ID: 936073878

View in Genome Browser
Species Human (GRCh38)
Location 2:109389291-109389313
Sequence CTGTGCAAACAGGAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 388}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936073872_936073878 -1 Left 936073872 2:109389269-109389291 CCTTGTGCATCAGGTTCACACCC 0: 1
1: 0
2: 0
3: 7
4: 180
Right 936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 388
936073871_936073878 4 Left 936073871 2:109389264-109389286 CCGCTCCTTGTGCATCAGGTTCA 0: 1
1: 0
2: 0
3: 17
4: 211
Right 936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 388
936073870_936073878 5 Left 936073870 2:109389263-109389285 CCCGCTCCTTGTGCATCAGGTTC 0: 1
1: 0
2: 0
3: 18
4: 189
Right 936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 388
936073867_936073878 11 Left 936073867 2:109389257-109389279 CCAGGCCCCGCTCCTTGTGCATC 0: 1
1: 0
2: 2
3: 11
4: 205
Right 936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 388
936073869_936073878 6 Left 936073869 2:109389262-109389284 CCCCGCTCCTTGTGCATCAGGTT 0: 1
1: 0
2: 0
3: 9
4: 87
Right 936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936073878 Original CRISPR CTGTGCAAACAGGAGGAAGA GGG Intronic
900206373 1:1433537-1433559 CTGTGCCTGCAGGAGGCAGAGGG + Intergenic
900481332 1:2900883-2900905 CTGTGCAGGAAGGAGGCAGACGG - Intergenic
900583396 1:3420475-3420497 CCGCGCAAGCAGGAGGAAGCAGG + Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901574213 1:10187013-10187035 CTGTTCAAAAAGGTGGAAAATGG + Intergenic
902397745 1:16141704-16141726 CTATGCCAAGAGGAGGAAGTGGG + Intronic
902568186 1:17329209-17329231 CTGTGTATACAGGAGGCTGAGGG + Intronic
902984397 1:20146771-20146793 CTGTTCAAACATGAGGTGGAGGG + Intronic
903218544 1:21856023-21856045 CTGTGCACACAGGAGCCAGAGGG + Intronic
903737926 1:25542182-25542204 CTGTGCCAAAAGGAGCCAGAGGG - Intergenic
904073663 1:27823068-27823090 CTATGCAGACAGGTGGGAGAGGG - Exonic
904450443 1:30607607-30607629 ATGTGCAAACACGAGTTAGAGGG - Intergenic
904799261 1:33081370-33081392 CTCTGCTGACAGGAGGCAGAAGG - Exonic
904899672 1:33846997-33847019 CTGTGGGAACAGGAAGCAGATGG + Intronic
906754844 1:48301578-48301600 CTGAGCAAACAGAACGAAGTTGG + Intronic
907872246 1:58453948-58453970 ATGTGCAAGCAGGAGAAAGCAGG - Intronic
907881302 1:58551357-58551379 CTGTTCGTACACGAGGAAGAGGG + Intergenic
909883856 1:80915269-80915291 GTGAGCAAAATGGAGGAAGAAGG - Intergenic
910345924 1:86238275-86238297 CTGTGCAAATAAGAGGAGGGAGG - Intergenic
910400651 1:86834866-86834888 CTGTGCATTCAGTAGGAATAAGG + Intergenic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
915944819 1:160141896-160141918 CTGGGCAGACAGGTGGGAGATGG + Exonic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
916622964 1:166521253-166521275 AGGTGCAAGCAGGAAGAAGATGG - Intergenic
916804265 1:168243465-168243487 CTGTGCAGCCAGCAGGAAGTAGG + Exonic
917509978 1:175661862-175661884 CTGTGGAGGCAGGAGAAAGAGGG - Intronic
919070812 1:192752564-192752586 CTGTGCACACAGGAGAATTATGG - Intergenic
920044944 1:203127104-203127126 CTGTGCTATGAAGAGGAAGAAGG + Exonic
920086412 1:203421059-203421081 CTTTGCAAACATGAGGAGAAAGG + Intergenic
920206959 1:204299246-204299268 GAAAGCAAACAGGAGGAAGAAGG + Intronic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
922029150 1:221781361-221781383 CTGTGCAACCTGGAGGGACAGGG - Intergenic
922322865 1:224503408-224503430 GGGTCAAAACAGGAGGAAGAAGG - Intronic
922814834 1:228441206-228441228 CTTTGAAACCAGGAGGGAGAAGG + Intergenic
922990889 1:229910175-229910197 GTGTGGAAACAGCAAGAAGAAGG + Intergenic
