ID: 936071709

View in Genome Browser
Species Human (GRCh38)
Location 2:109375620-109375642
Sequence GCCCTGGCCCACTGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 396}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936071709_936071716 -4 Left 936071709 2:109375620-109375642 CCTCCTCCCCAGTGGGCCAGGGC 0: 1
1: 0
2: 1
3: 49
4: 396
Right 936071716 2:109375639-109375661 GGGCAGAGTGAACTCACAGGAGG 0: 1
1: 0
2: 3
3: 21
4: 215
936071709_936071717 0 Left 936071709 2:109375620-109375642 CCTCCTCCCCAGTGGGCCAGGGC 0: 1
1: 0
2: 1
3: 49
4: 396
Right 936071717 2:109375643-109375665 AGAGTGAACTCACAGGAGGATGG 0: 1
1: 0
2: 1
3: 24
4: 289
936071709_936071718 4 Left 936071709 2:109375620-109375642 CCTCCTCCCCAGTGGGCCAGGGC 0: 1
1: 0
2: 1
3: 49
4: 396
Right 936071718 2:109375647-109375669 TGAACTCACAGGAGGATGGCAGG 0: 1
1: 0
2: 0
3: 19
4: 226
936071709_936071719 9 Left 936071709 2:109375620-109375642 CCTCCTCCCCAGTGGGCCAGGGC 0: 1
1: 0
2: 1
3: 49
4: 396
Right 936071719 2:109375652-109375674 TCACAGGAGGATGGCAGGCGAGG 0: 1
1: 0
2: 0
3: 28
4: 246
936071709_936071715 -7 Left 936071709 2:109375620-109375642 CCTCCTCCCCAGTGGGCCAGGGC 0: 1
1: 0
2: 1
3: 49
4: 396
Right 936071715 2:109375636-109375658 CCAGGGCAGAGTGAACTCACAGG 0: 1
1: 0
2: 1
3: 19
4: 236
936071709_936071720 10 Left 936071709 2:109375620-109375642 CCTCCTCCCCAGTGGGCCAGGGC 0: 1
1: 0
2: 1
3: 49
4: 396
Right 936071720 2:109375653-109375675 CACAGGAGGATGGCAGGCGAGGG 0: 1
1: 0
2: 2
3: 29
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936071709 Original CRISPR GCCCTGGCCCACTGGGGAGG AGG (reversed) Intronic
900109117 1:998240-998262 GTCCTCACCCACTGGGGAGGCGG + Intergenic
900115618 1:1026657-1026679 GCCCAGTCCAAGTGGGGAGGGGG - Intronic
900295495 1:1947108-1947130 GCCCAGGCCCCCTTGGGACGTGG + Intronic
900556851 1:3284953-3284975 GCCCGGGCCCAGAGGGGAGCAGG - Intronic
900580518 1:3406349-3406371 GCCCTGGGCACCTGTGGAGGAGG + Intronic
900629850 1:3628645-3628667 CCCTTGGCCTTCTGGGGAGGGGG - Exonic
900682642 1:3925319-3925341 GTCCCAGCCCTCTGGGGAGGTGG + Intergenic
900712399 1:4122649-4122671 CCCCGGGCCAGCTGGGGAGGCGG + Intergenic
901116345 1:6848092-6848114 ATCCTGGCACACTGGTGAGGTGG - Intronic
901181000 1:7341844-7341866 GAGCTGGCCTCCTGGGGAGGAGG + Intronic
901185477 1:7370000-7370022 GCCATGGCCCACTGGTGACGTGG + Intronic
901318291 1:8323743-8323765 GCCCTGGCCTACCGCGAAGGAGG + Intronic
901639964 1:10688162-10688184 GCCCTGGCCTCCTGGGGATCAGG + Intronic
901646338 1:10718701-10718723 GTCCTGACCCACTGGGGAGTGGG + Intronic
902679251 1:18031340-18031362 CCCCTGGCCCAATGGGCTGGGGG + Intergenic
902715938 1:18272713-18272735 GCCCTGGGGCAGTGGAGAGGGGG + Intronic
902879042 1:19358844-19358866 GCCCTGGACAGCTGGGAAGGTGG + Intronic
903184306 1:21620589-21620611 GCCCTGGCTCACCCGGGAGAGGG - Intronic
903410645 1:23140614-23140636 GCCCTGGACCACCAAGGAGGAGG + Intronic
904143182 1:28369715-28369737 GCCCTTGGCCCCCGGGGAGGGGG - Intronic
904236999 1:29122661-29122683 GCCCGGGCCGACGGGGGAGCCGG - Intronic
905652026 1:39662928-39662950 GCCCTGGGCCAATGGGAAGGAGG - Intronic
906260142 1:44380701-44380723 GCCCTGACCCAATGGGGAAATGG + Intergenic
906313027 1:44767320-44767342 GCCCAGGGCAGCTGGGGAGGGGG + Exonic
906495415 1:46301829-46301851 GCCGAGGCCTGCTGGGGAGGGGG - Intronic
907328442 1:53656064-53656086 GATCTGGCCAACTGGGGAAGGGG + Intronic
907337946 1:53712724-53712746 GTCCTGGGGCACTCGGGAGGAGG - Intronic
907406985 1:54259671-54259693 CCGCCTGCCCACTGGGGAGGAGG + Intronic
907494630 1:54835764-54835786 GCCCTGTAACTCTGGGGAGGTGG - Intronic
910981058 1:92960962-92960984 GCGGGGGCCCACGGGGGAGGGGG + Intronic
912443566 1:109716416-109716438 GCCCTGGCCCTTTGGGGAGAGGG + Intronic
912680644 1:111726899-111726921 GTGCTGGGCCCCTGGGGAGGAGG - Exonic
912977630 1:114344833-114344855 GCTCTGGCCCAAGGGGCAGGTGG - Intergenic
914846546 1:151286834-151286856 ACCCTCTCCCACTCGGGAGGGGG + Exonic
914869089 1:151458699-151458721 GCGGTGGCCCGCTGGGGAAGGGG - Intronic
915701895 1:157804247-157804269 CCCATGGGCCACTGGGGGGGGGG - Intronic
917928241 1:179806608-179806630 GCCCTGTCCCCTTGGGAAGGTGG + Intronic
