ID: 936069985

View in Genome Browser
Species Human (GRCh38)
Location 2:109361438-109361460
Sequence CTTTCAAAACAGAAAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 952
Summary {0: 2, 1: 10, 2: 63, 3: 191, 4: 686}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936069985_936069986 15 Left 936069985 2:109361438-109361460 CCTGGTTCTTTCTGTTTTGAAAG 0: 2
1: 10
2: 63
3: 191
4: 686
Right 936069986 2:109361476-109361498 TTCAGTTTCTTTTTTTAAAATGG 0: 1
1: 2
2: 25
3: 314
4: 3552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936069985 Original CRISPR CTTTCAAAACAGAAAGAACC AGG (reversed) Intronic
900038568 1:436810-436832 CTCTCATAAAAGAAAGACCCAGG + Intergenic
900060003 1:671789-671811 CTCTCATAAAAGAAAGACCCAGG + Intergenic
900085633 1:894311-894333 CATTCAGAACAGAAACAACAGGG - Intergenic
900260661 1:1726817-1726839 CTCTCAAAACAGAAAAAAAAAGG - Intronic
902032804 1:13435065-13435087 TGTTCAAAACACCAAGAACCTGG + Intergenic
902266231 1:15267580-15267602 CTTCTAAAACAGAAAGCACCAGG - Intronic
902475449 1:16681996-16682018 CATTCAAAACCTCAAGAACCGGG - Intergenic
903644233 1:24883397-24883419 CTTCCAAAACAGAAGGCACCAGG - Intergenic
904967433 1:34387192-34387214 CTTTCAGAAAAGAAAACACCAGG + Intergenic
905288237 1:36901050-36901072 CTTACAAAGCAGAAATCACCAGG + Intronic
905586719 1:39125654-39125676 ATTTAAAAACAGACAGGACCTGG - Intronic
905963943 1:42073184-42073206 CTTCCAAAACAGAAAACACCAGG - Intergenic
906018239 1:42602655-42602677 CTTCTAAAACAGAAAGCACCAGG + Intronic
906347407 1:45026843-45026865 CTTCCAAAACAGAAAGCGCCAGG - Intronic
906701505 1:47861629-47861651 CTTCCAAAACAAAAAGCACCAGG + Intronic
907128617 1:52074803-52074825 CTTTTAAAACAAAAACAAGCCGG - Intronic
907817236 1:57931480-57931502 CTTGCGAAACAGAAGGGACCAGG - Intronic
907908627 1:58807949-58807971 CTTTCATAACAGAAAGAATATGG + Intergenic
907954096 1:59212206-59212228 ATTTCGAGACAGAAAGAGCCTGG - Intergenic
908033120 1:60022410-60022432 CTTTCAAAGCAGAAAGTACCAGG + Intronic
908047754 1:60189904-60189926 CTTCCAAAACAGAAAGCACCAGG + Intergenic
908515603 1:64889336-64889358 CTTAGAAAACAGGAAGGACCAGG + Intronic
908574817 1:65448647-65448669 CTTCCAAAACAGAAAGCACAAGG - Intronic
908673048 1:66569850-66569872 CTTTTAAAACAGAATGCACCAGG - Intronic
909944000 1:81642549-81642571 CTTCCAAAACTGAAAGCACCAGG + Intronic
910122932 1:83810347-83810369 CCTCCAAAACAGAAATAACTGGG - Intergenic
910182543 1:84501691-84501713 CTTGCAAAACAGAAAAATACTGG + Intronic
910734934 1:90443230-90443252 TGTTCAAAACACCAAGAACCTGG - Intergenic
910972428 1:92869868-92869890 ATTTCAAAACAGTAATGACCAGG + Intronic
911048832 1:93652159-93652181 CTTTCAGAACAGAATGAACAAGG - Intronic
911140041 1:94490561-94490583 CTTTTAAAAAAGAAGGAAACTGG - Intronic
911286405 1:95999042-95999064 CTTTCAAAACAGAAAGCATTAGG + Intergenic
911373450 1:97023054-97023076 CTTCCAAAACAGGAAGTACTAGG + Intergenic
911809443 1:102255874-102255896 CTTTCAAAACAGAAATCATCAGG + Intergenic
911960697 1:104298486-104298508 CTTTTTAAACAGAAAGGACATGG + Intergenic
912136764 1:106669655-106669677 CTTCTAAAACTGAAAGTACCAGG + Intergenic
912970696 1:114279906-114279928 CTTCCAAAACAGAAAGCATCTGG + Intergenic
913028227 1:114868677-114868699 CCTCCAGAACAGAAAGCACCAGG - Intronic
913029181 1:114881298-114881320 TCTTCAAAACAGAAAGAAAATGG - Intronic
913092489 1:115487766-115487788 GTTTCAAAACAGAAAGCCCCAGG + Intergenic
913204747 1:116527798-116527820 CTTCCAAAACAGAAAGCACCAGG - Intronic
913462977 1:119108312-119108334 CTTCCAAAATATAAAGTACCAGG - Intronic
914417627 1:147498453-147498475 CTGTCAGGACAGAAACAACCAGG + Intergenic
915208035 1:154285672-154285694 CTTTCAAGACGCCAAGAACCTGG - Intergenic
915862861 1:159465696-159465718 TGTTCAAAACACCAAGAACCTGG + Intergenic
917157236 1:172016723-172016745 CTTCCAAAAAAGAAGGCACCAGG - Intronic
917193745 1:172445283-172445305 CTTTAAAAATAGAAATAATCCGG + Intronic
917337873 1:173943847-173943869 CTTTCAAATCAGAAAATACAAGG - Intronic
917351063 1:174078154-174078176 TGTTCAAAACACCAAGAACCTGG + Intergenic
917568688 1:176239274-176239296 CTTTCAAATAAGAAAGCACTGGG - Intergenic
917763113 1:178186012-178186034 CTTTCAAAAAACAAAGTACCAGG - Intronic
917830792 1:178883467-178883489 CTTTCATTAAAGATAGAACCAGG + Exonic
918921923 1:190723589-190723611 CTTCCAAAATAGAAAGTAACTGG - Intergenic
919028841 1:192212902-192212924 TTTTCAAAATACAAAGAACCAGG + Intergenic
919099642 1:193078923-193078945 CTTTAAAAAAAGAACAAACCTGG + Intronic
919653464 1:200174233-200174255 CTTTCAAAACAAAAAGAGATTGG + Exonic
920189435 1:204183291-204183313 TTTTCAATACTGAAACAACCAGG - Intergenic
921194124 1:212736318-212736340 CTTTCAGAAAAGAAATAGCCAGG - Intronic
921242374 1:213198703-213198725 CTTCCAAAATAGAAAGCACCAGG + Intronic
921674163 1:217959720-217959742 CTTCCAAAACAGAAAGCACCAGG + Intergenic
922075574 1:222240540-222240562 TTTTCAAAACAGAATGTAGCCGG + Intergenic
922181515 1:223237973-223237995 TTTTCCAAACAGAAAGCACTAGG - Intronic
922521865 1:226260198-226260220 CTTCCAAAACAGATAGCACCAGG + Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
922708936 1:227812483-227812505 CAATCAAAACAGAATGATCCTGG + Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
923023171 1:230181866-230181888 CTTCCCAAACAGAAAGCACCTGG - Intronic
923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG + Intronic
923172750 1:231431982-231432004 TGTTCAAAACACCAAGAACCTGG - Intergenic
923419974 1:233803415-233803437 ATTTCAAAACAGAAAACACCAGG + Intergenic
923633270 1:235669844-235669866 TGTTCAAAACACCAAGAACCTGG + Intronic
923709262 1:236372684-236372706 CTTCCAAAACAGAAAGCACCAGG - Intronic
923766597 1:236897953-236897975 CTGTAAAAACAGAAAAAAGCAGG - Exonic
924251068 1:242133496-242133518 TGTTCAAAACACCAAGAACCTGG + Intronic
924364743 1:243280027-243280049 CTTTCAAAACAGAAAGCACCAGG - Intronic
924429105 1:243981279-243981301 ATTTAAAAACAGAAATAAGCTGG - Intergenic
924459094 1:244242600-244242622 CTATAGAAACGGAAAGAACCAGG + Intergenic
1062807289 10:432318-432340 CTTTCAAAACAGGAAGTGCCAGG - Intronic
1062963185 10:1589148-1589170 CTTTCACATCGGAAAGACCCTGG + Intronic
1062995182 10:1858927-1858949 TTTTCAAAACAGTAAAATCCAGG + Intergenic
1063056912 10:2515135-2515157 CTTCCAAAAAAGAAAACACCAGG + Intergenic
1063084493 10:2803971-2803993 CTTCCAAAACAAAAAGCACTGGG + Intergenic
1064596517 10:16951008-16951030 CTTGCAGAACAGCAAGCACCTGG + Intronic
1064665021 10:17642047-17642069 CCTTCAAAACATTAAGAAACTGG + Intergenic
1064700804 10:18019017-18019039 CTCTCCAAACAGAAATCACCAGG - Intronic
1064704184 10:18054422-18054444 CTTCCAAAACAGAAAGTACTGGG + Intergenic
1064977270 10:21131253-21131275 CTTTGAAAACAGAAAGCACAAGG + Intronic
1065613522 10:27497321-27497343 CTTTCAAAAAATAAAGCACCAGG + Intergenic
1065677298 10:28191144-28191166 CTTACAAAACAGCAAGCACCAGG + Intronic
1066043088 10:31571134-31571156 ATTCCAAAACAGAAAGCACCAGG + Intergenic
1066260029 10:33720469-33720491 TGTTCAAAACACCAAGAACCTGG + Intergenic
1066485692 10:35841944-35841966 CTTACAAAACAGAAAGCACTAGG - Intergenic
1066511408 10:36101686-36101708 CTTCCAACACAGAAAGTTCCAGG + Intergenic
1066650382 10:37649570-37649592 TTTTTAAAAAAGAAAGAAACTGG + Intergenic
1067093051 10:43280699-43280721 CATCCAAATCAGAAAGTACCAGG + Intergenic
1067664434 10:48263660-48263682 CTTCCAAAACATAAAGCACCAGG + Intronic
1067671573 10:48327711-48327733 CTTTTAAAACAGAAAACACCAGG - Intronic
1068026292 10:51649598-51649620 TGTTCAAAACACCAAGAACCTGG - Intronic
1069022954 10:63509534-63509556 CTTCCCAAACAGAAAGTACCAGG - Intergenic
1069125270 10:64623177-64623199 CTTTCAAAACACAAAGGAGAAGG + Intergenic
1069253454 10:66301188-66301210 CTTCCAAAACAGAAAGAACCAGG + Intronic
1069653464 10:70069427-70069449 CTTTCATAGCAGAAAGACCAAGG - Intronic
1070463606 10:76694706-76694728 CTTCTAAAACAGAAAGCACCTGG + Intergenic
1070621282 10:78013525-78013547 GTTTAAGAACAGAAAGAGCCTGG + Intronic
1071004844 10:80871480-80871502 CTTTCAAAAAAGAAAAGTCCAGG + Intergenic
1071047162 10:81394682-81394704 CTTCCAAAACAGAAAGCACGAGG - Intergenic
1071199090 10:83196808-83196830 CTTCCAAAAAAGAAATCACCAGG - Intergenic
1071584667 10:86808036-86808058 CTTCCAAAACAGAAAACAACAGG - Intronic
1071606045 10:86990819-86990841 CTTCCAAAACAGAAAGCACTTGG + Intergenic
1071827218 10:89337214-89337236 CTAACAAAACTGAAAGCACCTGG + Intronic
1072026604 10:91466060-91466082 CTTCTAAAACAGAAAGCACCAGG - Intronic
1072078038 10:91998573-91998595 CTTGAAACACAGAAAGAGCCAGG + Intronic
1073411631 10:103346790-103346812 GTCTCAAAATAAAAAGAACCAGG + Intronic