924273465 1:242359345-242359367 CTGTGGCAACTTGAGGAAGAGGG + Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
924866745 1:247990951-247990973 CTCTGCAGAAGGGAGGAAGAAGG + Intronic
924870530 1:248038951-248038973 CTCTGCAGAAGGGAGGAAGAAGG + Exonic
1063182645 10:3619113-3619135 CCCTGGAAACAGGAGGAGGAGGG + Intergenic
1063517211 10:6708771-6708793 ATCTGGAAACAGGAGCAAGAAGG - Intergenic
1063946315 10:11179797-11179819 TTGTACAAACAGGGGGAAGGAGG + Intronic
1064203305 10:13302166-13302188 CTGTGCAAACAGGAAGGGGCTGG - Intronic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1065787569 10:29230383-29230405 CTGTGGAGATAGGAGGCAGAGGG - Intergenic
1066010528 10:31190046-31190068 GTGTACAAACATGAAGAAGAAGG + Intergenic
1066711252 10:38237309-38237331 CTGTGGCAACTTGAGGAAGAGGG - Intergenic
1066782732 10:38970386-38970408 GTGTGCCAACGGGAGAAAGAAGG + Intergenic
1067211551 10:44263786-44263808 GTGTAGATACAGGAGGAAGATGG + Intergenic
1070186762 10:74071151-74071173 TTCTGCAAAAAGTAGGAAGAGGG - Intronic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1071289888 10:84181071-84181093 CCGTGCAAAGAGGAGGGAGAGGG + Intronic
1071289900 10:84181123-84181145 CCGTGCAAAGAGGAGGGAGAGGG + Intronic
1071289912 10:84181175-84181197 CCGTGCAAAGAGGAGGGAGAGGG + Intronic
1071585499 10:86816609-86816631 CTCTGCAAACAAGTGGAAAAAGG - Intronic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1072173800 10:92895648-92895670 CTGTTCAAACAAAAGGAAGCAGG + Intronic
1072407692 10:95170033-95170055 CTGTGCAATCAGGCAGAAGAAGG - Intergenic
1072532696 10:96334464-96334486 CTGGGAAAACAGGAGAAACAGGG - Intronic
1074640599 10:115376153-115376175 CTTATAAAACAGGAGGAAGAAGG - Intronic
1075611735 10:123860042-123860064 CTGGGCAAGCAGGAGAAACAAGG + Intronic
1075640466 10:124060634-124060656 CTCTGCACACTGGAGGTAGAGGG - Intronic
1075663935 10:124217557-124217579 CAATGCTAACAAGAGGAAGAAGG + Intergenic
1076497662 10:130907536-130907558 GTGTGAAAACAGGAGGAAGCTGG - Intergenic
1077960570 11:7072737-7072759 GTGTGCAAAGGGGAGCAAGATGG - Intergenic
1078449234 11:11428057-11428079 CTGGGCTAACGGAAGGAAGAGGG - Intronic
1078613380 11:12841628-12841650 GGGTGCAAACTGAAGGAAGATGG - Intronic
1078927836 11:15890403-15890425 GTGTGCACAGAGGAGGGAGAAGG - Intergenic
1079986974 11:27209885-27209907 GTGTGTAAAGAGGAGGAAGATGG + Intergenic
1080054541 11:27892529-27892551 CTATACAAAAGGGAGGAAGAAGG + Intergenic
1080916567 11:36666319-36666341 CTGTCCCAACAGCAGGAAAACGG + Intergenic
1081819829 11:45981545-45981567 CTGCCCTAATAGGAGGAAGAAGG + Intronic
1081864613 11:46352651-46352673 CTGTTCAAGGAGGAGGCAGAGGG - Intronic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082798686 11:57397563-57397585 CTATGGTAAGAGGAGGAAGAGGG - Intronic
1083000447 11:59286362-59286384 GTGTGCATATAGCAGGAAGACGG + Intergenic
1083407520 11:62468594-62468616 CTGAGAAATCAGGAGAAAGAGGG + Intronic
1084057693 11:66647170-66647192 CTGTAGAAACTGGAGCAAGAAGG - Intronic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1085986518 11:81794062-81794084 CGGTGAAAGCAGGAGCAAGAGGG - Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1088175057 11:107044077-107044099 CTGTGCACAAAGCAGGAAGTGGG - Intergenic
1088340373 11:108758716-108758738 AAGTGGAAACAGGAGGCAGAAGG - Intronic
1089099112 11:115945980-115946002 CTGAGCAGACAGGAGAGAGAAGG + Intergenic
1089968799 11:122675802-122675824 CGCTGCAAACTGGAGGAAAATGG - Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1091527026 12:1313136-1313158 TTTTGCAAGCAGGAGGAAGAAGG - Intronic