918302913 1:183220303-183220325 GCTCTGGCTCACTGGGGAAAAGG - Intronic
919895696 1:202008444-202008466 GCACTGGCCCAGTGCGGGGGCGG + Exonic
920750412 1:208669516-208669538 GACCTGCCCCACTGGGTAGCTGG + Intergenic
922233771 1:223707936-223707958 GCTCTGCCCCACTGGGCAGAAGG + Intronic
922741974 1:228019095-228019117 GCCAGGGCCCACCCGGGAGGAGG + Intronic
923686887 1:236159869-236159891 GCCTTGGCCCACTGTGGGAGCGG + Intronic
924632068 1:245750706-245750728 GCCCTGCCCAAATGGGGGGGTGG + Intronic
924944627 1:248838170-248838192 GCCTTGGCCCGCGCGGGAGGCGG + Intergenic
1062964771 10:1598775-1598797 GCCCTGGCCCTCTGGTCAGGAGG + Intronic
1063152696 10:3351112-3351134 GCCCAGGCTGAATGGGGAGGAGG - Intergenic
1063290008 10:4735443-4735465 GGCTTTGCCCCCTGGGGAGGAGG - Intergenic
1063962476 10:11318430-11318452 GCCCTGTTTCCCTGGGGAGGTGG - Intronic
1064013065 10:11751248-11751270 GCCATGGGCCACAGGGGAGCAGG + Intronic
1066411991 10:35180809-35180831 GCCCAGCCCCTCTGGGGACGGGG - Intronic
1066498779 10:35970268-35970290 GCCTTGGTCCACTGAGGAGAAGG + Intergenic
1066649405 10:37640433-37640455 GCCCTGGCCCAGGGAGGGGGCGG + Intergenic
1066697471 10:38091826-38091848 GCCCGGGACCCCAGGGGAGGAGG - Intergenic
1067015618 10:42754901-42754923 GCGCTGCCCCAGTGGGGAAGGGG - Intergenic
1067032291 10:42885974-42885996 GCCCTGGCCCAGGGAGGGGGCGG + Intergenic
1069607760 10:69750407-69750429 CCCCTGTCCCACAGGAGAGGAGG - Intergenic
1069897836 10:71689832-71689854 GCTCTGGCCCAGTGGTGAGGAGG - Intronic
1069913187 10:71772175-71772197 GGCCTGGGCCTCTGAGGAGGAGG - Intronic
1070680079 10:78442854-78442876 GCCCTGGCACTCTGCTGAGGTGG - Intergenic
1070749579 10:78955981-78956003 GCCCCTGCCCCCTGGGGAAGTGG - Intergenic
1070794388 10:79208231-79208253 ACCCAGCCTCACTGGGGAGGAGG - Intronic
1071096485 10:81981443-81981465 CTCCAGGCCCACTGGGGTGGTGG + Intronic
1071472189 10:85991513-85991535 GGACTGCCCCTCTGGGGAGGTGG + Intronic
1072894085 10:99350800-99350822 GCCCTGGCCTATTAGGGGGGTGG - Intronic
1073186539 10:101618574-101618596 ACCCTGGCCCAAAGGGGAAGGGG + Intronic
1073268174 10:102240953-102240975 GCCCTGGCCAGCGGGGGAGCTGG - Intronic
1075261551 10:120967594-120967616 GCCCTGCCCTCCTGTGGAGGTGG + Intergenic
1075283191 10:121159015-121159037 GCCATGACCCTCTGGGGAAGGGG + Intergenic
1075560901 10:123467766-123467788 TCCCAGGCCCGGTGGGGAGGGGG + Intergenic
1075712149 10:124536479-124536501 GCCCTGACCCACCGGGCTGGGGG - Intronic
1076190808 10:128482140-128482162 TCCCTGCCCCACTGGGCACGAGG - Intergenic
1076562561 10:131376808-131376830 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562578 10:131376867-131376889 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562595 10:131376926-131376948 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562612 10:131376985-131377007 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562629 10:131377044-131377066 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562646 10:131377103-131377125 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562663 10:131377162-131377184 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562680 10:131377221-131377243 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1077077751 11:709001-709023 GCCCTGGTGCTGTGGGGAGGGGG - Intronic
1078063885 11:8065287-8065309 GCCCTGGCCCCATGGGGAGCAGG - Intronic
1078552368 11:12289415-12289437 GCCCTGGCCCATTCCAGAGGGGG - Intronic
1079444299 11:20545674-20545696 GGCCTGGCCCTCTGTGGAGAAGG - Intergenic
1079689159 11:23400451-23400473 GCCCTGCCCCGCCGGGTAGGTGG + Intergenic
1080021367 11:27563746-27563768 GTTATGGCTCACTGGGGAGGTGG + Intergenic
1081285873 11:41269539-41269561 GCCCTGGACCACCAGGGAGAAGG + Intronic
1081647350 11:44799175-44799197 GGACAGGCCCCCTGGGGAGGGGG - Intronic
1082810481 11:57476514-57476536 GCCCTGGCGCTCCGGGGGGGTGG - Exonic
1083187659 11:61026936-61026958 GCCCGGGTCCTCTGCGGAGGGGG - Intergenic
1083248190 11:61446476-61446498 GCCCTGGGCCACTGAGGGCGGGG - Exonic
1083334201 11:61913345-61913367 GGCCTGGGCCACAGGGGAAGGGG + Intronic
1083571589 11:63764449-63764471 GCCCGGGCCCGCAGAGGAGGAGG - Exonic
1083768597 11:64854055-64854077 GGGCTGGCACACAGGGGAGGCGG + Exonic