1073533875 10:104256801-104256823 CTATGAAAACAAAAAGATCCTGG - Intronic
1073586348 10:104713883-104713905 CTTCCAAAAAAGAAATCACCAGG - Intronic
1073782418 10:106853098-106853120 TCTTCCAAACAGAAAGCACCAGG - Intronic
1074396948 10:113105767-113105789 CTTTCTAAACTGTAAGACCCTGG - Intronic
1074438632 10:113455669-113455691 TGTTCAAAACAACAAGAACCTGG - Intergenic
1074481935 10:113831101-113831123 CTTCCAAAACATGAAGTACCAGG + Intergenic
1075063757 10:119274946-119274968 TTTGCAAAGCAGTAAGAACCTGG + Intronic
1075155486 10:119973119-119973141 TGTTCAAAACACCAAGAACCTGG - Intergenic
1075267466 10:121015119-121015141 ATTTTAAAACATAAAGCACCAGG + Intergenic
1075914580 10:126156614-126156636 TGTTCAAAACACCAAGAACCTGG + Intronic
1076123804 10:127958815-127958837 CTTCTAAAACAGAAAGGACCAGG - Intronic
1076523069 10:131093242-131093264 TGTTCAAAAAAGAAAGGACCAGG - Exonic
1076576070 10:131469072-131469094 CTTCCAAATCAGAAAGCCCCAGG - Intergenic
1076652861 10:132002000-132002022 TGTTCAAAACACCAAGAACCTGG + Intergenic
1077511935 11:2970786-2970808 CTTTAAAAATATATAGAACCTGG - Intronic
1078293917 11:10045824-10045846 TTTCCAAAACAGAAAGCACCAGG + Intronic
1078314848 11:10285803-10285825 TCTTCAAAACACCAAGAACCTGG + Intronic
1078423439 11:11230621-11230643 CTTTCAAAACTGAAAGTTCCAGG - Intergenic
1078591612 11:12645790-12645812 TTTCCAAAACAGAAAGGACCAGG + Intergenic
1078695965 11:13631923-13631945 CTTTCAAAAAAGAAAAGCCCAGG - Intergenic
1078927315 11:15886407-15886429 CTTTGAAGTCAGAAAGAACAGGG + Intergenic
1078953419 11:16162196-16162218 CCTTCAAAACAGAAAGAATTAGG + Intronic
1078992142 11:16659758-16659780 CTTTCCAAATACAAAGTACCAGG - Intronic
1079051157 11:17160941-17160963 CTTTCAAACCAGAAAGATGAGGG + Intronic
1079072767 11:17362597-17362619 CTTCCAAAAAGGAAAGCACCAGG - Intronic
1079275717 11:19035351-19035373 CTTCCAAAACATAAAGCCCCAGG + Intergenic
1079752339 11:24214644-24214666 ATTGGAAAACAGAAAGAAGCAGG + Intergenic
1080249559 11:30217931-30217953 TTTTAAAAGCAAAAAGAACCAGG - Intergenic
1080703856 11:34669532-34669554 CATTCCAAACAGAAAGTTCCAGG + Intergenic
1080970800 11:37273969-37273991 TTTCAAAAACAGAAAGCACCAGG - Intergenic
1081370627 11:42297039-42297061 CTTCCAAAAAAGAAAGAAGCAGG - Intergenic
1081642909 11:44769523-44769545 CTTGCAAAAAAGAAAGTATCAGG - Intronic
1081880714 11:46448952-46448974 CTCCTAAAACAGAAAGAACTGGG + Intronic
1082130333 11:48481167-48481189 CTTAAAAAACAGAAAGTACCAGG - Intergenic
1082246778 11:49932482-49932504 CTTCCAAAGCAGAAAGCACCAGG + Intergenic
1082563851 11:54652076-54652098 CTTCAAAAACAGAAATTACCAGG - Intergenic
1082936403 11:58661305-58661327 TGTTCAAAACACCAAGAACCTGG - Intronic
1083093633 11:60226162-60226184 TTTTCAAAACAGAAAGCACCAGG + Intronic
1083917202 11:65755643-65755665 CTTCCAAAACAGAAAGCTGCAGG - Intergenic
1084089066 11:66868694-66868716 CTTTTAAAACACTAAGTACCTGG + Intronic
1085526809 11:77168803-77168825 ATTTAAAAAAAGAAAGAAACTGG + Intronic
1085753233 11:79180955-79180977 CTTCCAAAAAATAAAGTACCAGG + Intronic
1086199382 11:84183103-84183125 CTTCCCAAACAGAAAGAACCAGG + Intronic
1086363425 11:86083298-86083320 CTTCTGAAACAGAAAGAACCTGG - Intergenic
1086405002 11:86492075-86492097 CTTTCAAATCAGATAGACCTGGG + Intronic
1086536487 11:87853178-87853200 CATTCAAGGCAGAAAGAACATGG + Intergenic
1086849619 11:91794036-91794058 TGTTCAAAACACCAAGAACCTGG - Intergenic
1086916178 11:92532508-92532530 CCTTTAAAATACAAAGAACCTGG - Intronic
1087055109 11:93927153-93927175 CTTCTCAAACAGAAAGCACCAGG + Intergenic
1087602710 11:100337254-100337276 TTTTCAGAACAAAAAGAGCCTGG + Intronic
1087828200 11:102790065-102790087 CTTTCAAGACAGAAAGAGACAGG - Exonic
1087999628 11:104861132-104861154 CCTTCAAAACAGAAATCACCAGG + Intergenic
1088096511 11:106106830-106106852 CTTGCAAAACAAAAAGGTCCCGG - Intergenic
1089719828 11:120405388-120405410 CATTTAAAAGAGAGAGAACCAGG + Intronic
1089910647 11:122096799-122096821 CTTTCAAACTAGAAAGGATCAGG - Intergenic
1090108654 11:123880261-123880283 CTTCCAAAATAGAAAGCACAAGG + Intergenic
1090168169 11:124573922-124573944 CTTTCAAAACAGAAAACACCAGG + Intergenic
1090371269 11:126254824-126254846 CTCTAAAAAAAGAAAGAAACTGG + Intronic
1090739802 11:129648247-129648269 CTTTCAAAAAGGAAAGCACAAGG + Intergenic
1090754287 11:129775204-129775226 CTCCCAAAACAAAAAGCACCAGG + Intergenic
1090841554 11:130493115-130493137 CTTTCAAAACAGAAAGAACCAGG - Intergenic
1091421986 12:349631-349653 ATTTTATAACAGAAAGAACTAGG + Intronic
1091438198 12:490892-490914 CTTTCAAAACAGAAAGCCCCAGG + Intronic
1091892167 12:4066630-4066652 CTTCCAAAACAGAAAGTATGAGG - Intergenic
1091962350 12:4707850-4707872 CTTCCAAAATAGAAAGCACAAGG + Intronic
1092688940 12:11085576-11085598 ATGTCAAAACGGAAAGCACCGGG + Intronic
1093239388 12:16650962-16650984 CTTTCAAAATGGAAAGCACCAGG + Intergenic
1093506806 12:19876382-19876404 CTTCCAAAACAGAAAGCACCAGG - Intergenic
1093567547 12:20626309-20626331 GTTTAAAAACAGAAAGAATTAGG - Intronic
1093610164 12:21146076-21146098 TTTCCAAAACAGAAAGAAACAGG - Intronic
1094254251 12:28403272-28403294 CCTTCCAAACAGAAAGCACCTGG - Intronic
1094314708 12:29126504-29126526 CTTCCCAAACAAGAAGAACCAGG - Intergenic
1094548721 12:31429707-31429729 GTTTTAAAACAAAAAAAACCAGG - Intronic
1094796879 12:33984722-33984744 CTTTCAAAACAGTAAGAAACTGG - Intergenic
1095109624 12:38278670-38278692 CTTTCAAAACTGTAAGAAACAGG - Intergenic
1095258608 12:40071632-40071654 CTTCCAAAACTGAAAGCACCAGG - Intronic
1095634220 12:44413230-44413252 CTTCCAAAACAGAAAGTACCAGG + Intergenic
1095763839 12:45871739-45871761 CCTTCAAAACAGAAAGTACCAGG - Intronic
1095815042 12:46412072-46412094 CTCTCAAATCAGAAAGAAATGGG + Intergenic
1095886903 12:47197907-47197929 CATCTAAAACAGAAAGCACCAGG + Intronic
1096129055 12:49142888-49142910 CTTCCCAAACAGAAAGCACCAGG - Intergenic
1096558728 12:52420593-52420615 CTTTTAACAGATAAAGAACCTGG + Intergenic
1096631349 12:52928602-52928624 CTTTAAAAAAAGAAAGAAAGGGG + Intronic
1097238668 12:57558108-57558130 CTTTAAAAACAAAAACAGCCTGG + Intronic
1097535747 12:60868757-60868779 CTTTAAAAACAAAAAGAAAAAGG + Intergenic
1097869869 12:64592637-64592659 ATCTCAAAACAGAAAAAACTTGG - Intergenic
1097932192 12:65200433-65200455 TGTTCAAAACACCAAGAACCAGG + Intronic
1097932346 12:65202683-65202705 CTTCCAAAATATAAAGCACCAGG - Intronic
1098400819 12:70073717-70073739 TGTTCAAAACACCAAGAACCTGG + Intergenic
1098414858 12:70221290-70221312 CTTTGAAGTCAGAAAGAACTGGG + Intergenic
1098543309 12:71683969-71683991 TGTTCAAAACACCAAGAACCTGG - Intronic
1098546724 12:71719596-71719618 CCTTCCAAACAGAAATTACCAGG - Intergenic
1098696409 12:73562602-73562624 ACTTCCAAACAGAAAGCACCAGG + Intergenic
1098777767 12:74643019-74643041 CTTCCAAAACAGAAAACACCAGG - Intergenic
1098832870 12:75384516-75384538 CTTCCAAAACAGAAAGCACCAGG + Intronic
1098870503 12:75812130-75812152 ATTTAAAAAAAGAAAGAAACTGG + Intergenic
1099327558 12:81238495-81238517 CTTCCAAAACTGAAAGTACCAGG - Intronic
1099907384 12:88788481-88788503 ATTCCAAAACAGAAAGGATCAGG + Intergenic
1101127888 12:101657706-101657728 CTTACAAAACAGAAAGCAACAGG + Intronic
1101497781 12:105272092-105272114 CGTTCCAAACACCAAGAACCTGG - Intronic
1101649633 12:106664185-106664207 CTTCCAAAACAGAAAGCACCAGG - Intronic
1101943254 12:109116496-109116518 CCTTCAAAGCAGCAACAACCCGG - Intergenic
1101999802 12:109550237-109550259 CTGTCAAAACAGAAAGGATTGGG - Intergenic
1102598100 12:114008274-114008296 CTATCAAAAAAGAAAAATCCAGG - Intergenic
1103112111 12:118289692-118289714 ATTTAGAAACAGAATGAACCTGG + Intronic
1103483908 12:121269746-121269768 ATTTAAAAACAGAAAGATCTGGG + Intronic
1103762474 12:123261503-123261525 CTTAAAAAACAAAAAAAACCTGG + Exonic
1103972465 12:124680686-124680708 CTTTTAAAAAAGAGAGAACCAGG - Intergenic
1105020632 12:132814333-132814355 TTTTAACAACAGAAAGAACTGGG + Intronic
1105054848 12:133089175-133089197 CTTTCAAAAATGAAAGCATCAGG - Intronic
1105434036 13:20362067-20362089 CTTTAAAAAAAAAAACAACCCGG - Intergenic
1106107104 13:26742512-26742534 TTTTCAAAACAGAGAGAAATAGG + Intergenic
1106216066 13:27700955-27700977 CTTCTAAAACAGAAATCACCAGG - Intergenic
1106313116 13:28570944-28570966 CTCTTAAAACATAAAGAATCTGG - Intergenic
1106601605 13:31192322-31192344 TGTTCAAAACACCAAGAACCTGG + Intergenic
1106900216 13:34347842-34347864 CTTACAAAACAGAAAGCACATGG - Intergenic
1107255659 13:38423399-38423421 CATTCAAAACAGAGATAAACAGG - Intergenic
1107261060 13:38491920-38491942 TTACCAAAAAAGAAAGAACCAGG - Intergenic
