ID: 936073949

View in Genome Browser
Species Human (GRCh38)
Location 2:109389909-109389931
Sequence CAGATTCAGGAGAAGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 433}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936073949 Original CRISPR CAGATTCAGGAGAAGGCAGA TGG (reversed) Intronic
901269733 1:7942513-7942535 CAGAAGCAGAAGAAGGCAGACGG + Intronic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904705880 1:32390365-32390387 AAGATACAGGAGATGGAAGAAGG + Intronic
904835552 1:33333319-33333341 AAGAATGAGGAAAAGGCAGATGG + Intronic
905167994 1:36094366-36094388 AAGATACAGGAGGAGGCACACGG - Intergenic
905211995 1:36380804-36380826 CTGATTCAGGCGAAAGCAAAGGG + Intronic
906151006 1:43587817-43587839 CAGACACAGGAGCATGCAGAGGG - Intronic
906228831 1:44143024-44143046 GAGAGTCAGGACAAGGCAGGAGG - Intergenic
907609084 1:55849791-55849813 GAGAGACATGAGAAGGCAGAAGG + Intergenic
908290762 1:62664902-62664924 CAGATTCAGGAGAGGGCAAAGGG + Intronic
908829148 1:68162657-68162679 CAGATTGAGGATGTGGCAGATGG + Intronic
909419230 1:75444933-75444955 GAGATTGAGGAGAAAGAAGAAGG + Intronic
910445465 1:87295348-87295370 GTGATTCAGGACAAGGCAAAGGG + Intergenic
910626720 1:89315107-89315129 CAAATTCTGGAGAAGCCAGGTGG + Intergenic
911422674 1:97663711-97663733 CAGATTCAGGAGACTTCACATGG - Intronic
911697268 1:100904787-100904809 CAGTTTATGGTGAAGGCAGAGGG + Intronic
912242324 1:107924106-107924128 CATATTCTGGAGAAGGGACATGG + Intronic
912700200 1:111872546-111872568 CAGATACATGAGGAGGCTGAAGG + Intronic
913272403 1:117107463-117107485 CAGATTCATTAAAAGGCACATGG + Intergenic
913658023 1:120980150-120980172 CAGATTTAGGAGCAGTTAGAGGG - Intergenic
914009378 1:143763219-143763241 CAGATTTAGGAGCAGTTAGAGGG - Intergenic
914421949 1:147537291-147537313 CAGATGCAGGAAAAGGGAGAGGG + Intergenic
914522594 1:148431395-148431417 CAGATTTAGGAGCAGTTAGAGGG - Intergenic
914648004 1:149671894-149671916 CAGATTTAGGAGCAGTTAGACGG - Intergenic
915038713 1:152949677-152949699 CAGGTGCAGGAGAAGGCACGGGG + Intergenic
916014114 1:160733293-160733315 CAGATGGAGGAGGAGGTAGAAGG + Intergenic
918094660 1:181324920-181324942 CAGATGCAGGAGATGGAAGGAGG - Intergenic
918119033 1:181521511-181521533 CAGAGTCAGGAGAAGACAGGAGG + Intronic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920433286 1:205932597-205932619 CAACTCCAGGAGAATGCAGATGG + Intronic
922135147 1:222817802-222817824 CAGATTCAGCAGAATGGACAGGG - Intergenic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922572001 1:226639850-226639872 CAGACACAGGAGAACGCAGAGGG + Intronic
922740474 1:228011418-228011440 CAGATGCGGGCGAAGGGAGAAGG - Intronic
922972163 1:229751745-229751767 CAAAGCCTGGAGAAGGCAGAGGG - Intergenic
924519738 1:244795611-244795633 CAGAAACAGGAGAGGGCAGAGGG - Intergenic
1063800548 10:9572636-9572658 GAGACCCAGGAGAAAGCAGATGG + Intergenic
1065404754 10:25351338-25351360 CAGCTTCAGCAGAAGGCAGTGGG + Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065819547 10:29512797-29512819 CAGACTCAGCAGGAGGCAGGAGG - Exonic
1065953308 10:30671608-30671630 CAGACTCAGCAGGAGGCAGGAGG + Intergenic
1067798791 10:49342171-49342193 CAGTTACAGTAGAAGGCAAAGGG + Intergenic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1068724056 10:60280984-60281006 CAGATTAAGGAGTAGGCAACTGG + Intronic
1068729308 10:60338510-60338532 CAAATTCAGTAGAATGCAGAAGG + Intronic
1069152014 10:64974472-64974494 CAGGTTCAGGAAAAAGCAAATGG + Intergenic
1070786716 10:79166318-79166340 CAGATTTAGGCAAAGGCAGAAGG - Intronic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071450754 10:85789993-85790015 CAGAGTCAGGAAAAGGGAGAGGG - Intronic
1072438985 10:95437640-95437662 CACAATCAGGAGGAAGCAGAGGG + Intronic