1083849284 11:65355607-65355629 GCCCTGGCATCCTGGGGACGGGG + Intronic
1084429266 11:69102219-69102241 GCAGTGGGCCACTGGTGAGGGGG + Intergenic
1084431207 11:69112428-69112450 GCCATGGCCCAATGGCCAGGCGG - Intergenic
1084476486 11:69392301-69392323 CTCCTGGACCACAGGGGAGGAGG + Intergenic
1084588756 11:70078462-70078484 GCCCAGGCCCGCCGGGGACGTGG - Exonic
1084909080 11:72373065-72373087 GCCCTGGAGCTCTGGGAAGGGGG + Intronic
1085165796 11:74398352-74398374 GACCTGGTCCGCTGGGGAGCAGG - Exonic
1085458774 11:76680771-76680793 TCACTGGCGCACTGGGGAGCTGG - Intergenic
1086552526 11:88069276-88069298 GCCCTGCCCCCGTGGGGAGGTGG - Intergenic
1086953639 11:92914901-92914923 GCCCTCGCCCACCTGGGAAGGGG - Intergenic
1087432308 11:98069657-98069679 GCCCAGGCACATAGGGGAGGGGG + Intergenic
1089280878 11:117373545-117373567 GCCCAGCCCCAGTGGGGCGGAGG + Intronic
1089596956 11:119586436-119586458 TCCCTGGCCATGTGGGGAGGAGG + Intergenic
1091393777 12:141437-141459 GCTCCGGCCCACTGGGGTGATGG - Intronic
1091792554 12:3280226-3280248 GGCCCTGCCCACTGGGGTGGGGG - Intronic
1091857851 12:3753368-3753390 TCGCTGGCTCACTGGAGAGGTGG + Intronic
1095976347 12:47943139-47943161 GTCCTGGCGCAGTGGGGAGGAGG - Intergenic
1096255575 12:50059983-50060005 AGCCTGGCCCACAGAGGAGGAGG + Intronic
1096258116 12:50075016-50075038 GCCCTGGACCCCTGGGTGGGGGG - Intronic
1096372865 12:51083398-51083420 GCCCTAGCCCGGTGGGAAGGAGG + Exonic
1097127424 12:56785607-56785629 GCCCTGGCCCACAGAGGACAAGG - Intronic
1097490970 12:60269971-60269993 GCCCTGACCCTGCGGGGAGGCGG - Intergenic
1099910875 12:88831798-88831820 GACATAGCCCAGTGGGGAGGAGG - Intergenic
1100959243 12:99944377-99944399 GCCAAGGGCCACTGGGAAGGAGG - Intronic
1102253192 12:111401363-111401385 GGCCTGGGCCACAGGCGAGGAGG - Intergenic
1102825086 12:115942390-115942412 GCCTGGGCCTGCTGGGGAGGTGG + Intergenic
1102862555 12:116349396-116349418 ACCCTGGCTCTCTGGGCAGGAGG + Intergenic
1103415501 12:120739682-120739704 GCCCTGGCCTCCTGGGGGCGGGG + Exonic
1103415951 12:120741559-120741581 GCCCGGGGACAGTGGGGAGGGGG + Intergenic
1103906474 12:124330186-124330208 GGCCTGGCCCAGTGGGGCTGAGG - Intronic
1105591860 13:21799806-21799828 GCCCAGGACCTCTGGGGAGGGGG + Intergenic
1105705701 13:22966332-22966354 GCCCTGGACCCCGAGGGAGGAGG - Intergenic
1105858604 13:24391317-24391339 GCCCTGGACCCCTAGGGAGGAGG - Intergenic
1107978681 13:45714027-45714049 GTCCGGGCCCTCCGGGGAGGAGG + Exonic
1108418924 13:50228877-50228899 GCTCTGGACCACTGGGCTGGTGG - Intronic
1112064991 13:95783656-95783678 GCCCTGTGGCACTGGGGAAGGGG - Intronic
1112370473 13:98788774-98788796 TTCCTGCCTCACTGGGGAGGGGG - Intergenic
1113416447 13:110132222-110132244 CCCCTGGCTCACGGGGCAGGCGG + Intergenic
1113891155 13:113736246-113736268 GACCAGCCCCAGTGGGGAGGAGG - Exonic
1119187164 14:72651170-72651192 GCCCTGGCCCCTGAGGGAGGTGG + Intronic
1119227966 14:72958600-72958622 GTCCTGGCCCACTAGGAAAGAGG - Exonic
1119472005 14:74906243-74906265 ACACAGGCCCACTGGGGAGGAGG + Exonic
1119601392 14:75979393-75979415 GCCCAGGCCCACCTGGGAGGTGG - Intronic
1121280583 14:92694589-92694611 GCCCTGGCACTCTGGCCAGGAGG + Intergenic
1121382838 14:93489636-93489658 TTCCAGGCCCACTGGGGTGGAGG + Intronic
1121535121 14:94685863-94685885 GCCTGGGCCCACTGGGAATGTGG - Intergenic
1121981467 14:98458043-98458065 GCCCTGGCCCTCTGGGCCTGGGG - Intergenic
1122120743 14:99552209-99552231 CCCCTGCACCACTGGGGAGGAGG + Intronic
1122805441 14:104254033-104254055 GCGCAGGCCCAGTGGGGCGGTGG - Intergenic
1122806635 14:104263185-104263207 ACCCCAGCCCCCTGGGGAGGGGG + Intergenic
1122863115 14:104591428-104591450 GCCCTGACCCACTGGACATGGGG - Intronic
1122889192 14:104724687-104724709 GCCCTGGCCCGCTGCCGGGGTGG - Intronic
1122945258 14:105005724-105005746 GGCCAGGCCCACGGGCGAGGAGG + Intronic
1123108455 14:105854174-105854196 GCTCTGGCCTACTGGGGCGGCGG - Intergenic
1124156800 15:27233137-27233159 GCCTTGGCTCACTGGGGAGAGGG + Intronic
1124719164 15:32097222-32097244 GCCCTCCCCAACTGGGCAGGAGG - Intronic
1125444244 15:39736607-39736629 CCTGTGGCCCACGGGGGAGGAGG - Intronic
1125578985 15:40772703-40772725 GCCCTGGGCCACTGCAGAGAAGG + Intronic