1107995945 13:45861131-45861153 CTTTCAAAACAGGAGAAACCAGG - Intergenic
1108793705 13:54004803-54004825 GTTTTAAAACAGAAATAACATGG - Intergenic
1109239793 13:59871732-59871754 CTTCAAAAACAGAAAGAACAAGG - Intronic
1109478502 13:62916735-62916757 CTTTCAAAATACAAAGCATCAGG - Intergenic
1109511578 13:63382072-63382094 CTGTGAAATCAGAAACAACCAGG + Intergenic
1109713992 13:66196867-66196889 CTTACCAAACAGAAAAAGCCCGG + Intergenic
1110214832 13:73013983-73014005 TTTTCAAAACAGAAAGCACTAGG + Intronic
1111326120 13:86698119-86698141 CTTCCAAATCAGAAAGCACCGGG + Intergenic
1111689672 13:91547509-91547531 CTTCCAAAACAGAAAGCACCAGG + Intronic
1111745552 13:92264570-92264592 TGTTCAAAACACCAAGAACCTGG + Intronic
1111980616 13:95011845-95011867 CTTTAAAAACAGAAAGAATGTGG - Intergenic
1112721528 13:102251464-102251486 CTTTTAAAACATCAAGAAACAGG + Intronic
1114787425 14:25616856-25616878 TGTTCAAAACACCAAGAACCTGG + Intergenic
1114952938 14:27779942-27779964 CCTGCTAAACAGAAAGCACCAGG + Intergenic
1115308535 14:31956824-31956846 CTTTCAAAGAAGAAAAAACAAGG - Intergenic
1115531956 14:34335844-34335866 AGTTCAAAACACCAAGAACCTGG - Intronic
1115574930 14:34702192-34702214 CTTTCAAAATAAAAATAAACAGG + Intergenic
1115678372 14:35707724-35707746 CTTCCAAATTAGAAAGCACCAGG - Intronic
1115719267 14:36142608-36142630 CTTCCAAAACACAAAGCACCAGG - Intergenic
1115878237 14:37885472-37885494 CTTTCAACACAGAGAGCACCAGG - Intronic
1116089139 14:40281694-40281716 GTTTCAAAATATAAAGAACTTGG - Intergenic
1116293279 14:43070671-43070693 CTCTCAAACCAGAAAGAACCAGG - Intergenic
1116513003 14:45769891-45769913 CCTTCAAAATAGAATGAACTCGG - Intergenic
1116566844 14:46457414-46457436 TTTTCAAAACAGAATAAAACTGG - Intergenic
1116687670 14:48061878-48061900 CTTTCAAAAATGAAATTACCAGG + Intergenic
1116723584 14:48532227-48532249 TTTTCAAAACAGAAAGCACAAGG - Intergenic
1117146035 14:52837606-52837628 TTTTCAAAACGGCAAGAGCCTGG + Intergenic
1117748469 14:58896228-58896250 CTTACAAAAAAGAGAGAATCAGG - Intergenic
1117989277 14:61417745-61417767 CTTTAAAAAAAGAAAGAAAGAGG + Intronic
1118099919 14:62586373-62586395 CTTTCACAAAAGAAACCACCAGG - Intergenic
1118397457 14:65349481-65349503 CTTGAAAAAGAGAAAGAAACGGG - Intergenic
1118727816 14:68642231-68642253 CTCCCAAAATAGAAAGCACCAGG - Intronic
1118841065 14:69512021-69512043 CTTCCAAAACAGAAAGCACCAGG - Intronic
1119329276 14:73782133-73782155 TTTTCAAAAAAGAAAGAATCTGG + Intronic
1120030798 14:79638492-79638514 GTTATCAAACAGAAAGAACCTGG - Intronic
1120837165 14:89050812-89050834 CTTCCAAAACAGAAAGCACTGGG + Intergenic
1121910761 14:97790324-97790346 CTATCAAAACAGCAAAAACAGGG - Intergenic
1122170753 14:99872728-99872750 TTTTGAAAACAGAAAGAAGCAGG + Intronic
1122221206 14:100239950-100239972 CCTTCAAAACAAAAACATCCCGG - Intronic
1122380688 14:101304481-101304503 CCTTCCAAACAGAAAGAACTAGG + Intergenic
1122778201 14:104132297-104132319 ATTTCAAAAAAGAAAAGACCTGG + Intergenic
1202843327 14_GL000009v2_random:144346-144368 CATTCAGAACAGAAACAACAGGG - Intergenic
1202912723 14_GL000194v1_random:134584-134606 CATTCAGAACAGAAACAACAGGG - Intergenic
1202879916 14_KI270722v1_random:48098-48120 CATTCAGAACAGAAACAACAGGG + Intergenic
1123904589 15:24909132-24909154 CTCTCAATACATAAAGAACAGGG - Intronic
1124559709 15:30760357-30760379 GTTTTAAAACAGACAGCACCAGG + Intronic
1124671541 15:31645364-31645386 GTTTTAAAACAGACAGCACCAGG - Intronic
1124713826 15:32038891-32038913 CTTCCAAAACAGAAAGCAACAGG - Intronic
1125144532 15:36451419-36451441 GTCACAAAACAGAAAGAACTGGG + Intergenic
1125445384 15:39749259-39749281 CTTCCAAAAAAAAAAAAACCAGG + Intronic
1125817951 15:42602384-42602406 TCTTCAAAACACCAAGAACCTGG - Intronic
1126016516 15:44356579-44356601 CTTCCAAAGCAGGAAGCACCAGG + Intronic
1126159926 15:45601385-45601407 CTTCCAAAAAAGACAGTACCGGG - Intronic
1126530544 15:49705435-49705457 CGTGGAACACAGAAAGAACCCGG - Intergenic
1126643120 15:50848258-50848280 CTTGCAAATCAGAAAACACCAGG - Intergenic
1126658747 15:51010124-51010146 CTTCCAAAATAGAAAGCACGAGG - Intergenic
1127040064 15:54965080-54965102 CTTTCATGACACAAAGAACCTGG + Intergenic
1128596301 15:68953668-68953690 CTCTCAAAACAGAAACCTCCAGG - Intronic
1128667672 15:69550478-69550500 CTTTTAAAAGAGAAGGAAACTGG + Intergenic
1129040715 15:72684091-72684113 TTTTCAAGACACCAAGAACCTGG - Intronic
1129386430 15:75198647-75198669 TGTTCAAAACACCAAGAACCTGG - Intronic
1129545662 15:76392432-76392454 CTTTGAAAACCTAAAGAACCAGG + Intronic
1130582256 15:85148289-85148311 TTTTCAAAACAGAAAATGCCAGG + Intergenic
1130807293 15:87338153-87338175 CTTCCAAAATAGAAATCACCAGG + Intergenic
1131007948 15:88993867-88993889 CTCACAAAACAGAAAGAATATGG + Intergenic
1131100698 15:89687599-89687621 CTTACAAGACAGTAGGAACCAGG - Intronic
1131892632 15:96989174-96989196 CTTTCAGAACAGAGAGCACAAGG - Intergenic
1131964287 15:97823362-97823384 CTTCTAAAACAGAAAGTACCAGG - Intergenic
1132022851 15:98378875-98378897 CTTCCAAAATAGAAAGCACCAGG + Intergenic
1132412010 15:101587448-101587470 TTTTCAAAACTGAAAGTACCAGG + Intergenic
1132443347 15:101890806-101890828 CTCTCATAAAAGAAAGACCCAGG - Intergenic
1132487597 16:203239-203261 CTTCCAAAACAGAAAGCATCAGG + Intronic
1133034260 16:3026229-3026251 CCTTCAAAAGAGAAAATACCAGG - Exonic
1133163064 16:3925040-3925062 TTTCCAAAACAGAAAGTGCCAGG + Intergenic
1133623271 16:7546542-7546564 CTCTCAAAAGATAAACAACCAGG - Intronic
1133763889 16:8821812-8821834 CTTTCAAAACATCATGACCCTGG + Intronic
1134151668 16:11810197-11810219 TTTTCAAAACGTCAAGAACCTGG - Intergenic
1134210223 16:12270160-12270182 GTTTTAAAACTGAAAGAACGGGG - Intronic
1134606511 16:15575542-15575564 TGTTCAAAACACCAAGAACCTGG - Intronic
1135264768 16:21013948-21013970 CTTCCAAGAGAGAAAGTACCAGG + Intronic
1135501460 16:22999464-22999486 CTCTTAAAAAAGAAAGAAACAGG + Intergenic
1136078459 16:27834548-27834570 CTTTCAAAACAGAAATCTCCAGG - Intronic
1137329802 16:47481843-47481865 TTTTGAAAACAGGAAGAACTGGG - Intronic
1137437562 16:48469339-48469361 ATTCCAAAACAGAAAACACCAGG - Intergenic
1137473595 16:48785851-48785873 CTTTCTAAACAGAAAACACCAGG - Intergenic
1138065239 16:53934106-53934128 ATTTCACAACAGAACTAACCTGG - Exonic
1138592220 16:58007340-58007362 CTTCCAAAACAGAAGGCACCAGG - Intronic
1138746857 16:59373224-59373246 TTTTGAAAAAAGAAAAAACCTGG - Intergenic
1138812794 16:60170772-60170794 CTTTCAAGACAGAAGGAATACGG + Intergenic
1138904804 16:61318358-61318380 CTTCCAAAACAGAAATCGCCAGG + Intergenic
1139110717 16:63887272-63887294 CTTCAAAAACAGAAAGACCCAGG + Intergenic
1139121868 16:64029214-64029236 TTTCCAAAACAGAAAGCAACAGG - Intergenic
1139459620 16:67111113-67111135 ATTTCAAAAGAGAGAGAAGCGGG - Intronic
1139487089 16:67264069-67264091 CCTTCAAACCAGAGAGAATCGGG + Intronic
1139871132 16:70109452-70109474 CTATAAAAACATAAAAAACCTGG - Intergenic
1140041263 16:71409849-71409871 CTTTTTAAATAAAAAGAACCTGG + Intergenic
1140349706 16:74250737-74250759 CTTTGAAAACAGGAAGAGGCAGG + Intergenic
1140375738 16:74444420-74444442 CTATAAAAACATAAAAAACCTGG + Intergenic
1140495324 16:75381625-75381647 CTTGCCAAAGAGAGAGAACCTGG - Intronic
1140617752 16:76687686-76687708 CTTCCAAAACAGAAAGCACCAGG + Intergenic
1140623191 16:76761516-76761538 CATTAAAAAAAGAAAGCACCAGG + Intergenic
1141150149 16:81558902-81558924 CTTTCAAAGGACAAAGTACCTGG - Intronic
1141315282 16:82956733-82956755 CTTTCCAATGTGAAAGAACCTGG - Intronic
1141773997 16:86110229-86110251 CTCTCAAAACAGAAAAAAATTGG + Intergenic
1143308286 17:5966481-5966503 TTTCCAAAACAGAAAGCATCAGG - Intronic
1143565854 17:7720101-7720123 ATTTTAAGACAGAAAGAACAAGG - Intronic
1143791353 17:9298509-9298531 CTTTAAAAACCAAAAAAACCGGG + Intronic
1144238103 17:13282524-13282546 CTTTCACAACAGAAAAATCTAGG + Intergenic
1144277967 17:13694223-13694245 CATTCAAAGAAGAAAGCACCAGG - Intergenic
1145220210 17:21082399-21082421 TGTTCAAAACATCAAGAACCTGG + Intergenic
1146599038 17:34196774-34196796 CTTTCAGGAAAGAAAGAACAAGG + Intergenic
1146607229 17:34271081-34271103 TTTTACAAACAGAAAGACCCAGG + Intronic
1146745188 17:35322392-35322414 TGTTCAAAACACCAAGAACCTGG + Intergenic
1147223184 17:38952478-38952500 CTTTCCAACCAAAAAGAAACTGG - Intronic
1147354329 17:39881779-39881801 CTTCCAAGACAGAAAGCATCAGG - Intergenic
1147450961 17:40503692-40503714 CTTCCAAAACAGAAAGCACCAGG - Intergenic
1148535745 17:48437265-48437287 CTTACAAATCAGAAAGACCTGGG + Intergenic
1148797190 17:50202661-50202683 CAGTCAAACCAGAGAGAACCTGG + Intergenic
1149103458 17:52933735-52933757 ATCTCAAGAGAGAAAGAACCAGG + Intergenic
