ID: 936071117

View in Genome Browser
Species Human (GRCh38)
Location 2:109371954-109371976
Sequence GTCCCTTGAGAAAACGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936071117 Original CRISPR GTCCCTTGAGAAAACGGGGA AGG (reversed) Intronic
900164520 1:1239435-1239457 GGCCCTTGAGGCACCGGGGACGG + Intergenic
901946798 1:12710916-12710938 GTCTCTGGGGTAAACGGGGAAGG - Intergenic
902242823 1:15100183-15100205 GTGCCTGGAGAAAGAGGGGAAGG + Intronic
903351310 1:22718224-22718246 GGCCTTTGAGAAAACCTGGATGG - Intronic
906702912 1:47872751-47872773 GTCCCTTGAGAAGACTGGGTTGG + Intronic
907660672 1:56389993-56390015 CTCCCAGGAGAAAACAGGGAGGG + Intergenic
912416014 1:109508996-109509018 GTCACTTGAGAGAAAGAGGATGG + Exonic
912463888 1:109855970-109855992 TTCCCTTGAGATAAGGGGCATGG + Intergenic
913470435 1:119180648-119180670 GTCCCTTGACATAAGGGGCACGG + Intergenic
915585105 1:156840242-156840264 GCCCCTGGAGAAAAGGAGGAAGG + Exonic
918054076 1:181003463-181003485 TTCCCTTGAGAAAGGAGGGAAGG - Intronic
918144938 1:181747307-181747329 GTCCTTTGAGAAGAGGGGGCTGG + Intronic
924248556 1:242108359-242108381 GACCCTGCAGAAAACGTGGAAGG - Intronic
1066230683 10:33429834-33429856 ATCCCAAGATAAAACGGGGAAGG - Intergenic
1067455581 10:46417097-46417119 GTCCTTTCAGAAGAAGGGGAGGG + Intergenic
1067631622 10:47967542-47967564 GTCCTTTCAGAAGAAGGGGAGGG - Intergenic
1069782979 10:70968491-70968513 GTCCCTTGAGTAACTGGAGAAGG + Intergenic
1072207053 10:93214164-93214186 GTCCCTTGAGATTACGCAGAGGG + Intergenic
1076507453 10:130987492-130987514 GGCCCTGGAGAAAAGGGTGATGG - Intergenic
1078102214 11:8336656-8336678 GTGCCTGCAGAAAAAGGGGAAGG - Intergenic
1082100363 11:48168105-48168127 GTCTTTGGAGAAAACTGGGAGGG - Exonic
1085601740 11:77861609-77861631 TTCCCTTGACATAACGGGCATGG + Intronic
1086378421 11:86225573-86225595 GTCCTTTGAGGAAACATGGATGG + Intergenic
1088590673 11:111399990-111400012 GGCCCTGGAGAAAGCCGGGATGG + Intronic
1088977311 11:114827307-114827329 GATCCTTGAGAAAAAGGTGAGGG + Intergenic
1089981552 11:122776973-122776995 GTCGCTTGAGAATAATGGGAGGG - Intronic
1090039540 11:123278140-123278162 GTAGCTGGAGAGAACGGGGAAGG - Intergenic
1090353113 11:126120462-126120484 TTGCCTTGAGAAATCAGGGAAGG + Intergenic
1090632051 11:128657916-128657938 TTCTCTTGAGAAAACTGGGATGG - Intergenic
1094413986 12:30198993-30199015 GTCACTTAAGCAAACGAGGATGG - Intergenic
1097347677 12:58512578-58512600 TTCCCTTGAGAGAAAAGGGAGGG - Intergenic
1101226764 12:102695025-102695047 GGGCCTTGAGAAAACATGGACGG + Intergenic
1101604830 12:106240118-106240140 GTCCCTGGAGAACACGGTGGAGG - Exonic
1106191639 13:27458757-27458779 GCCTCATGAGAAATCGGGGAAGG + Intergenic
1109208363 13:59506414-59506436 GTCACTTGGGAAAATAGGGAAGG - Intergenic
1111164055 13:84434213-84434235 GTCCCTTGAGTAAAAGGTGTTGG - Intergenic
1117011669 14:51476742-51476764 ATCCCTTAAGAAAACTGAGAAGG + Intergenic
1121542901 14:94741894-94741916 GTCCCTTGAGATAGCTAGGAAGG + Intergenic