1093993364 12:25614884-25614906 GTGTGAAAACAGGGAGAAGATGG - Intronic
1094646418 12:32328870-32328892 CTGTGGAAACAGGAGATGGAGGG + Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1096674506 12:53219308-53219330 TTGTGCACACAAGAGGGAGAAGG - Intronic
1097845735 12:64363528-64363550 CTTTGCGAGGAGGAGGAAGAGGG + Intronic
1097866150 12:64560663-64560685 CTGAGAAAACAAGAGTAAGATGG - Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099136462 12:78909982-78910004 ATGTGAACAGAGGAGGAAGAAGG - Intronic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100182713 12:92102864-92102886 CAGTTCAAACTGGGGGAAGAGGG + Intronic
1100442745 12:94631477-94631499 ATGTGAAGACAGGAGAAAGACGG + Intronic
1101209986 12:102525962-102525984 CAGTACAAACAAGAGTAAGAGGG - Intergenic
1101321640 12:103678099-103678121 CTGTGGAAAGAGGTGGAAGCAGG - Intronic
1101649058 12:106658515-106658537 CTGAGCCACAAGGAGGAAGAAGG - Intronic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102513158 12:113429137-113429159 CTGTGCAGAAAGGAGGAAAGGGG - Intronic
1102609402 12:114098185-114098207 CTGAGCCACCTGGAGGAAGATGG + Intergenic
1102647451 12:114413104-114413126 CTGAGCAGTCAGGAGAAAGATGG - Intergenic
1103477902 12:121232236-121232258 CTGTGCAAGCAGGAGGATGCGGG - Intronic
1103868267 12:124071493-124071515 CTGTCCAAAGTGGTGGAAGAGGG + Intronic
1105210123 13:18252668-18252690 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1106323423 13:28663818-28663840 CAGTCCAATCAGGAAGAAGAAGG - Intronic
1109059123 13:57590706-57590728 CTTTGCAATTAGGAAGAAGATGG - Intergenic
1109298697 13:60567513-60567535 CTTTGCAAATAGGAGGAAGAAGG + Exonic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110792054 13:79597284-79597306 CTTTGCCAAAAGCAGGAAGAGGG + Intergenic
1111052857 13:82907999-82908021 TTGTGCAAACAGGGGCAAAAGGG + Intergenic
1113084686 13:106556030-106556052 CAGTGCAGATAGGAAGAAGAGGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115140679 14:30167979-30168001 TGGTGAAAGCAGGAGGAAGAAGG + Intronic
1115514576 14:34172900-34172922 CGGTGCAAGCATGAGGAAGGGGG + Intronic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1117226487 14:53666119-53666141 CTGTGGAAATAGGTAGAAGAAGG - Intergenic
1117287918 14:54305558-54305580 ATGATCAAACAGAAGGAAGAAGG + Intergenic
1117667319 14:58070200-58070222 CAGCTCAAAGAGGAGGAAGAAGG + Intronic
1117897918 14:60507203-60507225 CTCTGCAAACTGGAGCAAGGGGG + Intronic
1117992965 14:61452763-61452785 CTGTTCAAACAGGATGGAAATGG - Intronic
1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG + Intronic
1120044590 14:79791698-79791720 CCGTGCAAACCCAAGGAAGAAGG + Intronic
1120904546 14:89608992-89609014 CTGTACAACATGGAGGAAGAAGG + Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1124626350 15:31309601-31309623 GTGCGGTAACAGGAGGAAGACGG - Intergenic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127205742 15:56716389-56716411 CTAGGCAAACAGGAGAAGGAAGG + Intronic
1127581770 15:60345381-60345403 CTTTGCAAAGAGAAGGAAAAGGG - Intergenic
1127908404 15:63394963-63394985 CTGGGCAACTAGGAGGATGATGG - Intergenic
1128147404 15:65339611-65339633 CTGAGCAAACATGAGGAAGTGGG + Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1130034691 15:80347368-80347390 TTGTGTAAACAAGAGGAAAAGGG + Intronic
1130416674 15:83701073-83701095 CTCTGCAAACAGGAGAAGCAGGG - Intronic
1130635969 15:85620283-85620305 CTGTGCACAGTGGAGGATGAGGG + Intronic
1131329209 15:91480661-91480683 CTGTGTAAGCAGGAGACAGAAGG + Intergenic
1131797255 15:96031787-96031809 CTCTACAAAAAGGAGGAAAAAGG - Intergenic