1149309910 17:55383631-55383653 CTTTCAAGATAAAATGAACCAGG - Intergenic
1149834090 17:59896483-59896505 CTTTCAAAAAAGAATAAACCTGG - Intronic
1150178158 17:63084110-63084132 CTTCCAAAACAGAAAGCACCAGG - Intronic
1150332386 17:64304681-64304703 GTTTAAAAACAGAAAGGGCCGGG - Intergenic
1150716814 17:67579216-67579238 CTGCCCAAACAGAAAGAGCCTGG - Intronic
1150839008 17:68590949-68590971 ATTTCCAAAAAGAAAGATCCTGG - Intronic
1151146004 17:72041897-72041919 CTTTCCCAACAGGAAGAACCTGG + Intergenic
1151497862 17:74469960-74469982 CACACAACACAGAAAGAACCAGG - Intronic
1152938914 17:83155394-83155416 ATTCCCAAACAGAAAGAGCCGGG - Intergenic
1153512549 18:5871234-5871256 CTTTCTGAACACAAAGAAGCCGG - Intergenic
1153751423 18:8235201-8235223 CTTTCAAAACATGAAGTACCAGG - Intronic
1153792389 18:8590889-8590911 CTTCCAAAACAGAAAGCACCAGG + Intergenic
1153942843 18:9992152-9992174 ATTTCAAGACAGAAAGACCTAGG - Intergenic
1154029025 18:10734287-10734309 TTTTAAAAGCAGAAGGAACCTGG + Intronic
1154088685 18:11335520-11335542 CTTTCAAAACTAAAAGTAACAGG - Intergenic
1154232171 18:12566712-12566734 CTTCCAAAACAGAAAGCACCAGG + Intronic
1154532264 18:15359166-15359188 CTTTCCAAACATAAAAAAACAGG + Intergenic
1154937069 18:21071750-21071772 CATTAAAAAAATAAAGAACCAGG + Intronic
1155022907 18:21912796-21912818 ATTTGCAAACACAAAGAACCCGG - Intergenic
1155640105 18:28003334-28003356 ATTTCAAAAAAGATAAAACCTGG + Intronic
1155876958 18:31101045-31101067 CTTTAAAGAAAGAAAGAACCTGG + Intronic
1155904462 18:31432658-31432680 CTTTCCAAACAGAAAGCAACAGG + Intergenic
1156150585 18:34237013-34237035 CTTGTAAAATAGAAGGAACCAGG - Intergenic
1156515122 18:37672778-37672800 TTTTGAAAACAGATAGATCCAGG - Intergenic
1156671770 18:39479375-39479397 CTTTCAAAACAGGAAGAGCAAGG - Intergenic
1157175894 18:45451832-45451854 CTTTCAAAACAGAATGTACTTGG - Intronic
1158625990 18:59072096-59072118 TGTTCAAAACACCAAGAACCTGG + Intergenic
1158679906 18:59557847-59557869 TGTTCAAAACACCAAGAACCTGG + Intronic
1158815594 18:61091936-61091958 CTTTCAAAATGGAAAGCAACAGG - Intergenic
1159425758 18:68283886-68283908 CTATCATAAGAGAAAGAACACGG - Intergenic
1159907687 18:74112052-74112074 CTTGTAAAACAGAAAACACCAGG + Intronic
1160201774 18:76802029-76802051 CTTTCAACCCGGAAGGAACCTGG + Intronic
1160401803 18:78616194-78616216 ATTAAAAAACAGAAAGAAACAGG + Intergenic
1161901440 19:7122574-7122596 CTTTGAAAACATAACGACCCAGG - Intronic
1162653037 19:12105754-12105776 CCTTCAAAATAGAAATAATCAGG - Intronic
1164460723 19:28445414-28445436 CGTTCAAAACACCAAGAACCTGG + Intergenic
1164692164 19:30219567-30219589 CTTACAAAACAGAAAGGTGCTGG + Intergenic
1164790681 19:30976612-30976634 CTTTCAGAAAATAAAGCACCAGG - Intergenic
1165266777 19:34667720-34667742 TGTTCAAAACAGCAAGAACCTGG + Intronic
1165283980 19:34822931-34822953 CTTCCAAAACAGAAAGCACTAGG + Intergenic
1165533550 19:36423854-36423876 TGTTCAAAACATCAAGAACCTGG - Intergenic
1165589807 19:36958390-36958412 CTTCCAAAATAGAAAGCATCAGG - Intronic
1166194521 19:41197208-41197230 ATTACAAAACAGAAGGAGCCTGG + Intronic
1166550165 19:43660471-43660493 CTTTAAAAAAAAAAAAAACCAGG - Intronic
1166713041 19:44949216-44949238 CCTTCAGCACAGAAAGAACTTGG - Exonic
1166847416 19:45737468-45737490 CTGTCTAAAAAGAAAGAGCCAGG - Intronic
1168670259 19:58236206-58236228 TTTTGAAAACAGAAACAGCCAGG + Intronic
1202655533 1_KI270708v1_random:17118-17140 CATTCAGAACAGAAACAACAGGG + Intergenic
925447699 2:3942076-3942098 ATTTCAAAACAGAGAGAAATGGG - Intergenic
925563328 2:5222223-5222245 CTATGAAAACAAAAACAACCAGG - Intergenic
925937719 2:8782537-8782559 TTTTCAAAACAGAAAGCACCAGG + Intronic
925941095 2:8819846-8819868 TTTTCAAAAAAGGAAGTACCAGG + Intronic
926262636 2:11280778-11280800 CTTCCAAAACAGAAAGCATGAGG + Intronic
926432906 2:12807772-12807794 CTTTGAACACAGGCAGAACCAGG + Intergenic
926728854 2:16019568-16019590 GTTTCTAAGCAGAAGGAACCTGG - Intergenic
927037727 2:19197559-19197581 ATTTCAAAACAGAAAACACCAGG + Intergenic
927333258 2:21891017-21891039 CTCTCAAGGCAGAAAGAAACTGG - Intergenic
927550462 2:23994172-23994194 CTTTCAAAAGAGCAAGAAAAAGG - Intronic
927625769 2:24716764-24716786 CTTTCAAAACAGAAATCACTAGG + Intronic
927727958 2:25442545-25442567 TTGTCAAAACAGACAGAACTGGG + Intronic
927771024 2:25861478-25861500 CTTTCAAAACAGAAAGCCTCAGG + Intronic
927902820 2:26833621-26833643 CTTCCAAAAAAGAAAACACCAGG + Intergenic
928157352 2:28888760-28888782 GTATCAAAACAGAAATAAGCCGG + Intergenic
928452759 2:31391936-31391958 CCTTTAACACAGAAAGCACCAGG - Intronic
928735689 2:34285881-34285903 TTTACAAAACAGAAAAAATCAGG + Intergenic
929066914 2:37986318-37986340 TTTCCAAAACAGAAAGCATCAGG + Intronic
929179380 2:39018435-39018457 ATTTTCAAACAGAAATAACCAGG + Intronic
929900422 2:45996945-45996967 CTTCCAAAACAGAAAGCACTAGG - Intronic
932089673 2:68794901-68794923 CTTCCAAAAAAGAAAAACCCAGG - Intronic
932712090 2:74073848-74073870 ATTTCAAGACAGAGAGAAGCAGG - Intronic
932916123 2:75859967-75859989 CATTCAAAGCAGAAAGAATTAGG - Intergenic
933057310 2:77687148-77687170 CTTCCAAAAAAGAAAAATCCCGG - Intergenic
933896580 2:86815834-86815856 AATTCAACACAGAAAGAGCCAGG + Intronic
933927450 2:87108348-87108370 CTTCCAAAAAAGAAAAATCCTGG - Intergenic
934011792 2:87827360-87827382 CTTTTAAATCAGAGATAACCTGG + Intergenic
934126268 2:88894289-88894311 CTTTCAAAACAGAAAACACCAGG - Intergenic
934484380 2:94689497-94689519 CCTGCTAAACAGAAAGCACCAGG - Intergenic
934611921 2:95745515-95745537 CTTTCAAAATAGAAAGCACCAGG + Intergenic
934649057 2:96078376-96078398 CTTTCAAAACATAAAGTACCAGG - Intergenic
934694701 2:96391234-96391256 CTTTCAAAACAGTAAAATACTGG - Intergenic
935469971 2:103447188-103447210 TTTTCAAAACAGAAATATTCTGG - Intergenic
935750548 2:106229477-106229499 CTTCTAGAACAGAAAGTACCAGG - Intergenic
936069985 2:109361438-109361460 CTTTCAAAACAGAAAGAACCAGG - Intronic
936120660 2:109740920-109740942 CTTCCAGAACAGAAAGTACCAGG + Intergenic
936144644 2:109972231-109972253 CTTTCAAAATGGAAAGGAACAGG + Intergenic
936181329 2:110270194-110270216 CTTTCAAAATGGAAAGGAACAGG + Intergenic
936200043 2:110399238-110399260 CTTTCAAAATGGAAAGGAACAGG - Intergenic
936224037 2:110630540-110630562 CTTCCAGAACAGAAAGTACCAGG - Intergenic
937019668 2:118638932-118638954 CGTTCAAAACGCCAAGAACCTGG + Intergenic
937086406 2:119174716-119174738 CTTTCCAGACACAACGAACCCGG - Intergenic
937542623 2:122977416-122977438 CTTCCAAAACAGAAAGCACCAGG + Intergenic
937721729 2:125105276-125105298 TTTTTAAAACAGAAAGCACCTGG - Intergenic
937970883 2:127547947-127547969 CTTTCAAAAAAGGAAGCACCAGG - Intronic
938193192 2:129301055-129301077 CTTCCCAAACAGAAAGACCAAGG + Intergenic
939236864 2:139505225-139505247 CTTCCAAAACAGAAAGCACCAGG + Intergenic
939432881 2:142133096-142133118 CTTTCAGAAGAGGAAGAATCTGG - Intergenic
939466577 2:142563434-142563456 TGTTCAAAACAGGAAGGACCTGG + Intergenic
940163767 2:150744222-150744244 CTTCCAAAACACAAAGCACCAGG + Intergenic
940239908 2:151551374-151551396 AATTCAGAAGAGAAAGAACCTGG - Intronic
940410213 2:153354025-153354047 CTTCCAAAACAGAAAGTACCAGG - Intergenic
940472969 2:154122551-154122573 CTTCCAACAAAGAAAGCACCAGG - Intronic
940508079 2:154581181-154581203 TTTTCAAAACAGGAAGCAACAGG + Intergenic
940714104 2:157199131-157199153 CTTCCAAAACAGAAAACACCAGG + Intergenic
940805247 2:158180051-158180073 CTTTCAAAAGAGTAGGCACCTGG + Intronic
941058835 2:160821740-160821762 CTTTCAAAGCAGAAACCACCAGG - Intergenic
941060404 2:160840902-160840924 CTTCCAAAACAGAAAGCACCAGG + Intergenic
941402793 2:165051915-165051937 CTTTCAAAATAGAAAGAACCAGG + Intergenic
941603791 2:167570290-167570312 CTTCCAAAACAGAAAGCACCAGG - Intergenic
942155085 2:173120051-173120073 CTTTTAAAAAAGAAAGAAAGAGG - Intronic
943169137 2:184373259-184373281 TTTTCAAATCAGAAAGTACTAGG + Intergenic
943246858 2:185465072-185465094 TTTTCAAAACAGAAAGAACCAGG + Intergenic
943847405 2:192669570-192669592 TGTTCAAAACAACAAGAACCTGG - Intergenic
944185051 2:196939060-196939082 CTACCAAAACAGAAAGAAAAAGG + Intergenic
944364542 2:198902171-198902193 CTTTCCAAACAGCAAGAAGGAGG - Intergenic
944782230 2:203031125-203031147 ATTTCAAAACAATGAGAACCTGG - Intronic
945165975 2:206945999-206946021 CTTCTAAAACAGAAAGCACCAGG + Intronic
945309265 2:208291599-208291621 TTTCCAAAACAGAAAGCACCAGG - Intronic
945311532 2:208319084-208319106 CATTCAAAACAGAGATACCCTGG + Intronic
945519278 2:210803129-210803151 CTTGAAAAACAGAAATATCCTGG - Intergenic
945593765 2:211767195-211767217 TGTTCAAAACACCAAGAACCTGG + Intronic