1122286827 14:100657285-100657307 GTGCCTTGAGGAACCAGGGAAGG - Intergenic
1127539503 15:59922813-59922835 GTCCCTTGGGAAAAAAGGGCAGG + Intergenic
1127855603 15:62951022-62951044 GTCACCTGACAGAACGGGGAGGG + Intergenic
1130263433 15:82377617-82377639 GACCCTTTACAAAACGGGGCAGG - Intergenic
1132270273 15:100517992-100518014 CTACCTTGAGCAAATGGGGATGG + Intronic
1136240262 16:28938992-28939014 GCCCCTAGGGAAAGCGGGGAGGG + Intronic
1138118473 16:54379120-54379142 CTCCCTTGAATAAATGGGGATGG + Intergenic
1139593469 16:67945582-67945604 GTCCCATAGGAAAAGGGGGATGG + Intronic
1140325164 16:73994403-73994425 GTCCCTTGATACAATGGGGAAGG - Intergenic
1142885044 17:2907294-2907316 GTACCATGAGAAGAAGGGGAAGG + Intronic
1143474072 17:7193037-7193059 GTCCCGGGAGAAAATGGAGAAGG - Exonic
1145023783 17:19452637-19452659 GGCACTTGAGAATCCGGGGAAGG + Intergenic
1147203516 17:38820454-38820476 GTCCCATGAGAGAAGGTGGATGG - Intronic
1151128855 17:71875062-71875084 GTCATTTGAGAAAACATGGATGG + Intergenic
1151848940 17:76678297-76678319 ATCCCTTGATAAAAGGGGCAGGG - Intronic
1155429172 18:25737725-25737747 CTCTCTTGAGTAAGCGGGGAAGG - Intergenic
1155567195 18:27148166-27148188 GTCCTTTGTGGAAACGTGGATGG - Intronic
1157108418 18:44796751-44796773 GTCACTTGAGAAAAAGCTGAAGG - Intronic
1161952737 19:7476902-7476924 GTGCCTTGAGAAAGCTGGAACGG - Exonic
1164383989 19:27758144-27758166 CTCCCTTTAGAATACGGGGGTGG + Intergenic
1164565455 19:29323046-29323068 GTCCCAGAAGAAAACTGGGATGG + Intergenic
1166076404 19:40416109-40416131 GCCCTTTGAGAAAACGGTTAAGG + Intergenic
1166497472 19:43314614-43314636 GTCTCTGGAGTAAAAGGGGAAGG - Intergenic
1166826564 19:45613514-45613536 GTCCCTTGGGGAGATGGGGATGG - Intronic
1168137297 19:54360190-54360212 GACTCCTGAGAAAACGGGGCAGG + Intronic
1168160780 19:54508895-54508917 GACTCCTGAGAAAACGGGGCAGG - Intronic
925043893 2:756103-756125 GTCCCGTAAGCAAACTGGGATGG + Intergenic
927103343 2:19804766-19804788 TTCCTTTGGGAAAATGGGGAAGG - Intergenic
929611453 2:43273800-43273822 GACCCTTGAGCAAACAGGGAGGG - Intronic
930144038 2:47982921-47982943 GTCCCCTCAGAAATGGGGGAAGG + Intergenic
931815591 2:65897605-65897627 CTCCCTAGAGAAAAAGAGGAGGG - Intergenic
933175230 2:79166482-79166504 TTCCCTTGATATAACGGGCATGG + Intergenic
935083628 2:99823791-99823813 GTCCCTTGCGGCAACGTGGATGG + Intronic
936071117 2:109371954-109371976 GTCCCTTGAGAAAACGGGGAAGG - Intronic
936772977 2:115937250-115937272 ATCCCTAGAGAAAACTGTGAAGG - Intergenic
938072373 2:128315502-128315524 GTCCCCAGAGAACACGGAGATGG + Intronic
938661146 2:133488550-133488572 CTCCCTTCAGAAAAAGGGGCAGG + Intronic
948204517 2:236156201-236156223 GAGCCTTGAGAAAAGAGGGAGGG + Intergenic
1169800268 20:9506758-9506780 GTCCCTGGCGAAAACGGGCGTGG + Intergenic
1170932819 20:20784097-20784119 GACCCTGGAGAGAAGGGGGATGG + Intergenic
1172207067 20:33170707-33170729 GTCTCTGGAGAACAGGGGGATGG - Intronic