1133187782 16:4112803-4112825 CTGTTTAAAAAGGAGGAAGTGGG + Intronic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134634070 16:15778905-15778927 GTGGGCAAGCAGGAGGCAGATGG + Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134912251 16:18038199-18038221 CTTAGCAAACAGGAGGAAAAGGG - Intergenic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135178887 16:20255763-20255785 GTGGGCAAGGAGGAGGAAGAAGG - Intergenic
1135539476 16:23318973-23318995 GTGTGCAAACACCAGGAAGGAGG + Intronic
1135893991 16:26381929-26381951 CTGAGGACACAGGAGGAAGCAGG - Intergenic
1136043447 16:27598356-27598378 ATGTGCAGACAGGAGAGAGACGG - Intronic
1136922739 16:34345578-34345600 CTGAGCAGACAGGAGTAGGAGGG + Intergenic
1136981834 16:35066228-35066250 CTGAGCAGACAGGAGTAGGAGGG - Intergenic
1138293579 16:55868383-55868405 CTGTGCAAAAACTAGGAAGTTGG - Intronic
1138302772 16:55946440-55946462 CTCTGCAAACAGGAAGAACAAGG - Intronic
1141861170 16:86717609-86717631 CTAAGCAAAAAGAAGGAAGATGG + Intergenic
1143937523 17:10502405-10502427 ATGTGCAAAAAGAAAGAAGAGGG - Intronic
1143980598 17:10866168-10866190 CTGTGCAGAAAGGAGGGAGGAGG + Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1146456952 17:33015990-33016012 CTTGGCAAAGAGGAGGACGAAGG - Exonic
1146990392 17:37265594-37265616 CTGTTCAAAGAGGAGGAAATAGG + Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1149521503 17:57321499-57321521 CTCTGGAAACAGGAGGACAAGGG + Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1152405335 17:80095111-80095133 CTGTGCCGCCAGGAGGAACAAGG - Intronic
1152844574 17:82591800-82591822 CTTTGGAAACAGGAAGCAGAAGG - Intronic
1156495017 18:37519964-37519986 CTGGGAAAACGGGAGGGAGAAGG + Intronic
1156547881 18:37983881-37983903 CAGAGCTCACAGGAGGAAGAAGG - Intergenic
1157129884 18:44996907-44996929 CTGTGCAAAAAGCAGTGAGATGG + Intronic
1158489309 18:57895437-57895459 CTGAGCAAACAGGAAGACGCTGG - Intergenic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1162270229 19:9608338-9608360 CTGTGAAGACATGAGGAAGTGGG + Exonic
1162275470 19:9650540-9650562 GTGTGAAAACATGAGGAAGTGGG + Intronic
1165145189 19:33726043-33726065 CGGTTCTTACAGGAGGAAGAGGG - Intronic
1166612714 19:44213191-44213213 ATTTGCAAAGAGGAGGAAGGAGG + Exonic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
925219636 2:2127725-2127747 CTGAGCAAAGATGAGGAAGGAGG + Intronic
925296257 2:2779596-2779618 CTGTGCAAGCAGGAGGCAGGGGG - Intergenic
925896523 2:8476539-8476561 CTGTGCCAACAGCAGGAATGAGG + Intergenic
926032670 2:9605912-9605934 GTGTGCTAACATGAGGGAGAGGG - Intronic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927339499 2:21966331-21966353 CTGAGCAAGCAGCAGGAACAAGG + Intergenic
927517400 2:23680349-23680371 CTGGGCATGCAGGAGGAAGTGGG + Intronic
927974421 2:27327226-27327248 CTGCGCATGCAGGAGGGAGAGGG - Exonic
928360768 2:30660534-30660556 ATATGCAAACAGCAGGAAGGTGG + Intergenic
928855006 2:35792644-35792666 GTGTGGAAACTGGAGGAACATGG + Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929750570 2:44708410-44708432 CTGCTCAAACAGGAGAAAGGAGG + Intronic
929818741 2:45257082-45257104 CTGTGGAAGCGGGAGGAACATGG + Intergenic
930179715 2:48341682-48341704 CTGTGCCAAGAGGAAGAACATGG + Intronic
931590129 2:63873977-63873999 TAGTCCAAACAGCAGGAAGAAGG + Intronic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
931910122 2:66889917-66889939 CTGGGCAGAGAGGAGAAAGAAGG - Intergenic
932452756 2:71825414-71825436 AAGTGCAAACAGGAGAAAGAAGG + Intergenic
933592308 2:84246639-84246661 CTGTGCAAAAAGGAAGAACGAGG - Intergenic