1072965087 10:99964945-99964967 TAGCTTCAGGAAAAGGAAGAAGG + Intronic
1073146976 10:101287541-101287563 CAGATACAGGGCAATGCAGAAGG + Intergenic
1073539676 10:104307950-104307972 CAGATTCAGGGCCAGGGAGAAGG - Intergenic
1073759831 10:106617291-106617313 CAGAGAGAGGAGGAGGCAGAAGG - Intronic
1074200702 10:111232489-111232511 CAGGTTGAGGAGAAACCAGAAGG - Intergenic
1074324430 10:112434827-112434849 CAGATTCAGGAGAAAGGTAAAGG + Intronic
1074850351 10:117434447-117434469 CCGATGCAGGAGGGGGCAGAGGG + Intergenic
1074899322 10:117803038-117803060 AAGATTTGGGAGAAGGGAGAAGG + Intergenic
1075348921 10:121706209-121706231 CAGGTACAGGGGGAGGCAGACGG + Intergenic
1075827989 10:125376875-125376897 GAGATGCAGGAGGAAGCAGAGGG + Intergenic
1075944392 10:126419637-126419659 ATGATTCAAGAGAAGGCTGAGGG + Intergenic
1076409387 10:130234954-130234976 CAGACCCTGGAGAAGGCAGCTGG - Intergenic
1077556453 11:3228332-3228354 CAGGTGCAGCAGCAGGCAGAGGG + Exonic
1077609699 11:3636743-3636765 GAGGCTCATGAGAAGGCAGAAGG + Intergenic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1078108945 11:8376391-8376413 CAAAGCCAGGAGAAGGCAGACGG + Intergenic
1078225313 11:9385913-9385935 CAGATTCAGCAGCATGCTGAAGG - Intronic
1078397033 11:10990323-10990345 CAGAATCAGGACAAAGCAGATGG - Intergenic
1079168481 11:18069006-18069028 TAGCTTCAGGAGAAGTGAGATGG + Intergenic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1080063997 11:27988381-27988403 AAGTTTCAGGGGCAGGCAGAAGG + Intergenic
1080304970 11:30826187-30826209 CAGATTCTTATGAAGGCAGATGG + Intergenic
1081594940 11:44452625-44452647 AAGCTTCGGGGGAAGGCAGATGG + Intergenic
1081741368 11:45443307-45443329 CAGGGTCTGGAGAATGCAGAGGG + Intergenic
1081931548 11:46875025-46875047 CAGGCACAGGAGAAGCCAGAAGG + Exonic
1082050726 11:47768338-47768360 CAGAGGCAGGAGACGGGAGAGGG - Intergenic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083140690 11:60718747-60718769 CAGCGTCAGTAGAAGGCAGGAGG + Intergenic
1083257816 11:61507489-61507511 CGGGTTCAAGAGAAGGCAGGAGG + Intergenic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1084410483 11:69003632-69003654 CAGAGCCAGGAGCAGGCAGGCGG - Intergenic
1084475593 11:69386915-69386937 CAGATCCAGGAGCAGGGACAGGG - Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1089744947 11:120610066-120610088 GAGAGACAGGAGAAGGCAGATGG - Intronic
1090640594 11:128726200-128726222 CAGCTTCAGGGGAGGGCAGGGGG - Intronic
1091037812 11:132249223-132249245 CAGAGACAGGATAAGGCTGAAGG + Intronic
1091127426 11:133113209-133113231 CAGATCCAAAATAAGGCAGATGG - Intronic
1091784797 12:3236770-3236792 CAGGTTCAGCAGGAGGGAGAGGG + Intronic
1096621684 12:52869400-52869422 GAGATTCAGGAGACAGGAGATGG + Intergenic
1097078880 12:56414890-56414912 CAGAATAAGGAGAAATCAGACGG + Intergenic
1101214347 12:102565599-102565621 AAGCTGCAGGAGATGGCAGAGGG + Intergenic
1101227454 12:102704161-102704183 GAGAAGCAGGAGAAGGGAGAAGG - Intergenic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1101901240 12:108792606-108792628 CATCCTCAGGGGAAGGCAGAAGG + Exonic
1102201113 12:111058614-111058636 CAGATACAGGAGAAGCTGGAGGG + Intronic
1103132644 12:118482490-118482512 GAGACACAGGAGAAGGCTGAAGG + Intergenic
1103401127 12:120643430-120643452 CAGAACCAAGAGAAGGCAGATGG + Intronic
1103890047 12:124231882-124231904 AAGATTCCTGAGCAGGCAGAGGG + Intronic
1104404482 12:128506201-128506223 CAGATGCAGGAGAAAGCAGTGGG + Intronic
1105406238 13:20134848-20134870 CAGGTGCAGAAGAAGGCAAATGG - Intergenic
1105415240 13:20206343-20206365 CAGACTCAGGAGAGCGCACAGGG - Intergenic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1106334106 13:28766802-28766824 CAGATATGGGAGAAGACAGAAGG + Intergenic
1108260489 13:48650966-48650988 CAGATTCAGAAGCAGGGAGTAGG + Intergenic