1125608257 15:40954289-40954311 ACCCTGGCCCAGTGTGAAGGGGG + Intronic
1125609316 15:40960016-40960038 GCTCTGGGGCGCTGGGGAGGAGG + Intergenic
1125733377 15:41906941-41906963 GCCATGGCCCACTGAGATGGAGG - Intronic
1125758574 15:42082305-42082327 GCCCTTGACCATTGGGAAGGAGG - Exonic
1127391622 15:58509640-58509662 GTCCTGGCTTACTGGGGAGTTGG - Intronic
1128074188 15:64816225-64816247 GCCCTGGGCCACTAGGGAGCAGG + Intronic
1128309688 15:66622348-66622370 GCCCTGGCCCGGCGGGAAGGCGG - Intronic
1128516324 15:68344201-68344223 GTCCTGGACCCCTGGGGAGAGGG + Intronic
1129761599 15:78131842-78131864 GCCCTGTCCCTCTGGGGAGAAGG + Intronic
1131065185 15:89430148-89430170 GACCTGGCCTGGTGGGGAGGTGG - Intergenic
1131068533 15:89449403-89449425 GCCCTGGCTCACCGGGGAAGGGG + Intergenic
1132010322 15:98269084-98269106 GCCCTGGCCCACGGAGCAGCGGG + Intergenic
1132558614 16:583550-583572 GCCCGGGCCCGCTGGGGACGGGG - Exonic
1132620794 16:867536-867558 CCCCTGGCTCACTGGGGACCAGG - Intronic
1132641587 16:980811-980833 GCCCTGGGCGCCTGCGGAGGCGG - Intronic
1132782797 16:1637379-1637401 GCCCGGGCCCAGGCGGGAGGAGG - Intronic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1135047734 16:19168570-19168592 GCCCTCGCCAACAGCGGAGGGGG - Exonic
1135120945 16:19766258-19766280 GCCCTGGCCCCTTGGGGTGGGGG + Intronic
1135422431 16:22314133-22314155 GCCCTGGCCCCTGGAGGAGGAGG + Intronic
1135736946 16:24939442-24939464 GCCCTAGAGCTCTGGGGAGGGGG + Exonic
1136147259 16:28322665-28322687 GCCCATACCCACTGGGGAGGTGG - Exonic
1136220297 16:28823794-28823816 GCCCCGGCCTTCAGGGGAGGCGG + Intronic
1137021555 16:35432956-35432978 GCCCTGGGCCCCTGGGTATGTGG + Intergenic
1137724192 16:50646067-50646089 GGTCTGGCCCAGTGGGGAGCGGG + Intergenic
1137773467 16:51036800-51036822 GCCCTGTGCCACTGCGGATGTGG + Intergenic
1141663156 16:85452612-85452634 GCCTGGGCCCACTGGGGCAGGGG - Intergenic
1141694498 16:85613266-85613288 GCTCGGGCCCGCTGGGGAGGTGG - Exonic
1142121387 16:88388237-88388259 GCTCTGGCCCACCGGCCAGGAGG - Intergenic
1142254208 16:89006217-89006239 GGCGTGGCCCACCCGGGAGGAGG - Intergenic
1142812195 17:2400599-2400621 CCCCTGGGGCACTGGGGAAGGGG - Intronic
1143524861 17:7466162-7466184 GCCCAGGCCAGCTGGGGAGTGGG - Exonic
1143651595 17:8266961-8266983 TCCCTCTCCCACTGTGGAGGGGG + Intronic
1143786672 17:9260786-9260808 GGCCTGGCCTTCTGGGGAGAGGG - Intronic
1144507318 17:15843412-15843434 GCCCTGGCCTTCTAGGGTGGGGG + Intergenic
1144769081 17:17749204-17749226 GCACTGGCTCTCTGGGGAGGCGG - Intronic
1145005735 17:19336758-19336780 GTCCTGTGCCACTGGAGAGGTGG + Intergenic
1145119216 17:20241443-20241465 GCCTTGGCCCTCTAGGGTGGGGG + Intronic
1145171445 17:20661017-20661039 GCCCTGGCCTTCTAGGGTGGGGG + Intergenic
1145201768 17:20951782-20951804 GCACTGGCCCTCTAGGGTGGGGG + Intergenic
1146722124 17:35130868-35130890 ACCCCGCCCCACTGGGGAAGGGG - Intronic
1146762416 17:35490084-35490106 CGCCTGGGGCACTGGGGAGGAGG - Intronic
1147632362 17:41940299-41940321 GCCCAGGCCCACTTGTGAGCAGG - Intronic
1148079367 17:44959513-44959535 GCCCAGGCCCACTTGGGTTGTGG + Intergenic
1148455340 17:47808269-47808291 GCCCTGGCCCCGGGGGCAGGAGG - Exonic
1149641534 17:58206047-58206069 GCCCTGGCCCACAGTGCAAGAGG - Exonic
1150123382 17:62621269-62621291 GCCCTCCCCAGCTGGGGAGGCGG - Intergenic
1151559938 17:74864667-74864689 GCCCTGTGCCTTTGGGGAGGAGG - Intronic
1152500450 17:80705097-80705119 GCCCAGGGCCACAGGGAAGGAGG - Intronic
1152519724 17:80848192-80848214 GCCTTGGCCTACTGAGGAGCTGG - Intronic
1152588005 17:81197631-81197653 CACCTGGCCCTCGGGGGAGGAGG - Intronic
1152854168 17:82654433-82654455 GCCCTGAGCCACTGTGGAGAGGG - Intergenic
1154376783 18:13817321-13817343 GCTCTGGCCCAGTGGCTAGGAGG - Intergenic
1155246264 18:23913035-23913057 GCACTGCCACAGTGGGGAGGTGG - Intronic
1157473440 18:48007129-48007151 GCTGTGGCCCACTGGGAAGTGGG + Intergenic
1160090879 18:75825618-75825640 GCCCTGGGCCACTGGGAAGATGG - Intergenic
1160256070 18:77249978-77250000 GCGCCAGCCCACTGGGGAGGTGG + Intergenic
1160517791 18:79488033-79488055 GCCTCGGCCTTCTGGGGAGGGGG + Intronic
1160874536 19:1291002-1291024 CCCCTGACCCACAGGGCAGGTGG - Intronic