945610043 2:211989232-211989254 CTTGCAAAAAAGAAACAGCCAGG + Intronic
946381625 2:219352809-219352831 CTTTCCACACAGACAGACCCAGG - Intergenic
946822401 2:223643813-223643835 TTTTCAAAAAAGAAAGAAAGAGG - Intergenic
946968025 2:225059575-225059597 CTTCCAAAACTGAAAGTGCCAGG - Intergenic
947030803 2:225791602-225791624 TTTCCAAAAAAGAAAGAACCAGG - Intergenic
947158865 2:227191850-227191872 CTTACAAAACACAAAGACCTTGG + Intronic
947233754 2:227918891-227918913 CTTTCAAAAAATAAAGAGCAGGG + Intronic
948175069 2:235936891-235936913 CTTTGAAATCAGAAAGATCTGGG - Intronic
948185795 2:236020276-236020298 CTTTGAAAACAGAGAGAATCTGG - Intronic
948736528 2:240011107-240011129 CTTTCAACAAAGAAAGAAAGGGG + Intronic
1168819655 20:764326-764348 CTTCCAAGTCAGAAAGCACCAGG - Intronic
1168988602 20:2073666-2073688 CTTCCAAAACAAAAAGCACCAGG + Intergenic
1169721862 20:8686857-8686879 CTTTCCCATCAAAAAGAACCAGG - Intronic
1169885815 20:10395913-10395935 TTTTGAAGACAGAAAGACCCAGG - Intergenic
1170378800 20:15732920-15732942 CTTCCAAAACAGAAAGCACCAGG - Intronic
1170416883 20:16153150-16153172 CTTTCAAAACAGAAAACACCAGG + Intergenic
1170751468 20:19151166-19151188 TTTTCAAAACAGAAAACACCAGG + Intergenic
1170754769 20:19190665-19190687 CTTTCAAAACATAAAGTACCAGG - Intergenic
1171011974 20:21513826-21513848 TTTTAAAAAGAGAAAGAAACTGG + Exonic
1171213747 20:23336813-23336835 TGTTCAAAACACCAAGAACCTGG + Intergenic
1171319410 20:24227438-24227460 CTTCGAAAGCAGAAAGCACCAGG + Intergenic
1171467785 20:25343221-25343243 CTTCCAAAACAGAAATCACTGGG + Intronic
1172246681 20:33450242-33450264 CTTTAAAAACAAAAAGAGGCTGG - Intergenic
1172809762 20:37638838-37638860 CTTTCAAGTCAGAGAGAAACAGG + Intergenic
1173275310 20:41575331-41575353 TGTTCAAAACACCAAGAACCTGG + Intronic
1174322516 20:49753133-49753155 CTGTCAGAACAGAAAGAGCTTGG + Intergenic
1174532582 20:51225711-51225733 TGTTCAAAACACCAAGAACCTGG - Intergenic
1174856197 20:54047694-54047716 TGTTCAAAACACCAAGAACCTGG - Intronic
1175055802 20:56196820-56196842 ATGTCAGAACAGAAAGAAGCTGG + Intergenic
1175162313 20:57018027-57018049 TTTTTAAAAAATAAAGAACCAGG + Intergenic
1175510765 20:59523995-59524017 TTTCCAAAACAGAAAGCAGCAGG + Intergenic
1175631221 20:60538025-60538047 CTTCTAAAAAAGAAAGCACCAGG + Intergenic
1175689164 20:61053220-61053242 CCTTGGAAACAGAAAGAACCTGG + Intergenic
1176312757 21:5162227-5162249 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312770 21:5162305-5162327 ATTTCAATACAGCTAGAACCAGG + Intergenic
1176312783 21:5162383-5162405 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG + Intergenic
1176632083 21:9149262-9149284 CATTCAGAACAGAAACAACAGGG - Intergenic
1177383692 21:20380337-20380359 CTTCCAAAACAGACAGCATCAGG - Intergenic
1177962557 21:27685695-27685717 CTTTGAAAAAAGAAAGCACCAGG - Intergenic
1178031559 21:28532915-28532937 CTTCCAAAACAGAAAGCATCAGG - Intergenic
1179026523 21:37683354-37683376 TTTTTAAAAAAGCAAGAACCTGG - Intronic
1179571460 21:42281090-42281112 CTTTGGTGACAGAAAGAACCGGG - Intronic
1179722785 21:43324930-43324952 CTTGCAAAACATTAGGAACCGGG - Intergenic
1179844254 21:44099569-44099591 ATTTCAATACAGATAGAACCAGG - Intronic
1179844265 21:44099647-44099669 ATTTCAATACAGATAGAACCAGG - Intronic
1179844278 21:44099725-44099747 ATTTCAATACAGCTAGAACCAGG - Intronic
1179844291 21:44099803-44099825 ATTTCAATACAGATAGAACCAGG - Intronic
1180134490 21:45853371-45853393 TTTTCAAAACGCCAAGAACCTGG - Intronic
1180168669 21:46045345-46045367 CTTCCAAAAAAGAAATATCCAGG + Intergenic
1180374526 22:12078389-12078411 CATTCAGAACAGAAAAAACAGGG + Intergenic
1180901658 22:19377363-19377385 ATTAGAAATCAGAAAGAACCAGG - Intronic
1180932701 22:19604228-19604250 TGTTCAAAACACCAAGAACCTGG + Intergenic
1181777025 22:25167046-25167068 CTTTGAAAACAGTAAGGAGCTGG + Intronic
1182056733 22:27362665-27362687 CTTCCAAAACAGAAAGCACTAGG - Intergenic
1182205865 22:28625737-28625759 CTTAGAAAAAAGAAAGAACAAGG + Intronic
1182640077 22:31759977-31759999 CTTTAAAACCAGAAAGAGGCTGG - Intronic
1183551558 22:38489970-38489992 CTTTCCTAGCAGAAAGCACCAGG + Intronic
1184055569 22:42045722-42045744 CTTCCAAAAAATAAAGCACCAGG + Intronic
1184127003 22:42494483-42494505 ATTTAAAAACAAAAAGAAACAGG - Intergenic
1185243282 22:49758296-49758318 CTCTCAATACATAAAGAACAGGG - Intergenic
949266415 3:2161819-2161841 CCATCAAAACAGCAAGAAACAGG - Intronic
949311090 3:2699021-2699043 CTTAAAAAAAAAAAAGAACCTGG + Intronic
949566818 3:5252907-5252929 CTCTTAAAACAAAAAGAATCTGG - Intergenic
949661572 3:6284679-6284701 CTTTCAGATGAGAAAGAATCAGG + Intergenic
949983395 3:9518535-9518557 CTTCCAAAAGAGAAAGCACCAGG - Intronic
950220926 3:11195622-11195644 CTTTCAAAAGGGCAAGAAGCAGG - Intronic
950245745 3:11416333-11416355 CTTCCCAAATAGAAAGCACCAGG - Intronic
950621335 3:14207880-14207902 CTTTTAACACCAAAAGAACCAGG + Intergenic
951134363 3:19086491-19086513 CTTTCAAAACAGAAAGCATCAGG + Intergenic
951465331 3:22994675-22994697 TTTTGAAAACAGAAATAACAAGG + Intergenic
951504577 3:23429153-23429175 TTTCCAAAACGGAAAGCACCAGG + Intronic
952133632 3:30392749-30392771 CATTCAAAGCAGAAGAAACCAGG + Intergenic
952287101 3:31980296-31980318 GTTTAAAAACAGAAAGAGGCCGG - Intronic
952482781 3:33778810-33778832 ATGGCAAAGCAGAAAGAACCTGG - Intergenic
952679214 3:36071958-36071980 TTTTCAAAAAAAAAAGCACCTGG + Intergenic
952735411 3:36686184-36686206 CTTCCAAAACAGAAAGAACCAGG + Intergenic
953610916 3:44446459-44446481 CTTCCAAAACAGAAAGGGCTGGG + Exonic
953767615 3:45755972-45755994 CATTTAAAAAAGAAAGAACATGG - Exonic
953943928 3:47128892-47128914 TTTTCAAGACAGAAGGTACCAGG + Intronic
954050949 3:47976797-47976819 CATTCACAACAAAAAGAACTTGG + Intronic
954495370 3:50954354-50954376 ATAACAATACAGAAAGAACCAGG + Intronic
954758076 3:52853331-52853353 ATTTCAAAAAAGAAAAAACAAGG + Intronic
954821658 3:53334460-53334482 CTTTCAAACCAATAAAAACCAGG - Intronic
955244841 3:57215466-57215488 CTTTAAAAACAGAAAAATGCTGG + Intronic
955514644 3:59714631-59714653 CTTTTAAAAAAGAAACAACAGGG - Intergenic
956339075 3:68200460-68200482 CTTCCCTAACAGAAAGCACCAGG - Intronic
956954573 3:74321904-74321926 TTTCCCAAACAGAAAGCACCAGG + Intronic
957016875 3:75075911-75075933 CTTTCAAAAAAGAAAGCACTAGG - Intergenic
957867788 3:86046836-86046858 CTTTCAAAACAGAAATATCTTGG + Intronic
958443788 3:94190126-94190148 CTTCCAACACAGATAGCACCTGG - Intergenic
958964061 3:100538328-100538350 CTTTTAAAAAAGAAAGACCTAGG - Intronic
959374508 3:105572064-105572086 CTTTCAAAACAGGAAGAGAGGGG + Intronic
959413397 3:106053702-106053724 CTTCCAAAACAGAAAATGCCAGG + Intergenic
959465007 3:106674931-106674953 TGTTCAAAACATCAAGAACCTGG + Intergenic
960226585 3:115176583-115176605 CTCCCAAAACAGAAAGTATCAGG + Intergenic
960743974 3:120865874-120865896 CTTTTAAAACTGAAAGAAGGAGG + Intergenic
960756232 3:121016799-121016821 CTTCCAAAACAGAAAGCACCAGG + Intronic
960893209 3:122473239-122473261 CTTCCAAAACAGAAAACACCAGG + Intronic
961014133 3:123454412-123454434 CTCTTAAAACAGAATGAACCAGG - Intergenic
961156470 3:124683888-124683910 CTTTCAGAATAAACAGAACCTGG + Intronic
961335442 3:126175250-126175272 CTTCCAAAATAGAAAGCACTAGG + Intronic
961863475 3:129936709-129936731 TGTTCAAAACACCAAGAACCTGG - Intergenic
962000764 3:131293723-131293745 CTTCCACATCAGAAAGCACCAGG - Intronic
962040319 3:131700603-131700625 CTTTCAAAAAAGGAAGAAAGAGG - Intronic
962841653 3:139238305-139238327 CTTTCCAAACAGTATGAACCCGG + Intronic
963014878 3:140813312-140813334 CTTTCAAAACAGAAAGTACCAGG + Intergenic
963232273 3:142920210-142920232 CTTCCAAAACAGAAACCATCAGG - Intergenic
963402856 3:144823365-144823387 TTTTCAAACCAGATAGAACATGG - Intergenic
963574030 3:147036942-147036964 GTTTCAAAACAGAAAGCACCAGG + Intergenic
963845681 3:150154579-150154601 CTTCCAAAACAGAAAGAAACAGG + Intergenic
964800351 3:160550269-160550291 CTTTCAAAACAAAACAAACAAGG - Intronic
964853039 3:161115646-161115668 CTTGCAAAATAGAAAGAAGCAGG + Intronic
965043250 3:163538539-163538561 ATTTCACAATAGAAAGAAACAGG + Intergenic
965114740 3:164474505-164474527 TATTAAAAACAGAAAGCACCAGG - Intergenic
965446912 3:168784716-168784738 CTTCCAAAACAGAAAGCAGTAGG + Intergenic
965828754 3:172758154-172758176 GTTTAAAAACAAAAAGAAGCGGG - Intronic
965849749 3:173009741-173009763 TGTTCAAAACACCAAGAACCTGG - Intronic
965873322 3:173286570-173286592 CTTTCAAAAAAGAAAACTCCAGG + Intergenic
965910191 3:173765486-173765508 ATTTCAAAACAGAAAGACAAGGG - Intronic
966226323 3:177601979-177602001 CAATCATAACAGAAATAACCTGG + Intergenic
966431282 3:179833585-179833607 ATTTCTAAACAGAATGAACTTGG - Intronic