1173056023 20:39613637-39613659 GATCCTTGGGAAAACTGGGAAGG - Intergenic
1173589966 20:44217033-44217055 GTCCCATGGGACAACGGGGTCGG - Intergenic
1173695857 20:45011525-45011547 GTCCACTGAGAAATCTGGGAAGG - Intronic
1174034662 20:47661239-47661261 GACCACTGAGAAAACGTGGAGGG - Intronic
1174415423 20:50363234-50363256 TTCCCTTGGCAAAACCGGGAGGG - Intergenic
1180035833 21:45248724-45248746 GTCCCTTGGGAAATCTGAGAGGG + Intergenic
1180701488 22:17783737-17783759 GAGCCTTGAGTAAGCGGGGAAGG - Intergenic
1181850713 22:25748109-25748131 GTCCCCTGAGAAAAGGCTGAAGG + Intronic
1181863462 22:25837090-25837112 GTCCCTTCAGAAAATATGGATGG + Intronic
954956031 3:54518935-54518957 GTCCCTTGAGAAATTGAGGGGGG + Intronic
954999015 3:54909492-54909514 CTCCCTTGGGAAAAAAGGGACGG + Intronic
961209760 3:125116643-125116665 TTCCCTTGAAAAACAGGGGAAGG + Intronic
961597372 3:128029135-128029157 GTGCTTTGGGAAAGCGGGGAGGG - Intergenic
968715879 4:2159036-2159058 TTCCCCTGAGAACACTGGGAGGG + Intronic
969432628 4:7164815-7164837 GTCCCAGGAGAAAACCAGGAAGG - Intergenic
986002457 5:3641161-3641183 GTCCCTTTAGAAAGTGGGGCTGG + Intergenic
997624955 5:135325224-135325246 GTCCCTCTAGAAACTGGGGATGG + Intronic
1001092383 5:168751015-168751037 GACCCTTGAGCAAAGGTGGAAGG + Intronic
1001731916 5:173966640-173966662 GTCCCTTGAGAATTTGGGGATGG - Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1007988761 6:46233465-46233487 GTGCATTGAGGAAAGGGGGATGG + Intronic
1012986771 6:105884208-105884230 CTCTCTTCAGATAACGGGGAAGG - Intergenic
1013304864 6:108838584-108838606 GGCCCTTGAGAAGGCGGGAATGG + Intergenic
1019847363 7:3518985-3519007 GTCATTTGAGACAACAGGGATGG + Intronic
1022895542 7:34747262-34747284 GTCTCTTGAGAAAGTGGGTAGGG - Intronic
1028480028 7:91294114-91294136 GTTCCTTGAGGAAATGGGAAAGG + Intergenic
1029298123 7:99558109-99558131 GTCCTTGGGGAAAGCGGGGACGG - Intronic
1034235978 7:149569854-149569876 TTCCCCTGAGAAGACGGGAAAGG - Intergenic
1034890960 7:154838821-154838843 GTCCCTCGAGGAAAAGAGGATGG + Intronic
1035888884 8:3323385-3323407 GTGACTTGGGAAAATGGGGAAGG - Intronic
1037760443 8:21738231-21738253 GTCACCTGAGAAAAGGGGGTGGG - Intronic
1038420407 8:27430705-27430727 CTCCCTTGAGACAATGGGTATGG + Intronic
1049790898 8:144472342-144472364 GTCCCTGGTGAGAAAGGGGAAGG - Exonic
1051397990 9:16647246-16647268 GTCCCTTGCCAAAAAGGGGTAGG + Intronic
1053135898 9:35650150-35650172 GTGGCTGGAGAAAAGGGGGAGGG - Intronic
1053473361 9:38363336-38363358 GGTCCTTGAGAAAACCGGGGAGG + Intergenic
1057929635 9:99182510-99182532 GTGCTTTGAGAAAACCGGCAGGG - Intergenic
1059249920 9:112879402-112879424 GTCCCTTGAAGAAAAGGGGCAGG + Exonic
1187672101 X:21678048-21678070 GTACCTTGAAGAAACGGTGATGG - Intergenic
1194783643 X:98056095-98056117 GTCCCTTGAGAAATGGTGAAGGG - Intergenic
1198935925 X:141903060-141903082 GTCCCTGGAGAGAAGAGGGAGGG + Intergenic
1200079041 X:153566497-153566519 GGCCCTTGAGACCACTGGGAGGG - Intronic