1160877749 19:1305053-1305075 GCCCTGGGCCACCGGGGCTGTGG - Intergenic
1161015434 19:1980686-1980708 GCCCAGGCCCTCCTGGGAGGGGG + Exonic
1161397525 19:4052480-4052502 CTCCTGGCCTGCTGGGGAGGGGG + Intronic
1161479034 19:4501538-4501560 CCCCTGGCCTCCTGGGAAGGTGG + Intronic
1161757566 19:6145517-6145539 AACCTGGTCTACTGGGGAGGTGG - Intronic
1161983622 19:7642868-7642890 GCCCTGCGCCCATGGGGAGGGGG - Intronic
1162000956 19:7744878-7744900 CTTCTGGCCAACTGGGGAGGAGG - Intronic
1162003823 19:7764902-7764924 TTCCTGTTCCACTGGGGAGGTGG + Intronic
1162004220 19:7766848-7766870 CTTCTGGCCAACTGGGGAGGAGG + Intronic
1162029996 19:7913229-7913251 GCCCTCGGGCACTGGGGAGCTGG + Exonic
1162472346 19:10879971-10879993 GCACTGGCCCTCTGTGTAGGGGG + Intronic
1162809648 19:13156080-13156102 GTCCCGGGCCCCTGGGGAGGGGG + Intergenic
1162947351 19:14052020-14052042 GTCCTGGGGCAGTGGGGAGGGGG + Intronic
1162958873 19:14114574-14114596 GAGCTGGCCCACAGGGGAAGGGG - Intronic
1163222221 19:15929796-15929818 ACCCACCCCCACTGGGGAGGTGG - Intronic
1163282843 19:16327567-16327589 GCCTTGGGGCACTTGGGAGGAGG + Exonic
1163572332 19:18089916-18089938 GGCCTGGCACAGTGGGGACGGGG + Intronic
1164781445 19:30896761-30896783 TCCCTGGGTCACTGGGGAGAGGG - Intergenic
1164985374 19:32644551-32644573 GCCTAGGCCCTCTGGGGAGGAGG + Intronic
1165106538 19:33473089-33473111 GCCCTGGTCCAGCGTGGAGGTGG - Intronic
1165135189 19:33663448-33663470 GCCTTGGCCCACTGAGTAGCTGG - Intronic
1165321284 19:35086812-35086834 GCCCTGGCCCACAGGAGGAGGGG - Intergenic
1165407902 19:35642077-35642099 GCCCAGGCCCTTGGGGGAGGGGG + Exonic
1165432083 19:35778572-35778594 GCCCTGGCACCCTCGGGGGGCGG - Exonic
1165862430 19:38916194-38916216 GCCCTGTGCCGCTGGGGACGGGG - Intronic
1166691733 19:44825719-44825741 TCCCTGGGCCAGTGGGAAGGGGG + Intergenic
1166750483 19:45162035-45162057 TCCCTGGCCCACCAGGGAGGCGG + Intronic
1166822980 19:45591895-45591917 CCCCTGGCCCACGGGGGCTGTGG + Exonic
1167246185 19:48374517-48374539 GGACTGGCCCAGTAGGGAGGAGG - Intronic
1167792302 19:51689873-51689895 GCCCGAGCCCTCGGGGGAGGTGG + Intergenic
1168144920 19:54415535-54415557 CCCATGGCCCCCGGGGGAGGGGG - Exonic
925144279 2:1570461-1570483 GCTCTAGACCCCTGGGGAGGAGG - Intergenic
925601149 2:5609880-5609902 GCCATGCTCAACTGGGGAGGGGG + Intergenic
927490761 2:23519413-23519435 GCCTTGGCACACTGGCCAGGGGG - Intronic
927514068 2:23661707-23661729 CCCCAGGCCCACTGGGAAGAGGG + Intronic
927841828 2:26449801-26449823 GGCCTTGCTCCCTGGGGAGGGGG + Intronic
927900794 2:26816979-26817001 GCCCTGCATCACTAGGGAGGAGG - Intergenic
929596599 2:43180060-43180082 AGCCTGGCCTGCTGGGGAGGGGG - Intergenic
929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG + Intronic
930026935 2:47034713-47034735 GGCCTTGCCCACTGTGGAGAGGG - Intronic
931286257 2:60834554-60834576 TCCCTGGCCCCCTGGGAGGGAGG + Intergenic
931641313 2:64383165-64383187 GCCCTGGCTGACTGAGGAGCTGG + Intergenic
931757288 2:65385379-65385401 GCCCACGCCCTCTGGGGAGTTGG + Intronic
933418988 2:82023705-82023727 GCCCTTCCACACTGAGGAGGAGG + Intergenic
933544933 2:83697770-83697792 CTCCAGGCCCACTGGGGAGGAGG - Intergenic
934555231 2:95283538-95283560 GGCCTGGCCCTCTCGGGTGGGGG - Intronic
934652005 2:96098173-96098195 GCCCAGGCCCAGAGAGGAGGAGG + Intergenic
935177680 2:100663992-100664014 GCCCTGCCCCACTGGGGCTGAGG - Intergenic
936071709 2:109375620-109375642 GCCCTGGCCCACTGGGGAGGAGG - Intronic
937059373 2:118970345-118970367 GTCCTGACCCAGAGGGGAGGAGG - Intronic
937325710 2:120988706-120988728 GCCCACGCCCACTGGGGCCGCGG + Exonic
937890247 2:126933242-126933264 GCCCCGGCCCACCAGGGAAGGGG - Intergenic
938115408 2:128599877-128599899 GCCATGGCTCACTGGGTAGCAGG - Intergenic
941463022 2:165793819-165793841 GCCCTGGGCCAAGGGGCAGGTGG - Intronic
942457297 2:176147231-176147253 GTGCAGGTCCACTGGGGAGGGGG - Intergenic
944662598 2:201933852-201933874 GTCCTGGCACAGTGAGGAGGAGG + Intergenic
945639151 2:212400296-212400318 GCTGTGGCCTAATGGGGAGGTGG + Intronic
946347820 2:219125433-219125455 GCCCTGGCTCGCAGGGGTGGAGG - Intronic
947525371 2:230874045-230874067 GCCCAGGTCCCCCGGGGAGGGGG - Intronic