966464813 3:180218589-180218611 CTTCTAAAACAGAAAGTACCAGG + Intergenic
966545744 3:181145564-181145586 TTTCCAAAACAGAAAGCACCAGG + Intergenic
966719744 3:183050257-183050279 CTTCCAAAACAGAAAGCACAAGG + Intronic
966745532 3:183272257-183272279 CCTTCACTACAGAAAGAACTAGG + Exonic
966940809 3:184745879-184745901 CTTTCAGATCAGAAAAAGCCAGG + Intergenic
967575264 3:191082626-191082648 CTTTCAAAACAGCAAAGACATGG + Intergenic
967995061 3:195160317-195160339 ATTTCAAAACAGAAAGACAGAGG - Intronic
968483690 4:848786-848808 CTCTGAAAACAGGAAGAGCCTGG + Intergenic
968535066 4:1120601-1120623 TTTCCAAAGCAGAAAGCACCAGG + Intergenic
968949376 4:3682708-3682730 TGTTCAAAACACCAAGAACCTGG + Intergenic
969337265 4:6519002-6519024 CTTCCCAAACAGAAAGTACCAGG + Intronic
969655623 4:8496301-8496323 TGTTCAAAACACCAAGAACCTGG + Intergenic
970175299 4:13333349-13333371 TGTTCAAAACACCAAGAACCTGG + Intergenic
970344241 4:15137769-15137791 CTGTCAAAACTGAAATAGCCTGG + Intergenic
971684944 4:29752517-29752539 ATTCCAAAAGAGAAAGCACCAGG + Intergenic
971927422 4:33030659-33030681 CTTTAAAAACAGCAAGGAACTGG - Intergenic
972103435 4:35450956-35450978 ATTCCAAAACAGAAGGTACCAGG + Intergenic
972896863 4:43632707-43632729 CCTGTAAAACAGAAAGAAACAGG - Intergenic
972912828 4:43839286-43839308 TTTTCCAAAAGGAAAGAACCAGG - Intergenic
972954346 4:44370610-44370632 CTTTCAAAGCAGAAATAAGGAGG + Intronic
973313722 4:48737490-48737512 CTTCCAAAAGAGAAAGCACCAGG + Intronic
973594735 4:52475934-52475956 CTTTGAAAAAAAAAAAAACCAGG + Intergenic
974332303 4:60496596-60496618 ATTTCAAAACACAAAGAAGGGGG - Intergenic
974475887 4:62379247-62379269 ACTTCAAAAAAGAAAAAACCAGG + Intergenic
974517625 4:62937370-62937392 CTTTGAAATCAGACAGACCCAGG - Intergenic
974602322 4:64099463-64099485 CTTTGAAAGCAGTAAGAATCAGG - Intergenic
974662492 4:64910722-64910744 CTTTCAAAAAAGAAAGTACCAGG - Intergenic
975639877 4:76489839-76489861 TGTTCAAAACACCAAGAACCTGG - Intronic
977111262 4:92958797-92958819 CTTTCCAAACAGAAAGTACAAGG - Intronic
977266068 4:94856393-94856415 CATAGAAAACAGCAAGAACCTGG + Intronic
977933256 4:102772058-102772080 CTTGCAAAACAGAAAGCACCAGG + Intergenic
977964548 4:103129227-103129249 TTTCCAAAACAGAAAGCACCAGG + Intronic
978054843 4:104250612-104250634 CTTTCAAAAGAGAAATAAACAGG + Intergenic
978526103 4:109667216-109667238 TTTCCAAAACAGAAAGCACCAGG - Intronic
978825034 4:113012197-113012219 CTATCAAAACAGAATGATTCAGG + Intronic
979030474 4:115638521-115638543 CTTTAAAAAAAAAATGAACCAGG + Intergenic
979706686 4:123728085-123728107 CCTTCAAAACAGAAATCACTAGG - Intergenic
980019338 4:127689833-127689855 CCTTTAAAAGAGAAAGACCCTGG + Intronic
980081297 4:128347293-128347315 CTTTTAAAAAAAAAAAAACCAGG + Intergenic
980099197 4:128524379-128524401 TTTTAAAAAAAGAAAGAACGGGG + Intergenic
980513055 4:133819093-133819115 CTTTCAAAATGGAAAGTATCAGG - Intergenic
980556928 4:134419625-134419647 CTTTCCAAACAGAGAGCTCCAGG - Intergenic
981082201 4:140646633-140646655 CTTCCAAAACAGAAAGTAAAAGG - Intronic
981555944 4:145993969-145993991 TTTGCAATACAGAAAGCACCAGG - Intergenic
981638767 4:146911717-146911739 CTTTCAAGACAGGAAGAAAAGGG + Intronic
982498564 4:156124503-156124525 CTTCCAAAACAGAAAGTACCAGG + Intergenic
982666209 4:158267296-158267318 TTTCCAAAACAGAAAGCACCAGG - Intergenic
982873984 4:160621870-160621892 CTTCCAAAACAGAAAGAACTAGG + Intergenic
983579687 4:169295381-169295403 TTTTCAAAATAGAAAGCACCAGG + Intergenic
983985050 4:174049443-174049465 TTTCCAAAACAGAAAGCACCAGG - Intergenic
984007941 4:174336203-174336225 CTGTGAAAATATAAAGAACCAGG - Intergenic
984307365 4:178011243-178011265 CTTCCAAAACAGAAAGCCTCAGG - Intergenic
984321372 4:178201059-178201081 ATTCCAAAACAGAAAGCACAAGG + Intergenic
984442033 4:179783736-179783758 CTTCCAAAAGAGAAAACACCAGG - Intergenic
984687141 4:182682170-182682192 CTTATAAAAAAGAAGGAACCAGG + Intronic
985231503 4:187822900-187822922 CTTTATAAACTGAAAGAAACTGG + Intergenic
985395618 4:189540320-189540342 ATGACAAAAAAGAAAGAACCAGG + Intergenic
1202756110 4_GL000008v2_random:63828-63850 CATTCAGAACAGAAAAAAACAGG + Intergenic
985567486 5:627123-627145 CTTCCAAAACAGAAAGTACCAGG - Intronic
985690768 5:1310939-1310961 AGTTCAAAACACCAAGAACCTGG - Intergenic
985759723 5:1740901-1740923 TTCCCAAAACAGAAAGCACCAGG - Intergenic
986035845 5:3937562-3937584 CTTTCAAAACATAAAGCACCAGG - Intergenic
986262534 5:6160769-6160791 CTTTTAAAACAGAAGGAAAGTGG + Intergenic
986538710 5:8820489-8820511 TTTACAAAACAGAAAGCACCAGG - Intergenic
986629789 5:9760209-9760231 CTTACAAAACAGAAAGGACCTGG + Intergenic
986940363 5:12940836-12940858 TTTCCAAAACAGGAAGCACCAGG + Intergenic
987273014 5:16332169-16332191 TTTCCAAAACAGAAAGCTCCAGG + Intergenic
987454474 5:18126165-18126187 CTTTGATAACAGAAAAAAGCTGG - Intergenic
987518066 5:18940884-18940906 CTTTCAAAAAAGAAAGCTCTTGG + Intergenic
988297393 5:29383228-29383250 TGTTCAAAACACCAAGAACCTGG + Intergenic
988310139 5:29546642-29546664 CTTTCAAAATAGAAAAGGCCTGG - Intergenic
988598187 5:32614631-32614653 ATTTCAAAACAAAAAGAACTTGG - Intergenic
988647874 5:33114911-33114933 CTTCCAAAACAGAAAGCACCAGG - Intergenic
989249576 5:39294577-39294599 CTTTCAACAAAGAAAGGTCCAGG + Intronic
989367676 5:40675079-40675101 CTTTCAAAACTGACAACACCTGG + Intergenic
989776588 5:45215896-45215918 CTTCCTAAAGAGAAAGCACCAGG + Intergenic
990078071 5:51875316-51875338 CTTCCAAACCAGAAAGTACTAGG - Intergenic
990688255 5:58332910-58332932 TCTTCAAAATAGCAAGAACCTGG - Intergenic
991322990 5:65396963-65396985 CTTCCCAAACAGAAAGCACTAGG - Intronic
992309288 5:75478723-75478745 GGTTCAAAACAGAAAGATCAAGG + Intronic
992533588 5:77675107-77675129 CTTCAAAAACAGAAAGCACCAGG + Intergenic
992544621 5:77800009-77800031 CTTTCAAAACAGAAAGCACAAGG + Intronic
992601145 5:78401457-78401479 CTTCCAAAACAGAAGGTAACAGG - Intronic
992694405 5:79271506-79271528 CTTCCAAAACAGAATGCATCAGG - Intronic
992957143 5:81921833-81921855 CTTCAAAAACAGAATGAAACTGG - Intergenic
993163295 5:84317631-84317653 CTATCAAAATAGAAAGTATCTGG - Intronic
993977406 5:94499255-94499277 GGCACAAAACAGAAAGAACCTGG - Intronic
994346978 5:98698237-98698259 TTTTCAATAAAGAAAGAATCAGG - Intergenic
995298129 5:110543096-110543118 TGTTCAAAACACCAAGAACCTGG + Intronic
995311939 5:110723137-110723159 CTTCCAAAACAGAAAGTACCAGG - Intronic
995656351 5:114431217-114431239 CTTCCAAAACAGAAAGCCCCAGG - Intronic
995936675 5:117524459-117524481 CTTTGAAAATGGAGAGAACCTGG - Intergenic
996243583 5:121232377-121232399 TGTTCAAAACACCAAGAACCTGG - Intergenic
996433570 5:123408633-123408655 CTTCCCAAACAGAAAGTACCAGG + Intronic
996901612 5:128548223-128548245 TTTCCAAAAAAGAAAGTACCAGG + Intronic
996924286 5:128805373-128805395 CCTTCCAAACAGAAAGTGCCAGG - Intronic
997094185 5:130892153-130892175 TATTCTAAGCAGAAAGAACCGGG + Intergenic
997984298 5:138491209-138491231 CTGTGAAGGCAGAAAGAACCTGG - Intergenic
998160439 5:139809947-139809969 CTTTCAAAACACCCAGAATCTGG - Intronic
998211782 5:140205120-140205142 TCTTCAAATCACAAAGAACCAGG - Intronic
998714018 5:144860827-144860849 TTTTTAAAACAGAAAGCAGCAGG - Intergenic
998854113 5:146378219-146378241 GTCTCAAAATAAAAAGAACCTGG - Intergenic
998949940 5:147383256-147383278 CTGGCAAAACAGGAAGCACCAGG - Intronic
999045362 5:148462530-148462552 CTTTCAAAACAGAAAGTACCAGG + Intronic
999552331 5:152702959-152702981 CTGTCAAAACAGAAAACTCCAGG - Intergenic
999564808 5:152846937-152846959 CTCCTAAAACAGAAAGCACCAGG - Intergenic
999580047 5:153028306-153028328 CTTTCAAAACAGAAAGCACCAGG + Intergenic
999799037 5:155016160-155016182 CCTTGAAGACAGAAAGATCCTGG + Exonic
999834014 5:155349769-155349791 TTTCCAAAACAGAAAACACCAGG + Intergenic
1000251243 5:159497607-159497629 CAATCAAAACAGAGAGGACCGGG + Intergenic
1000778442 5:165448404-165448426 CTTTTCCAAAAGAAAGAACCAGG + Intergenic
1001053601 5:168431704-168431726 CTTTTAAAACTGCCAGAACCTGG + Intronic
1001316629 5:170646107-170646129 CTTTCGAAACAGAAAGCACCAGG + Intronic
1001967953 5:175926326-175926348 CTTCCAAAACAGAAAACATCAGG + Intronic
1002009033 5:176261839-176261861 CTTCCAAAACAGAAAGCCCCAGG + Intronic
1002217689 5:177650439-177650461 CTTCCAAAACAGAAAGCCCCAGG - Intergenic
1002249492 5:177917475-177917497 CTTCCAAAACAGAAAACATCAGG - Intergenic
1002735279 5:181382133-181382155 CTCTCATAAAAGAAAGACCCAGG - Intergenic
1002749240 6:91993-92015 CTCTCATAAAAGAAAGACCCAGG + Intergenic
1002877988 6:1227953-1227975 CTTTCCAAACAGCATGCACCTGG + Intergenic