934528010 2:95063837-95063859 CTGTGCACACAGCAGGAAAGGGG - Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
934953159 2:98593003-98593025 CTGTGCCAACAGTAGGCAAACGG + Intronic
936022711 2:109006864-109006886 TTATACAAACATGAGGAAGACGG + Intergenic
936039771 2:109141353-109141375 CTGAGCAAGTTGGAGGAAGAGGG - Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937140040 2:119592125-119592147 ATGTACAAAGAGGAGAAAGAGGG + Intronic
937253355 2:120538117-120538139 CTGTGCCCAGAGGAGGAACAGGG + Intergenic
937774168 2:125756060-125756082 GTGTGAGAAGAGGAGGAAGAGGG + Intergenic
938849413 2:135245298-135245320 CTGGGCAATCAGCAGGAAGTTGG + Intronic
939105450 2:137943623-137943645 CTCTGCAAACATGAGGAAACGGG - Intergenic
939241854 2:139571839-139571861 CTCTGAAAACAGGAAGATGAAGG + Intergenic
939366939 2:141245908-141245930 TTGTGGAAAAAAGAGGAAGAAGG - Intronic
940426437 2:153536385-153536407 CTGTCCAATCTGGAGGAGGAGGG + Intergenic
942330080 2:174814180-174814202 CTCTGCATACATGTGGAAGATGG + Intronic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
942920668 2:181369849-181369871 CAGTCCAAACATCAGGAAGAAGG + Intergenic
945800044 2:214417596-214417618 GTCTGCAAAGAGGAGGGAGATGG + Intronic
946469225 2:219940835-219940857 CAGTGCAAAATGGATGAAGATGG + Intergenic
946617565 2:221526500-221526522 CTGAGCACACAGGAGAAAGGTGG - Intronic
947008151 2:225536233-225536255 TTGGGAGAACAGGAGGAAGAAGG - Intronic
947152593 2:227130546-227130568 GACTCCAAACAGGAGGAAGAGGG - Intronic
947376055 2:229496034-229496056 CTGTAAGAACAGGAGCAAGAAGG - Intronic
948579042 2:238971678-238971700 CTGTGGTAACAGGAGGCAGGGGG - Intergenic
948768683 2:240236365-240236387 AGGTGCAAACAGGAGGACGATGG - Intergenic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
1169051928 20:2586325-2586347 GTGTTCAAACAGGAGAAAAATGG + Intronic
1169149960 20:3281807-3281829 CATTGCAAAGTGGAGGAAGAGGG + Intronic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1169801866 20:9518795-9518817 CTGTGCATCCAGAAGGCAGAGGG + Intronic
1170022668 20:11853092-11853114 CTATGCATCCAGGATGAAGAAGG + Intergenic
1171291271 20:23984358-23984380 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1173898589 20:46569809-46569831 GTAAGAAAACAGGAGGAAGAGGG - Intronic
1174116560 20:48230444-48230466 CTGTGCAAACAGCCTGATGATGG - Intergenic
1174402766 20:50284825-50284847 CTGTGCAGGCAGCAGGAAGCTGG - Intergenic
1175054413 20:56185213-56185235 TTGTGGGAACAGGAGCAAGAAGG - Intergenic
1175237271 20:57523886-57523908 CTGAGCATACAGCAGCAAGAAGG - Exonic
1176059701 20:63167214-63167236 CTGTGGAAACAGGAGCAATGAGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177048484 21:16201543-16201565 TTGTGCAACCAGGTGGATGATGG - Intergenic
1177421883 21:20870094-20870116 CTGTTCAAACAGAAGCAAGGAGG - Intergenic
1177735763 21:25086703-25086725 CTGAGGACACAGGAAGAAGAGGG + Intergenic
1177883236 21:26718818-26718840 CTTTGCAAAGAGGATGAAGACGG + Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1179094440 21:38299686-38299708 CTGAGCAACCAACAGGAAGATGG - Exonic
1179818786 21:43924546-43924568 GATTGCTAACAGGAGGAAGATGG - Intronic
1180004381 21:45013315-45013337 CTGTGCAAACAGCCAGCAGAAGG + Intergenic
1180746013 22:18089520-18089542 CTGTGCTGTCAGGATGAAGAAGG + Exonic
1180766134 22:18346736-18346758 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
1180780179 22:18515642-18515664 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1180812895 22:18772963-18772985 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1181199073 22:21207279-21207301 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1181400689 22:22648577-22648599 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
