818207 CCCCTTCCTCCCCTCTGCTGTGG + Intronic
1152579356 17:81159305-81159327 CTCCCAGCTGCCCCATGTTGGGG - Intronic
1154125405 18:11688634-11688656 CTCCTCTCTGCCCTATATTGTGG + Intergenic
1166562361 19:43741535-43741557 CCCCTTGCTGCTATGTGGTGAGG + Intronic
1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG + Exonic
926911103 2:17852964-17852986 CCCCTTGCTGCACATTGCTGTGG - Intergenic
930188736 2:48436421-48436443 ACCCTTGCTGGCCTCTGTGGTGG + Intergenic
934041361 2:88129893-88129915 CCCCTTCCTGCCCGCTGTTCAGG - Intergenic
936069095 2:109353505-109353527 CCCCTTGCTGCCCTATGTTGGGG - Intronic
948946640 2:241223878-241223900 CCTCTTGCTGCCCTTTTTTGGGG + Intronic
1170363065 20:15568519-15568541 TCCCTAGAGGCCCTATGTTGAGG - Intronic
1173591989 20:44231878-44231900 GCCCTTGCTGCCCCCTGCTGTGG - Intergenic
1174920164 20:54693469-54693491 CCACTTGCTGAGTTATGTTGAGG + Intergenic
1178441840 21:32604695-32604717 CTCCTTCCTGCCCCATGCTGAGG - Intronic
1179885363 21:44312010-44312032 CCCCTTGCTGCCCAGTCCTGGGG + Intronic
1183493200 22:38127639-38127661 CTCCTGGCTGCCCTCTGTTCAGG + Intronic
1183677319 22:39306885-39306907 CTCCTTGCTGCCCCCTGTTGAGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
952838880 3:37627741-37627763 GCCCTTGCTGACCAATGTTTGGG - Intronic
955714147 3:61810941-61810963 CCCCTTGCCTACCTGTGTTGGGG + Intronic
961602659 3:128073236-128073258 CCCCTTGCTGCCCTTGGCTCAGG + Intronic
963176973 3:142309004-142309026 GCCATTTCTGCCCCATGTTGAGG - Exonic
963778327 3:149462697-149462719 CCCTTTGCTGTCCTGTGTAGTGG - Intergenic
964032702 3:152155848-152155870 CCCACTGCAGCCCTATGCTGTGG + Intergenic
967545092 3:190716237-190716259 CCACTGGCTCACCTATGTTGAGG - Intergenic
968672120 4:1857268-1857290 CCCCTTCCTTCCCTAAGATGAGG + Intergenic
968702412 4:2063215-2063237 CCCTTTGCGGCCCTCTGCTGTGG + Intronic
971323177 4:25621827-25621849 CCCATTGCTGACTTATGTTCTGG + Intergenic
972031900 4:34471122-34471144 CCAGTTGCTGGACTATGTTGTGG + Intergenic
972313433 4:37902206-37902228 GCCCATGCTGCCCTGGGTTGTGG + Exonic
972793325 4:42393459-42393481 CCTCTTCCTGCCCTGTGTTTCGG - Intergenic
979322014 4:119335835-119335857 CTCCTTCCTACCCTAAGTTGTGG - Intergenic
986389604 5:7272373-7272395 CCCTTTGCTGCCCTCTGTTACGG + Intergenic
998130596 5:139649413-139649435 CCGCTCGCAGCCCTGTGTTGAGG + Intronic
1002911047 6:1491213-1491235 CCCCTTTCTGCCCCAAGCTGGGG - Intergenic
1018376748 6:163219921-163219943 CCCCTGGCTGCCCTATGGAAAGG + Intronic
1022991678 7:35714699-35714721 CCCCTTGCTGCCTTGGGGTGGGG - Intergenic
1023785665 7:43705513-43705535 CCCGTTGCTGGCCTCTGTTAGGG - Intronic
1023867257 7:44244153-44244175 CTCCTTCCTGCCCCATGTAGTGG - Intronic
1025020640 7:55476753-55476775 GCCCCTGGTGCCCTGTGTTGAGG - Intronic
1033273948 7:139957057-139957079 GCCCTTGCTGCCATGTGCTGGGG - Intronic
1033544038 7:142384008-142384030 TCCCTTGGTGCCTTGTGTTGGGG + Intergenic
1033556395 7:142491802-142491824 CCACTTTGTGCCCTATGTTAGGG + Intergenic
1033558765 7:142511258-142511280 ACCCTTTGTGCCCTATGTTAGGG + Intergenic
1035090666 7:156307510-156307532 CCCCTTGCTGAGCTGTGGTGGGG - Intergenic
1035779587 8:2217135-2217157 CCCCTTGGTGCCCTCTGTAGGGG + Intergenic
1042190166 8:66177931-66177953 GCCCTTGCTGCCTTATCTCGGGG + Intronic
1048519466 8:135140275-135140297 TCTCTTGCTGCCCTATGAAGAGG + Intergenic
1059723215 9:116981974-116981996 CTCCTGGCTGCCATTTGTTGAGG + Intronic
1062188745 9:135234710-135234732 CAGCTTGCAGCCCTTTGTTGAGG - Intergenic
1186905141 X:14102591-14102613 CCCCTTGCTGCCCTCCATTTTGG - Intergenic
1190222364 X:48520656-48520678 CCCCTTCCTGCCTTGTGGTGGGG - Exonic
1190474507 X:50813619-50813641 GCCCTTGCTGCCCCACGTCGGGG - Intronic
1193508595 X:82372424-82372446 CCCCTTGCTGTCCTGTGAGGTGG + Intergenic
1198151834 X:133918684-133918706 CTCCTTGCTGCCATCTGTTTTGG - Intronic
1198775427 X:140173710-140173732 TCTCCTGCTGCCCTATGTGGAGG + Intergenic
1198948273 X:142039900-142039922 TCTCTTGCTGCCCTATGAAGAGG + Intergenic