947564605 2:231185882-231185904 GCCCTGGCCCTCCAGCGAGGTGG - Intergenic
948574961 2:238943965-238943987 GCCCTGACCCACTGGAGCTGTGG + Intergenic
948596516 2:239082861-239082883 GCCCCGGGCCACAGGGCAGGTGG + Intronic
948806441 2:240455369-240455391 TCCCTGGCCCAGCGGGGAGCAGG + Intronic
948904034 2:240969355-240969377 GCCCTGAGCCTCTGAGGAGGTGG + Intronic
1171464108 20:25315865-25315887 GCACTGGCCCACAGGGCAGAAGG - Intronic
1171899104 20:30840373-30840395 GCCATGACCCAGTGGGGAGACGG - Intergenic
1172078091 20:32315055-32315077 GCCCTCCCCAACTAGGGAGGAGG + Intronic
1172174714 20:32965340-32965362 TCCCTGGGTCAGTGGGGAGGTGG - Intergenic
1172793962 20:37524453-37524475 GCCCTGACTCACTGGGGAGTGGG - Intronic
1173823048 20:46030894-46030916 TCCCAGGGTCACTGGGGAGGTGG - Intronic
1174047039 20:47741042-47741064 CGCCTGACCCACGGGGGAGGTGG - Intronic
1174399736 20:50269622-50269644 GGCCTGGCCCACTGGGTGGGTGG - Intergenic
1174456920 20:50655362-50655384 GCCCTGGGGCGCTGGGCAGGGGG - Intronic
1174649485 20:52112568-52112590 GTCCTGGGCCTCTGGGGATGTGG + Intronic
1175239450 20:57536119-57536141 GCCCCCGCCCAGAGGGGAGGTGG + Intergenic
1175258034 20:57658591-57658613 GCCCTGAATCTCTGGGGAGGTGG + Intronic
1175884378 20:62280688-62280710 GCCCTGGCTTTCTGGGGAGCTGG - Intronic
1175916142 20:62426939-62426961 GGCCTGGCCCGTGGGGGAGGGGG + Intronic
1176063539 20:63182627-63182649 GGCCTGGCCAGCTGGGGTGGGGG - Intergenic
1176122519 20:63460482-63460504 GCACTGGCCTGCTTGGGAGGGGG - Intronic
1177894519 21:26844321-26844343 GCCCCGGCCGACTGGGAAAGCGG - Exonic
1178233381 21:30813098-30813120 GCCATAGCCCACTGGAGAGTAGG + Exonic
1178847561 21:36186504-36186526 ACCCTGACACACTGGGGAAGTGG + Intronic
1179449678 21:41460003-41460025 GCCCTGGCCTCATGGTGAGGAGG - Intergenic
1179577704 21:42318150-42318172 GCCCAGGGCTCCTGGGGAGGGGG - Intergenic
1180092202 21:45538884-45538906 GCCCTGGCCGTGTGGGGCGGGGG - Intronic
1180172624 21:46067700-46067722 GGCCAGGCCCACTGAGGTGGAGG + Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181385105 22:22538981-22539003 GGCTTGGCCAACTTGGGAGGCGG - Intergenic
1181430957 22:22881473-22881495 GCCCTGTCACACTGAGCAGGAGG + Intronic
1182303773 22:29353903-29353925 GCCCTGCAGCTCTGGGGAGGGGG - Intronic
1182572544 22:31249653-31249675 GACCAGGACCACTGGTGAGGGGG - Intronic
1183065723 22:35361344-35361366 GCCCTGGACTTCTGGCGAGGCGG - Intergenic
1183070691 22:35393950-35393972 GCCATGGCCCACGGGGAAAGTGG - Exonic
1183072130 22:35403455-35403477 GCCCCGGCCTTCTGGGGAGGAGG + Exonic
1183306367 22:37085305-37085327 GCCCTGGCCCAATGGAGAGATGG - Intronic
1183491791 22:38120732-38120754 GCCCTGGCGCACTGGGGCCGTGG - Intronic
1183673044 22:39283935-39283957 GCCCTGTCCCGCCGGGCAGGGGG - Intergenic
1184176475 22:42792207-42792229 GCTGTGGCCCACTGTGGGGGCGG - Intergenic
1184322065 22:43749444-43749466 TCCATGGGCCAGTGGGGAGGGGG + Intronic
1184606718 22:45578635-45578657 GTCCTGTCCCACTGGGTGGGTGG + Intronic
1185326691 22:50229078-50229100 TGCCGGGCCCACTGGGGAGCAGG + Intronic
950135638 3:10578931-10578953 GCGGTGGCCTCCTGGGGAGGTGG + Intronic
950172900 3:10851781-10851803 GCCCTTGGCCACTGGGCAGGGGG + Intronic
950418024 3:12879691-12879713 GCCCTGCTCCACTGGGGAGGGGG + Intergenic
950459197 3:13111207-13111229 CCCTGGGCACACTGGGGAGGTGG - Intergenic
950471517 3:13189408-13189430 GCCCAGGGCATCTGGGGAGGAGG - Intergenic
951641733 3:24844170-24844192 ACCCTTGCCCAATGGGGAGGAGG + Intergenic
953070579 3:39515492-39515514 GCCCTAGCCCACAGGGGACAAGG + Exonic
953215018 3:40909854-40909876 GCCCTGGCCCACTATGGCAGTGG - Intergenic
953666152 3:44927915-44927937 GCCCTGCCCCACCTGGGAAGGGG - Intronic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
954882228 3:53844139-53844161 GCCCTGGCCCCCTGGGGCTTAGG - Intronic
956435623 3:69232013-69232035 TCCCTGGCCGGCTGGGCAGGAGG + Intronic
956605254 3:71067057-71067079 GGGAAGGCCCACTGGGGAGGTGG + Intronic
956737647 3:72250456-72250478 GCCCCTGCCCAGTGTGGAGGTGG + Intergenic
961444254 3:126971829-126971851 ACGCAGGCCCACTGAGGAGGGGG - Intergenic
961558416 3:127712299-127712321 GCCCTGGCCTACAGGGAGGGTGG - Intronic