1181702669 22:24629675-24629697 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183141888 22:35950176-35950198 CTCAGAAAACAGGAAGAAGATGG - Intronic
1183342855 22:37291539-37291561 CTGGGCAAACATGGGGAAGTGGG + Intronic
1184792998 22:46712641-46712663 GTGTGCAGACAGCAGGAAGAAGG + Intronic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
1185128870 22:49026121-49026143 CTTTCCAGTCAGGAGGAAGAGGG - Intergenic
1185180351 22:49356690-49356712 GCATGGAAACAGGAGGAAGATGG - Intergenic
1203227752 22_KI270731v1_random:87627-87649 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950882490 3:16334591-16334613 CGGGGCATACAGGATGAAGAGGG + Intronic
950916242 3:16648086-16648108 CAGAGCAAACAGGCAGAAGAAGG - Intronic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
953892554 3:46764138-46764160 CTGTGCAAAGAGGAGAGAAAGGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
956575523 3:70748549-70748571 GTGGGGAAACAAGAGGAAGAGGG - Intergenic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
958962566 3:100523843-100523865 CTGTTCAAAAAGGAATAAGAAGG - Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
961831063 3:129623290-129623312 CTGTGAAGACAGGAGGGAGAAGG + Intergenic
961916191 3:130377516-130377538 CTGTTCGACCAGGAAGAAGAGGG + Intronic
962626807 3:137233816-137233838 CTGTTCAAGAAGGAGGAATACGG - Intergenic
962628685 3:137253276-137253298 CTTTGCAGCCAGGAGGAAGTGGG + Intergenic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
962857153 3:139357957-139357979 CTCTGCAGACAAAAGGAAGAGGG + Exonic
963035198 3:141019706-141019728 ATGTCCAAAAAGGAGGAAGAAGG - Intergenic
965305114 3:167054743-167054765 CTGTGCACACAATAGGCAGAGGG + Intergenic
965380457 3:167981751-167981773 CTGTAAAAACAAGAAGAAGAAGG - Intergenic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966571690 3:181451263-181451285 CTGTCTAAAAAGGAGAAAGAGGG + Intergenic
966879463 3:184341853-184341875 ATGTGCAAACGGGAGGAGAAAGG - Intronic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
967754001 3:193147995-193148017 CTGGGCAAACAGGAAGGAGTTGG - Intergenic
968900700 4:3430501-3430523 CTGTGGAACCAGGAGGTAAACGG - Exonic
968930434 4:3575971-3575993 TTGTGCTAACAGGAGGCAGAGGG + Intergenic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
971282221 4:25250204-25250226 CCGTGCAAAGAAGAGGGAGAGGG + Intronic
971364863 4:25969570-25969592 CTGTCCAATCAGAAGGGAGATGG + Intergenic
972574592 4:40340021-40340043 CTATCAAAACAGGAGGGAGAGGG - Intronic
973624959 4:52762421-52762443 CTGTGAATAAAAGAGGAAGAGGG - Intergenic
973635313 4:52856993-52857015 CTGTGCAAACAGGATGTGGGAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
978338259 4:107693216-107693238 CTGTGAAAACAGGAACAGGAGGG + Intronic
979280819 4:118865688-118865710 CTTTGGAAACAGGAGGAAGGAGG + Intronic
979827055 4:125250894-125250916 CTGTGCAGATAGGAGGGAGGGGG - Intergenic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
985198480 4:187459291-187459313 CTGTGCAAACAGGATTTTGAAGG + Intergenic
985385581 4:189444193-189444215 CAAGGCAAACAGGATGAAGAAGG - Intergenic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
987665150 5:20927688-20927710 CTGAGCAAAAAGAAGAAAGATGG - Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988474517 5:31572084-31572106 ATGAGCAAACAGGAAGAAGAGGG + Intergenic
988757537 5:34274494-34274516 CTGAGCAAAAAGAAGAAAGATGG + Intergenic
988920557 5:35937477-35937499 CTGGGCCAACAGGAAAAAGAAGG - Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