1003198418 6:3935946-3935968 CTTCCAAAACAGAAAGCAGCAGG - Intergenic
1004772836 6:18804790-18804812 CCTTCAAAACAGAAAGTACCAGG - Intergenic
1004952310 6:20687300-20687322 ATTCTAAAACAGAAAGCACCAGG - Intronic
1005051733 6:21690470-21690492 CGTTTAAAACAAAAAGAAACAGG + Intergenic
1005222622 6:23605105-23605127 CTTCCAAAGCAGAAAGTTCCAGG + Intergenic
1005228263 6:23668816-23668838 CTCCCAAAACAGAAAGCTCCAGG - Intergenic
1005372068 6:25144028-25144050 CTTCTAAAACAGAAAGCATCAGG + Intergenic
1005432814 6:25776392-25776414 CTTGCAAAAAAAAAAGAACAAGG - Intronic
1005610109 6:27515391-27515413 CTATCAAAACACAAAGAAGCAGG - Intergenic
1005886261 6:30100326-30100348 CTTTTCCAACAGAAAGTACCAGG + Intergenic
1006807868 6:36800163-36800185 CTTTCATAACTGCCAGAACCAGG - Intronic
1007455173 6:41971543-41971565 ATCTCAAAAAAAAAAGAACCTGG - Intronic
1008186096 6:48392391-48392413 CTTCCAAAACAAAATGCACCAGG + Intergenic
1008390715 6:50948214-50948236 CTTCTGAACCAGAAAGAACCAGG - Intergenic
1008439229 6:51513824-51513846 CTTTCAAAGGATAAAGGACCAGG - Intergenic
1008789668 6:55215251-55215273 CTTGCAAAACAGAAATAAGTGGG + Intronic
1009418016 6:63437030-63437052 CTGTCAAAAAAGAAAGAAAAGGG + Intergenic
1009469943 6:64019707-64019729 CATTTAAAAAAGAAAGAACGAGG - Intronic
1009569113 6:65358397-65358419 TTTTAAAAACAGAAAGTCCCAGG - Intronic
1009737449 6:67695199-67695221 GTTTCAAAACAGAATGTACCAGG + Intergenic
1010137144 6:72568883-72568905 TCTCCAAAACAGAAAGCACCAGG + Intergenic
1010203760 6:73305532-73305554 CATCCAAAACAGAAAGGACCTGG + Intronic
1010671444 6:78691479-78691501 CTTTGAAAACAGTCAGAACTGGG - Intergenic
1010825320 6:80465962-80465984 CTGGCAAAATGGAAAGAACCAGG + Intergenic
1011007528 6:82663761-82663783 TTTTAAAAAAAGAAAGCACCTGG + Intergenic
1011069691 6:83366481-83366503 CCTTCAAAAAAGAAGGAAACAGG + Intronic
1011106651 6:83789110-83789132 CTTGTAAGACAGAAAGAGCCTGG - Intergenic
1011505297 6:88035307-88035329 CTGTCAAAACAGAAAGCACCAGG - Intergenic
1011651492 6:89510425-89510447 CTTTATATACAGAAAGCACCTGG + Intronic
1011874844 6:91945476-91945498 TTTCCAAAACAAAAAGCACCAGG + Intergenic
1012638043 6:101571930-101571952 CTTACAAAACAGAAAAAAGGTGG + Intronic
1012711977 6:102618110-102618132 TGTTCAAAACACCAAGAACCTGG + Intergenic
1012891866 6:104906127-104906149 CTTTCAAAACAGAAAGCACTAGG - Intergenic
1013114498 6:107091666-107091688 CTTCCAAAACACAAAGTACCAGG + Intronic
1013156366 6:107494101-107494123 CTTTCTAATCAGGAAAAACCAGG - Intronic
1013720565 6:113022339-113022361 CTTCCAAAATAGAAAATACCAGG + Intergenic
1013863911 6:114670970-114670992 CTTCAAAAACAGAAAGCAGCAGG - Intergenic
1014174643 6:118318663-118318685 TTTTCTTAAGAGAAAGAACCGGG + Intergenic
1014228332 6:118873640-118873662 CTTCCAAAACACAAAACACCAGG + Intronic
1014423869 6:121278123-121278145 CTTCCAAAATAGAAAACACCAGG + Intronic
1014497863 6:122149393-122149415 TTTTCAAAACAGAAAGCAACAGG - Intergenic
1014654710 6:124086795-124086817 CTTTCAAAACAGAAAGCACCAGG + Intronic
1014950603 6:127550295-127550317 CTTTCAAGAAAGAAAGCACCAGG + Intronic
1015105726 6:129533736-129533758 TGTTCAAAACACCAAGAACCTGG + Intergenic
1015392400 6:132697252-132697274 CTTTGAAGACAGAAGCAACCTGG + Intronic
1015886478 6:137923483-137923505 CTTCCAGTAGAGAAAGAACCAGG + Intergenic
1016252880 6:142067941-142067963 TTTGCAAAGCAGAAAGAGCCTGG - Intronic
1016339437 6:143046279-143046301 CTTCTAAAACAGAGGGAACCAGG + Intergenic
1016970666 6:149759209-149759231 TTTTCAGTACAGAAAGTACCTGG + Intronic
1018097517 6:160403411-160403433 TTTTCAAAACAGGAAGCACCAGG + Intronic
1019114321 6:169745900-169745922 CTTCCAAAGCAGAAATCACCAGG - Intronic
1019239544 6:170654446-170654468 CTCTCATAAAAGAAAGACCCAGG - Intergenic
1020854514 7:13400874-13400896 CATTCAAATCAGAATGAAGCAGG + Intergenic
1020980227 7:15057589-15057611 CTTTTAAAACAGAGATCACCAGG + Intergenic
1021226875 7:18038041-18038063 TGTTCAAAACATCAAGAACCTGG + Intergenic
1021272107 7:18602087-18602109 CTTCCAAAAAGGAAAGCACCAGG - Intronic
1021500475 7:21327899-21327921 TGTTCAAAACACCAAGAACCTGG - Intergenic
1021548778 7:21846830-21846852 CTTTCAAAACAGAAAGCACCAGG - Intronic
1021651384 7:22836938-22836960 TGTTCAAAACACCAAGAACCTGG + Intergenic
1021789061 7:24181822-24181844 CTTTCAAAAAAAAGAAAACCTGG + Intergenic
1022288904 7:28982040-28982062 CTATCAAAACAGGAAGAACATGG + Intergenic
1022457571 7:30572436-30572458 TGTTCAAAACACCAAGAACCTGG - Intergenic
1023037416 7:36144603-36144625 TTTCCAAAACAGAAAGCACCAGG + Intergenic
1023210708 7:37801600-37801622 ATTTCAAAACAGAGAGCACCAGG - Intronic
1023553624 7:41396647-41396669 CTTCCAAAACTGAAAGCAGCAGG - Intergenic
1023878129 7:44302264-44302286 TTTCCAAAACAGAAAGCACCAGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025988792 7:66478914-66478936 ATTTCAAAAAAAAAAGAAGCAGG + Intergenic
1026042959 7:66884179-66884201 ATTTCAGAACAGAAATAATCTGG - Intergenic
1026353830 7:69540248-69540270 TGTTCAAAACACCAAGAACCTGG - Intergenic
1026557067 7:71417783-71417805 CTTTCAAAACTGAAAGGACATGG + Intronic
1027602586 7:80257353-80257375 CTTGCTAAACACAGAGAACCTGG - Intergenic
1027959589 7:84928547-84928569 ATTTTAAAACAGTAAGTACCAGG + Intergenic
1028002992 7:85524813-85524835 CTTTCAAAACAGATAGTAAAAGG - Intergenic
1028197536 7:87924562-87924584 ATTTCAAAAAAGAAAGAAAGAGG + Intergenic
1028653159 7:93173045-93173067 CTTTCAAAAAAGAAAGCACCAGG + Intergenic
1028764502 7:94537032-94537054 CTTTCAAAACAGAAGATACCAGG - Intronic
1030045164 7:105488837-105488859 TTTTCAACACAGAAAGAACTAGG - Intronic
1030115953 7:106062439-106062461 CGTTCAGAACACCAAGAACCTGG - Intergenic
1030423585 7:109341557-109341579 CTTCCAAAAGAGAAAGCACCAGG - Intergenic
1030722701 7:112887571-112887593 CTTTTAAAACAGGAAGCACCAGG - Intronic
1030834979 7:114272507-114272529 CTCCCAAAATAGAAAGCACCAGG - Intronic
1031113002 7:117634120-117634142 CTTCCAAAACAGAAAGCACCAGG - Intronic
1031859416 7:126960779-126960801 CTTTCAAAACAGGAATAGCCTGG - Intronic
1031922160 7:127610058-127610080 CTTTCAAAAGGGAAAGAATTTGG + Intergenic
1032082079 7:128864408-128864430 CTTTCTGCACAAAAAGAACCTGG - Intronic
1032099224 7:128959368-128959390 TTTTCAGAACAGATAGAAACAGG + Intronic
1032161684 7:129515840-129515862 CTTTAAAAGCAGCAAGAATCAGG - Intergenic
1032359832 7:131244982-131245004 CTTACAAAACAGAAAGCATTGGG - Intronic
1032457572 7:132085214-132085236 TGTTCAAAACACCAAGAACCTGG + Intergenic
1033085533 7:138338177-138338199 TTTTCAAAATAGAAAGATCAAGG - Intergenic
1033262421 7:139855344-139855366 CATTCTAAACACACAGAACCTGG + Intronic
1033985240 7:147217773-147217795 TTTCCAAAACAGAAAGCATCAGG - Intronic
1034009530 7:147513890-147513912 CTTCCAAAACAGAAAAATCCAGG - Intronic
1034019719 7:147628295-147628317 CTTACAAGACAGAAAGAATTGGG + Intronic
1034072305 7:148198215-148198237 GCTTCAAAAGAGAAAGAACAGGG - Intronic
1034466512 7:151232914-151232936 GTCTCAAAACAGAAATAAACTGG - Exonic
1034568653 7:151936580-151936602 CTGTGAAAAGAGAAAGAACTTGG + Intergenic
1035508228 8:152161-152183 CTCTCATAAAAGAAAGACCCAGG + Intergenic
1036036410 8:5024594-5024616 CTTCCCAAACAGAAAGTAGCTGG + Intergenic
1036114503 8:5944082-5944104 CTTTGAAAGCAGGAAGAACTGGG - Intergenic
1036387792 8:8296888-8296910 ATTTCAAATCAGAAAGAAACTGG - Intergenic
1036407404 8:8467455-8467477 CTTTGAAAATAGAAAGACGCGGG + Intergenic
1036467054 8:9009010-9009032 CCTTCATAACAGAAAGAATCGGG - Intronic
1037254520 8:16938419-16938441 CTCCCAAAACAAAAAGGACCAGG + Intergenic
1037601487 8:20399557-20399579 CTTCCAAAAAAGAAAGACCCAGG + Intergenic
1038084730 8:24182923-24182945 CTTTCCAAACATAAAGTACTAGG + Intergenic
1038304672 8:26388668-26388690 CCTTCAAAAAAGTAAAAACCAGG + Intronic
1038323642 8:26553164-26553186 CTTCCAAAACCGAAAGCACCAGG + Intronic
1038565139 8:28613611-28613633 CTTCCAAAACAGAAAGCACCAGG - Intronic
1038656498 8:29457336-29457358 CTTGCAAAACTAGAAGAACCAGG + Intergenic
1038752581 8:30310369-30310391 CTTTCAAAACAGAAATCACCAGG - Intergenic
1038768848 8:30457159-30457181 CTCTCAAAACTGTCAGAACCTGG - Intronic
1038839635 8:31171140-31171162 CTTTGAAACCAGGCAGAACCAGG - Intronic
1038975758 8:32693931-32693953 CTTTCAAAACAGAATCAAAGAGG - Intronic
1039176309 8:34810810-34810832 CTTCCAAAAAAAAAAAAACCTGG + Intergenic
1039216571 8:35278413-35278435 TTTTCACAACAAAAAGAACAAGG - Intronic
1039320332 8:36423258-36423280 ATTACGAAACAGAAAGAACTTGG - Intergenic
1039422733 8:37457741-37457763 TATTCAACACAGAAAGATCCAGG - Intergenic
1039671098 8:39599483-39599505 CTTCCACAACAGGAAGCACCAGG - Intronic
1039730979 8:40277262-40277284 CTTTGAAAACAGAAGACACCAGG - Intergenic