962842884 3:139251783-139251805 GCCTTGTGCCAATGGGGAGGTGG - Intronic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
963906787 3:150779493-150779515 GCCCTGGACCACCATGGAGGTGG - Intergenic
965439922 3:168699830-168699852 GCTCTGGGTCACTGGGGAGCTGG - Intergenic
965768884 3:172159998-172160020 GTCCTGGGTCACTGGGAAGGTGG + Intronic
966866333 3:184260865-184260887 GCCCTGGCACCCGGGCGAGGGGG - Intronic
966936949 3:184717019-184717041 ACCCTGGCCAGCGGGGGAGGGGG + Intergenic
966975398 3:185078594-185078616 GTCCTCTCCCACTGAGGAGGAGG - Exonic
968131616 3:196195787-196195809 GGCATGGGCCACGGGGGAGGGGG - Intergenic
968512351 4:1001208-1001230 GCCCTGGGCCCCTGGGGTGGGGG + Intronic
968673105 4:1862817-1862839 GCCCTGCCGCCCTGGGGAGAGGG + Intergenic
968935079 4:3605562-3605584 GCCTCAGCCCACGGGGGAGGGGG - Intergenic
969608869 4:8216163-8216185 GCTCTTGCCCAGTGAGGAGGAGG + Exonic
970251010 4:14116150-14116172 GTCCTGGACCACTTGGCAGGAGG + Intergenic
971732721 4:30406700-30406722 GCCCTGCCCCACTGGGGCTGAGG + Intergenic
983661280 4:170132840-170132862 GCCCTTCCACACTGAGGAGGAGG - Intergenic
984615165 4:181888923-181888945 GCCCACCCTCACTGGGGAGGGGG + Intergenic
987099206 5:14577476-14577498 GCCCTGCCCCCGTGGGTAGGCGG - Intergenic
993098917 5:83512285-83512307 GCCAGGGCCCAGTGTGGAGGTGG + Exonic
995247652 5:109952673-109952695 GGCTTTGCCCACTGGGGAGAAGG + Intergenic
997579564 5:135008742-135008764 TCCCAGGCCCACTGAGGAGAAGG - Intronic
997622067 5:135305492-135305514 GCCCATGCCAACTGGGGAAGGGG - Intronic
998821340 5:146060367-146060389 GCCATGGCTCAGTGGGGAGTTGG - Intronic
999252263 5:150189984-150190006 GCCCTGAGCGAGTGGGGAGGGGG - Exonic
1000170263 5:158695457-158695479 GCCCTGGCTCATTGATGAGGAGG - Intergenic
1000368365 5:160511574-160511596 GTCCTGCTCCACTGGGGAAGAGG - Intergenic
1001042941 5:168349759-168349781 GCCGTGGGCCACTGGGCGGGAGG + Intronic
1002044100 5:176532413-176532435 CCGCTGGCCCACGGGGGCGGAGG + Exonic
1002045865 5:176541595-176541617 GCCCTTCCCCACTGCAGAGGAGG - Intergenic
1002424111 5:179165723-179165745 GCCCTGCCTCACTCAGGAGGTGG - Intronic
1002427272 5:179183716-179183738 GCACTGGCCTACAGGAGAGGAGG + Intronic
1002599338 5:180345418-180345440 TCCCAAGCCCACAGGGGAGGTGG + Intronic
1003149865 6:3539394-3539416 GCTCTAGTCCACTGGAGAGGTGG + Intergenic
1006278231 6:33023005-33023027 CTCCAGGCACACTGGGGAGGTGG - Intergenic
1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG + Intronic
1006508197 6:34504695-34504717 CTCCTGGAACACTGGGGAGGAGG - Intronic
1007078226 6:39081376-39081398 GCCCTGGCTCACTGTGGGGAAGG + Intronic
1007250653 6:40492701-40492723 GCCCTGGCCCCCAGCAGAGGAGG - Intronic
1007574443 6:42916052-42916074 GCCATGGCCCACTCGGAAGGAGG - Exonic
1008222669 6:48874694-48874716 GCCCTTCCACACTGAGGAGGAGG + Intergenic
1011657678 6:89566397-89566419 CCACTGACCCACTGGGGAAGCGG + Intronic
1013853316 6:114541853-114541875 GTGCTGGCCCACTGGGGCTGAGG - Intergenic
1017954530 6:159167879-159167901 GCCCTGAGCCAGTGGGGAAGTGG + Intergenic
1019270993 7:149177-149199 GCGCTGGCGCAGTGTGGAGGAGG - Intergenic
1019447482 7:1078913-1078935 GCCCTGACCCGCTGGGGTGGGGG - Intronic
1019622987 7:2001661-2001683 GCACTGTCCCACTGGGGACTCGG + Intronic
1021114428 7:16731774-16731796 GCCCTTGCAAACTGGGGACGGGG + Intergenic
1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG + Intergenic
1026159163 7:67853508-67853530 GCCCTGGCTAAGCGGGGAGGTGG + Intergenic
1026739064 7:72967108-72967130 GGCCTTGGCCACTGTGGAGGAGG + Intronic
1026790085 7:73325740-73325762 GGCCTTGGCCACTGTGGAGGAGG + Intronic
1026910808 7:74090744-74090766 CTCCAGCCCCACTGGGGAGGTGG + Intronic
1027104669 7:75397965-75397987 GGCCTTGGCCACTGTGGAGGAGG - Intronic
1028762449 7:94510323-94510345 GGCCCGGCCCGCGGGGGAGGCGG + Intronic
1029118573 7:98251614-98251636 GCCCAGCCCCACCGGGCAGGAGG + Intronic
1029667848 7:102007444-102007466 GCCCTGGCACCCAGGGGCGGAGG - Intronic
1031034235 7:116770104-116770126 GCTCTGGCCTCCTGGGGTGGTGG - Intronic
1032386496 7:131529305-131529327 CCCCTGGCCCCCGGGGGAGCTGG - Intronic
1033220944 7:139525813-139525835 GCCCAGCCACAGTGGGGAGGAGG - Intronic
1033290552 7:140079254-140079276 GCCCTGACCCCCTCGGGAAGTGG + Intergenic