991557542 5:67912517-67912539 ATGGTCAATCAGGAGGAAGAAGG + Intergenic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
992619081 5:78574711-78574733 CTGTGCTAACAGGTTGCAGATGG + Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
993170471 5:84412949-84412971 CTTTGCAAACAGAATTAAGAAGG + Intergenic
993248267 5:85480397-85480419 CTGTTAAAAGTGGAGGAAGAAGG - Intergenic
993367620 5:87052484-87052506 CTGAGCAAACAGAACAAAGAAGG + Intergenic
993969973 5:94407242-94407264 CTGTGCAAGCAGGATGTAAAAGG + Intronic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
994238323 5:97391653-97391675 ATGAGCAAAGAGGAGAAAGATGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995629681 5:114119624-114119646 GTGATCAGACAGGAGGAAGACGG - Intergenic
995759901 5:115552017-115552039 CTATTCAAATAGGGGGAAGAGGG - Intergenic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
997565467 5:134882825-134882847 CCGTGGAAAGAGGAGGGAGAGGG + Intronic
997857376 5:137384177-137384199 CTCTGTATACAGGAGGCAGATGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998258518 5:140609328-140609350 CTGTGCCAACAGGAAGCAGGAGG + Intergenic
998796565 5:145825998-145826020 CTGGGAAGACAGGAGGCAGATGG + Intronic
1000076375 5:157791427-157791449 CTTTGCACAGAGGAGGAACATGG - Intronic
1000307813 5:160011718-160011740 TTGTGCAATCAGAAGGAAGTAGG - Intronic
1001012083 5:168107732-168107754 CTGAGCAAAGAGGAAGAAGCAGG - Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1004889210 6:20082433-20082455 CTTTGCAAACGAGAGGAAGAGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006637676 6:35472211-35472233 CTTTGCAATCAGAAGGAAAAGGG + Intergenic
1008502601 6:52198897-52198919 CTGAGAATACAGGGGGAAGAGGG + Intergenic
1008638581 6:53437371-53437393 CTATGCAAAAAGAAGAAAGAAGG - Intergenic
1008828294 6:55726547-55726569 CTGTGAAAAATGGAGGAAGAGGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009474281 6:64068961-64068983 CTTTGTAAAAGGGAGGAAGAGGG + Intronic
1010508450 6:76688491-76688513 CTGTATAAAAAGGAGGCAGATGG + Intergenic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1011517355 6:88167344-88167366 CCGTGCACACAGGAGGCAGACGG - Intergenic
1012935157 6:105359780-105359802 TTGTCCTAACAGGAGGGAGAGGG - Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016479526 6:144467226-144467248 ATGAGCAGACAGGAGGAGGAGGG - Intronic
1016857227 6:148683350-148683372 CTGTGTAAACAGGAGACAGATGG - Intergenic
1017668635 6:156747762-156747784 CTTTGCAATAAGGAGGAGGATGG + Intergenic
1018570946 6:165209356-165209378 CACTGCAAAAATGAGGAAGATGG - Intergenic
1018734440 6:166676695-166676717 CTGTGGAAACATGAAGCAGATGG - Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1020756577 7:12211148-12211170 GGGCTCAAACAGGAGGAAGAAGG + Intergenic
1021454354 7:20813280-20813302 TTGTATAAACAGGAGGAATATGG + Intergenic
1021515615 7:21481328-21481350 GTGTGGAAACGGGAGGAAGTAGG + Intronic
1021973263 7:25985352-25985374 CTGTGCAAAGAACAGAAAGAAGG - Intergenic
1022471466 7:30684083-30684105 CTGTCCATTCAGGAGGCAGAGGG - Intronic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023519934 7:41039819-41039841 CTGAGGAAACATGAGCAAGAAGG - Intergenic
1023614212 7:42002422-42002444 CTGTTAAAATAGGAGGAATATGG + Intronic
1024540609 7:50472657-50472679 CCGTGCAAACTGGAGGCAAATGG + Intronic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1024782889 7:52872731-52872753 CTGAACAAAAAGGAGAAAGATGG + Intergenic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1026299710 7:69086671-69086693 CTGTGAAGACAGGATGCAGAAGG + Intergenic