1040624240 8:49127683-49127705 CTTCCAAAACAGAAAGCATCAGG - Intergenic
1040699916 8:50050464-50050486 CTTCCAAAACAAAAAGCACCAGG + Intronic
1041033609 8:53764042-53764064 CTTACAAAACAGAAAGCAACAGG + Intronic
1041093108 8:54322284-54322306 CTTTCAAAGCACAAAGCACCAGG + Intergenic
1041113524 8:54510613-54510635 CTTTCAAAACATAGGGAAACAGG - Intergenic
1041339527 8:56828528-56828550 GTTCCAAAACAGACAGCACCAGG + Intergenic
1043412858 8:80017613-80017635 CTTCCAAAACAGAAAGCCCCAGG + Intronic
1043592121 8:81844314-81844336 CGTTCAAAACACCAAGAACCTGG + Intergenic
1043593091 8:81852485-81852507 TGTTCAAAACATCAAGAACCTGG + Intergenic
1044051258 8:87508016-87508038 ATTTCATATCAAAAAGAACCTGG + Intronic
1044789256 8:95829980-95830002 CATCCAAAATAGAAAGTACCAGG + Intergenic
1044975147 8:97657153-97657175 TTTTAAAAAAAGAAAGATCCAGG + Intronic
1045400698 8:101814024-101814046 CTTACAAAATAGAAAACACCAGG + Intronic
1045409236 8:101899996-101900018 CTCCCAAAACAGAAAGTTCCAGG - Intronic
1045538357 8:103057014-103057036 TGTTCAAAACACCAAGAACCTGG - Intronic
1045609225 8:103816015-103816037 CTGTCAGAACAGAAAGAACATGG - Intronic
1046502049 8:115090566-115090588 CTTCCAAAACTGAAAGTACTTGG - Intergenic
1046621573 8:116534082-116534104 CATTGAAAACAGAAAGAAAAAGG + Intergenic
1046825244 8:118683007-118683029 CTTCCAAAACAGAAAAAAAAAGG - Intergenic
1047467385 8:125130551-125130573 CTTTCCAATCAAAAAGAACCAGG - Intronic
1047832908 8:128655763-128655785 CTTTCAAGGAAGAAAGAACAGGG - Intergenic
1048134362 8:131733288-131733310 CTTTCATAAGAGAAAGCACCAGG + Intergenic
1048388881 8:133941138-133941160 CTTCCAAAACAGAAAGCATCAGG + Intergenic
1048487339 8:134860495-134860517 CTCTCAAAACAGAAAAAAACAGG - Intergenic
1048548661 8:135412666-135412688 CTTTCAGAAAAGAAAGCACCAGG - Intergenic
1048721467 8:137330686-137330708 CTATAAAATAAGAAAGAACCTGG + Intergenic
1048930532 8:139311888-139311910 CTGTCAAGACAGAAAGCACATGG + Intergenic
1050111731 9:2223848-2223870 CTTCCAAAACAGAAAGCACCAGG - Intergenic
1050440461 9:5656337-5656359 CATCCAAAACAGAAAGAACCAGG - Intronic
1050695340 9:8273353-8273375 CTTCCAAAACAGAAAGCACCAGG - Intergenic
1051231689 9:14961878-14961900 TGTTCAAAACACTAAGAACCTGG + Intergenic
1051462000 9:17329652-17329674 CTCTCAAAAAAGAAAAAAGCAGG + Intronic
1051612425 9:18974175-18974197 CATTCAAAATAGAAGGAGCCAGG + Intronic
1051983220 9:23049481-23049503 TTTTCAAAACAGAAACCACCAGG + Intergenic
1052783659 9:32807865-32807887 CTTCCAAAACAAAAAGCACAAGG + Intergenic
1052786050 9:32829474-32829496 TTTCCAAGACAGAAATAACCAGG - Intergenic
1053529423 9:38864602-38864624 CTTTCAATAAAGAAAATACCAGG + Intergenic
1053731732 9:41063946-41063968 CTTTCCAACCAGACAGAAACTGG - Intergenic
1053923221 9:43021262-43021284 CCTGCTAAACAGAAAGCACCAGG + Intergenic
1054201649 9:62089030-62089052 CTTTCAATAAAGAAAATACCAGG + Intergenic
1054636710 9:67499329-67499351 CTTTCAATAAAGAAAATACCAGG - Intergenic
1055378453 9:75678262-75678284 CTTTCAAAACAGAGACCACTGGG + Intergenic
1055402354 9:75937616-75937638 CTTTCACACTAGAAAGAAGCAGG - Intronic
1056212544 9:84378515-84378537 CTTCCAAAACAGAAAGTACCAGG - Intergenic
1056385620 9:86094584-86094606 ATTTCAAAACAGGAAGAATTTGG - Intronic
1056427917 9:86496770-86496792 CTTCCAAAATAGAAAGCACCAGG - Intergenic
1056708628 9:88972075-88972097 CTTTAAAAAAAGAAAAAAACTGG - Intergenic
1056828521 9:89893659-89893681 CTCTCAAAACAGATAGAATGAGG - Intergenic
1056896128 9:90552410-90552432 CTTTCACAACAGAAATCACATGG - Intergenic
1056983114 9:91335200-91335222 CTTTCCACACAGAAAGCACCGGG - Intronic
1057199047 9:93130717-93130739 CTTTCAAAACAGTGAGAGCCAGG - Intronic
1057264811 9:93608571-93608593 CTTCCAAAATATAAAGCACCAGG - Intronic
1057287504 9:93771323-93771345 CTTCCAAAACAGAAAGCATCAGG + Intergenic
1057558201 9:96105781-96105803 CTTCTAAAACAGAAAGTACCAGG + Intergenic
1057910698 9:99017803-99017825 CGTTAAAAAGAGAAAGAAACAGG - Intronic
1058310526 9:103496208-103496230 CGTTCTAAACAACAAGAACCTGG - Intergenic
1058490870 9:105497491-105497513 TTTCCAAAACAGAAAGCACCAGG - Intronic
1058678863 9:107424434-107424456 TTTTAAAAACAAAAAGAAACTGG + Intergenic
1059379800 9:113914174-113914196 TTCTCATCACAGAAAGAACCGGG - Intronic
1060320736 9:122557838-122557860 TTTCCCAAACAGAAAGTACCAGG - Intergenic
1060721203 9:125980222-125980244 CTTCCAAAACAGAAAGCAGATGG - Intergenic
1060740590 9:126095429-126095451 CTTTGAAAACAGAAAAATCATGG - Intergenic
1061005391 9:127926257-127926279 CTCTAAAAAAAGAAAGAAACAGG - Intronic
1062133150 9:134911074-134911096 CTTGGAAAGCAGAGAGAACCTGG - Intronic
1062203188 9:135319768-135319790 CTTCTAAAACAGAAAACACCAGG + Intergenic
1203687710 Un_GL000214v1:10877-10899 CATTCAGAACAGAAACAACAGGG + Intergenic
1203754910 Un_GL000218v1:116881-116903 CATTCAGAACAGAAACAACAGGG - Intergenic
1203536914 Un_KI270743v1:48665-48687 CATTCAGAACAGAAAAAACAGGG + Intergenic
1203600200 Un_KI270748v1:5509-5531 CTCTCATAAAAGAAAGACCCAGG - Intergenic
1203648565 Un_KI270751v1:93176-93198 CATTCAGAACAGAAACAACAGGG - Intergenic
1185598781 X:1325005-1325027 CTTTAAAAGAAGAGAGAACCTGG - Intergenic
1185610238 X:1390008-1390030 TTTTAAAAAAAGAAAGAGCCGGG - Intronic
1185681251 X:1890142-1890164 TTTTGAAAACACAATGAACCAGG - Intergenic
1185926030 X:4147557-4147579 GTTGCAAAACACAAAAAACCTGG + Intergenic
1185930079 X:4192950-4192972 ATTTCCAAGCAGAAATAACCTGG - Intergenic
1186083639 X:5962007-5962029 CATTCAAAACAGGAAAAAGCAGG - Intronic
1187216193 X:17279248-17279270 CTGTGAAAAGGGAAAGAACCAGG - Intergenic
1187549708 X:20289982-20290004 ATTACAAAAGAGAAAGAACATGG - Intergenic
1187797317 X:23018180-23018202 CTTTGAAAGCAGAAAGATCTGGG + Intergenic
1188280710 X:28265062-28265084 CTTCAAAAACAGAAAGCACTAGG + Intergenic
1188697206 X:33208502-33208524 CTGACAACACAGAACGAACCAGG - Intronic
1188840622 X:35012579-35012601 CTTTCAAGAGAGAAAGAGCCTGG + Intergenic
1189018759 X:37312461-37312483 TTTTCAAAGCAGACAGAATCTGG - Intergenic
1189163215 X:38832487-38832509 CTTTAAAATCAGAGAGACCCTGG + Intergenic
1189460428 X:41238255-41238277 CTCTCAAAAAAAAAAGAAACTGG + Intergenic
1189753048 X:44242334-44242356 CTTTCAAAACAGCCATAATCAGG - Intronic
1190402533 X:50052667-50052689 CTTGCCAAAAAGAAAGCACCAGG - Intronic
1190408914 X:50115215-50115237 TGTTCAAAACAACAAGAACCTGG + Intergenic
1190927282 X:54921377-54921399 CTTTCAAACCGGAACCAACCGGG - Intronic
1192310468 X:70008905-70008927 CTTCCAAAAGGGAAAGCACCAGG - Intronic
1192836826 X:74808695-74808717 CTTCCAAAACAGAAAGCACCAGG - Intronic
1192903869 X:75528702-75528724 CTTCCAAAACAGAAATCACCAGG - Intergenic
1193947491 X:87755955-87755977 TGTTCAAAACACCAAGAACCTGG - Intergenic
1194182234 X:90726542-90726564 CTTCCAAAAAATAAAGAACAGGG + Intergenic
1194517493 X:94873970-94873992 CTTTCAACAAAGAAAGGCCCGGG + Intergenic
1194643826 X:96433876-96433898 CCTTCAAAACAGTAACATCCTGG + Intergenic
1194864173 X:99045267-99045289 CTTCATAAACAGAAAGCACCAGG - Intergenic
1195526923 X:105901890-105901912 TTTCCAAAACAGAAATAATCAGG - Intronic
1195573347 X:106421478-106421500 CTTTCAAACGAGAAAGAATATGG - Intergenic
1195586646 X:106572721-106572743 CATCTAAAACAGAAAGCACCAGG + Intergenic
1195603948 X:106780778-106780800 CTTTAAAGCCAGATAGAACCTGG + Intronic
1196072606 X:111543133-111543155 TGTTCAAAACACCAAGAACCTGG - Intergenic
1196305695 X:114100209-114100231 CTTTCAAAATAAAAACAAACAGG + Intergenic
1196392148 X:115218896-115218918 TGTTCAAAACACCAAGAACCTGG + Intronic
1196623640 X:117852838-117852860 CTTGAAATACAGAAAGAAACTGG + Intergenic
1196852731 X:119953871-119953893 CTTCCAGAACAGAAAGCACCTGG - Intergenic
1197539357 X:127737172-127737194 CATCCAAAACAGAAAGCACCTGG + Intergenic
1197795805 X:130297171-130297193 CCTTCAAAACAGGAATAAACTGG + Intergenic
1197908988 X:131459872-131459894 CCTCCAAAACAGAAAGCACTAGG + Intergenic
1198092528 X:133345841-133345863 TGTTCAAAACACCAAGAACCTGG - Intronic
1198157038 X:133971251-133971273 CTTTCTATACAGATAGAACAAGG - Intronic
1198383684 X:136107449-136107471 TGTTCAAAACACCAAGAACCTGG + Intergenic
1198816143 X:140592813-140592835 TTTTCATATCAGAACGAACCAGG + Intergenic
1199132692 X:144211181-144211203 CTTTTAAATCAGAGATAACCTGG - Intergenic
1199292171 X:146117113-146117135 CCTTCCAAAAAGAAAGCACCAGG - Intergenic
1199702679 X:150395560-150395582 CTTTCCAAACAGAAGGCGCCAGG - Intronic
1199864763 X:151833225-151833247 CTTACAAAACAGAAAGCACCAGG + Intergenic
1200175305 X:154110643-154110665 CTTCCAAAAAAGAAAGCACCAGG - Intergenic
1201168535 Y:11234489-11234511 CATTCAGAACAGAAACAACAGGG - Intergenic