1034116839 7:148591003-148591025 GCCTTGCCCCACTGGGCAGGAGG - Exonic
1034200911 7:149282313-149282335 GCCCTGGCCCAGCCGGAAGGAGG + Exonic
1034238548 7:149591904-149591926 GCCCAGGCCCACCGGGGACAGGG - Intergenic
1035184039 7:157111942-157111964 GCACAGGACCACTGGTGAGGCGG + Intergenic
1035237531 7:157508601-157508623 GCTCTGTCCCCCTGGGAAGGTGG + Intergenic
1036214248 8:6865986-6866008 CCCCTGGCCAGCTGGGGAGGGGG + Intergenic
1036656977 8:10683114-10683136 GCCCTGGCCCACTCGCCATGGGG - Intronic
1037467160 8:19172019-19172041 GCCCAGGCAGGCTGGGGAGGCGG - Intergenic
1037963190 8:23115149-23115171 GCCTGGGCCTGCTGGGGAGGAGG - Intronic
1038423625 8:27450947-27450969 GCCCCAGCCACCTGGGGAGGTGG - Intronic
1038429859 8:27491326-27491348 GCCCCGACCCACTGCGGCGGCGG - Intronic
1038439874 8:27564348-27564370 GCCCTGGCTGAATGGGGAGAGGG - Intergenic
1040122837 8:43701540-43701562 GCCCTTCCACACTGAGGAGGAGG - Intergenic
1041487171 8:58392110-58392132 GCCCAGGCCCACCAGGGAGTTGG + Intergenic
1045495031 8:102700856-102700878 GCCCTGGGAGGCTGGGGAGGAGG - Intergenic
1045509656 8:102805065-102805087 GGCCTGGCCCAGTGGGGGGCAGG - Intergenic
1046069387 8:109232238-109232260 ACCCTGCTCCACTGGGTAGGTGG + Intergenic
1049001173 8:139826429-139826451 GCCCTGGCCAGCTGGGGCTGTGG + Intronic
1049241565 8:141540069-141540091 GCCCTGGCTCACAGGGTAGCTGG + Intergenic
1049272044 8:141701086-141701108 GCCCAGGCCCAGAGGGGAGGGGG + Intergenic
1049673877 8:143881169-143881191 ACCCTGGCTGACTGGGGATGGGG - Intergenic
1049680394 8:143915515-143915537 ACCCAGACCCAGTGGGGAGGCGG - Exonic
1049684038 8:143932126-143932148 GGCCCGGCCCACGGTGGAGGTGG - Exonic
1049685853 8:143939049-143939071 GCCCGGGCCCGCTGGGGTGTTGG + Intronic
1049788578 8:144462777-144462799 GGCCGGGCCCACTGAGGCGGCGG - Intronic
1050594713 9:7194088-7194110 ACCCTGGGCCAAGGGGGAGGAGG - Intergenic
1051087411 9:13365945-13365967 TCTCTGGCCCACTGGCGTGGTGG + Intergenic
1051425074 9:16924556-16924578 GCCCTGCCCTGTTGGGGAGGCGG + Intergenic
1053004408 9:34594436-34594458 GCCCTGACCCTGGGGGGAGGGGG - Intergenic
1054455097 9:65426415-65426437 GCCTCAGCCCACGGGGGAGGGGG + Intergenic
1056382050 9:86064559-86064581 GCCCTGGCCATGTGGGGAGAGGG - Intronic
1056649813 9:88449068-88449090 GCCCTCGATCACAGGGGAGGAGG - Intronic
1059164676 9:112066768-112066790 GCCCTGGGCCAGTGGGGATTTGG - Intronic
1059245810 9:112848755-112848777 GCCCAGGCCAACTGGAGAGAGGG + Intronic
1061001905 9:127907379-127907401 GCCCTGACCTGCTGGGGAAGGGG + Intergenic
1061179120 9:129013689-129013711 GCCCAGGCCTACTAGGGAGATGG - Intronic
1061450469 9:130664599-130664621 GGCCGGGCCGACGGGGGAGGTGG - Exonic
1061958770 9:133977448-133977470 TCCCAGGCCCCCTGGGGTGGCGG - Intronic
1062033438 9:134372268-134372290 ACACGCGCCCACTGGGGAGGTGG + Intronic
1062094094 9:134694221-134694243 GCCCTGGATCACGGGGGTGGGGG + Intronic
1062290928 9:135794024-135794046 ACCCTGGCCCCCAGGCGAGGGGG + Intergenic
1062322409 9:135996863-135996885 TCCCTTGCCAACTGGGGAGGTGG + Intergenic
1062393864 9:136344849-136344871 GCCCCGCCCCATTGGGGAGGGGG - Intronic
1062397388 9:136357957-136357979 GCCCCGGACCACTGGGGCTGGGG + Intronic
1062423295 9:136494293-136494315 GTCCTGGCCCACGGGGGTGTGGG - Intergenic
1062429355 9:136520092-136520114 GCCCTGGCAGCCTGTGGAGGAGG - Intronic
1062630594 9:137461444-137461466 GCCGTGGGCCTCTGGGGTGGGGG + Intronic
1189272293 X:39759981-39760003 GCCCTGGTCCACGGAGGAGCGGG - Intergenic
1189478900 X:41377882-41377904 GACCTGTCCCACAGGGCAGGAGG - Intergenic
1191866296 X:65706455-65706477 GGGGTGGCCCCCTGGGGAGGTGG + Intronic
1192209614 X:69119440-69119462 GCCCCTGCCCACTGGGGAAAAGG + Intergenic
1192575289 X:72238787-72238809 GACCTGGCCCAGGGTGGAGGTGG - Intronic
1197541205 X:127764213-127764235 GCCATGGCCCATTGGGCAGGAGG - Intergenic
1198215334 X:134549817-134549839 GCCTTGGCCCGCTGCGGGGGAGG + Intergenic
1198222363 X:134614073-134614095 GCCCTGGGCTGCTAGGGAGGTGG - Intronic
1200098499 X:153675387-153675409 TCCCAGGCCCACTTTGGAGGTGG - Intronic
1200116989 X:153773756-153773778 GCCCATGCCCAGTGGGGAGGAGG + Intronic
1200961001 Y:8996124-8996146 GCCCTTCCACACTGAGGAGGAGG + Intergenic