1028251768 7:88545944-88545966 TTCTGCAGACAGGAGGAAAATGG - Intergenic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1030038659 7:105430573-105430595 CTGAGCACACAGTAAGAAGATGG + Intergenic
1030401447 7:109056345-109056367 CAGTGCAGAAAGGATGAAGATGG - Intergenic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033116136 7:138627142-138627164 CTGTGATAGCTGGAGGAAGATGG + Intronic
1033495214 7:141887233-141887255 CACTGCATACAAGAGGAAGAAGG - Intergenic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1035015531 7:155762630-155762652 CTCTGCAAAAAGAAGGAACATGG - Intronic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035529321 8:338345-338367 CTGTGAAAACATGAGGAGTAGGG + Intergenic
1036966224 8:13301097-13301119 CTGTGGATACAGGAGGATAATGG + Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037669593 8:21002664-21002686 CTGGGCAAACAGGAAGAAGCTGG + Intergenic
1038280180 8:26156905-26156927 CTGTGCAGCCAGAAGCAAGATGG + Intergenic
1039541954 8:38380613-38380635 GTTTGCAACCAGAAGGAAGAGGG + Intronic
1042166938 8:65954985-65955007 CTAGGCAAAAAAGAGGAAGAAGG - Intergenic
1042923895 8:73947341-73947363 GTGTGAAGACAGGAAGAAGATGG + Intronic
1045310924 8:101001943-101001965 TTGTGCAAAGAGCACGAAGATGG + Intergenic
1047343366 8:124003802-124003824 AGGTGCAAATAGGAGCAAGAAGG + Intronic
1048651130 8:136479316-136479338 CAGTGCAAACAGGTCTAAGAAGG - Intergenic
1048676546 8:136789832-136789854 CAGTGCAAACATGAGTAACATGG + Intergenic
1048874952 8:138829277-138829299 CTGCCCATGCAGGAGGAAGATGG + Intronic
1049204577 8:141357804-141357826 CCGGGCAAACAGGTGGAACAGGG + Exonic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1054459675 9:65455943-65455965 TTGTGCTAACAGGAGGCAGAGGG - Intergenic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1056608017 9:88103364-88103386 ATGAGGAAAGAGGAGGAAGATGG - Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1057270974 9:93651367-93651389 CAGTGGAAACAGGAGGCAAAGGG - Intronic
1057854992 9:98594942-98594964 CTTGGCAAACAGGAGGAAACAGG + Intronic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1061118632 9:128629756-128629778 CTGTGCCAAAAGGAGAGAGATGG - Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061712279 9:132496812-132496834 GTGTGCCAACAGGAAAAAGAAGG + Intronic
1185735371 X:2491814-2491836 CTGTGCAAACATCAGGCAGTCGG + Intronic
1186496800 X:10017136-10017158 CTGTGCAGGTAGGAGGAAGCAGG - Intronic
1187492130 X:19761950-19761972 CTGTGCAGCTATGAGGAAGAGGG - Intronic
1188999976 X:36933552-36933574 GAGTGAAAACAGGAGGAAAAAGG - Intergenic
1189296409 X:39921388-39921410 TTGTGTATAGAGGAGGAAGAGGG - Intergenic
1189551259 X:42095978-42096000 CTCTGCAAAGAGCAGGGAGAAGG + Intergenic
1190141423 X:47848884-47848906 CTGAGCAGACAGGAGAAAGATGG - Intronic
1190757437 X:53413139-53413161 CTGTGCAAACAGGGGAATGGTGG + Intronic
1191993197 X:67061999-67062021 CTGTGCAATCAGGCAGGAGAAGG - Intergenic
1192011739 X:67280240-67280262 CTGTTCAAAAAAGAGAAAGAAGG + Intergenic
1192591436 X:72363199-72363221 CTCTGCACACAGTATGAAGAAGG - Intronic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1195007873 X:100704482-100704504 CTGAGCAGAGAGGATGAAGAAGG + Intronic
1197324167 X:125070975-125070997 CTCTTCAAACAGAAAGAAGATGG + Intergenic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1197869267 X:131050278-131050300 CTGTGCACACATGTTGAAGAGGG - Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199321870 X:146449073-146449095 GTCTGGAGACAGGAGGAAGATGG - Intergenic
1200537996 Y:4422770-4422792 CAGTGCAATCAGGCAGAAGAAGG + Intergenic