1108884493 13:55163685-55163707 CACATGAATGAGAAGGCAGAAGG + Intergenic
1109898280 13:68724189-68724211 CAGATTAAGGCCAAGGCAGGTGG - Intergenic
1110300482 13:73920886-73920908 GTGCTTCTGGAGAAGGCAGAGGG - Intronic
1110633410 13:77736646-77736668 CAGATTCAGCAGAAGACATAAGG - Intronic
1111436072 13:88209847-88209869 GAAATTCAGAAGGAGGCAGAGGG + Intergenic
1111957334 13:94773937-94773959 CAGATTATGGGGAGGGCAGATGG + Intergenic
1112274712 13:98005643-98005665 CAGATGCAAGAGAAGGCAGCAGG + Intronic
1112725713 13:102302134-102302156 CAGATTAAGGAGAATTCAAAAGG + Intronic
1113448595 13:110389360-110389382 CAGATTAGGGAGAAGGGTGATGG - Intronic
1114384636 14:22242470-22242492 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1114661248 14:24346623-24346645 AATTTTCAGGAGAAGGAAGAGGG - Intergenic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1116611231 14:47074728-47074750 CAGATTCAGGACAAAGGAAATGG - Intronic
1117460354 14:55939102-55939124 CAGAGTGGGGAGAAGGCAGTAGG + Intergenic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1118299892 14:64605920-64605942 AAGATCCAGGAGAGGGAAGATGG + Intergenic
1119912204 14:78359880-78359902 AAGGTTCTGGAGAAGGCAGGAGG - Intronic
1120321404 14:82966294-82966316 CAACTTCAGGAGAAGTCAAAAGG - Intergenic
1120489987 14:85165172-85165194 GAGATGCAGCAGAAGTCAGAGGG + Intergenic
1120633165 14:86916228-86916250 CAGATTCATCAGAAGGCCAAGGG - Intronic
1120917290 14:89721250-89721272 CAGCTTAAGGAGAGGGGAGAGGG - Intergenic
1120976162 14:90250020-90250042 CAGATACAGCAAAAGGAAGAAGG + Intergenic
1121102252 14:91257863-91257885 CAGACTCAGCAGGAAGCAGATGG - Intergenic
1122647430 14:103204556-103204578 CTGATTCAGCACCAGGCAGAGGG + Intergenic
1122674088 14:103396007-103396029 CTGAGTCGGGAGAGGGCAGAAGG + Intronic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1125227632 15:37413045-37413067 CACATTGAGAAGCAGGCAGAAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126183593 15:45809794-45809816 CAGATGTAGCAGAAGGTAGAAGG + Intergenic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127300760 15:57651376-57651398 ATGATTCAAGAGGAGGCAGATGG - Intronic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128198150 15:65779153-65779175 CAAATTCAAGAGAAGGAAAAAGG + Intronic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1129166851 15:73783376-73783398 GAGATGGAGGAGAGGGCAGAGGG - Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129250998 15:74308956-74308978 CACATACAGGAGAAGGCAGGAGG - Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130430475 15:83842212-83842234 CAGATGGATGAGGAGGCAGAAGG + Intronic
1130577068 15:85102386-85102408 CAGTTTCAGGAGAATGGCGAGGG + Intronic
1130717676 15:86351788-86351810 CAGCTTGTAGAGAAGGCAGAAGG - Intronic
1130989216 15:88865884-88865906 CATCTTCAGCAGCAGGCAGAAGG - Intronic
1131132271 15:89908032-89908054 CAGATACAGGAAATGGCAGGAGG + Intronic
1131987669 15:98061393-98061415 CAGGCTCAGAAGAAGACAGAAGG - Intergenic
1133033247 16:3021467-3021489 CACGTTTGGGAGAAGGCAGAAGG + Intronic
1133333982 16:4994855-4994877 GTGATTCAGGAGAGGGCAGAAGG - Intronic
1135125334 16:19804933-19804955 CATACTCAAGAGAAAGCAGAAGG - Intronic
1137660824 16:50204577-50204599 CATCTTCAGGAGACTGCAGATGG - Intronic
1138459184 16:57138002-57138024 CAAGGTCAGGAGAAGGCAGAAGG - Intronic
1138795846 16:59968079-59968101 CAGATTCAGTAGGAGGGAAAAGG + Intergenic
1138828629 16:60352051-60352073 AAGATGCAGGAGAAGGTAGTAGG + Intergenic
1139253049 16:65515207-65515229 CAGATGAAGGCGAAGGGAGATGG + Intergenic
1139485306 16:67252885-67252907 GAGCTTGAGGAGAAGGGAGAGGG - Intronic
1140613557 16:76632586-76632608 AAGGTTCAAGAGAAGGCATACGG - Intronic
1140946823 16:79776501-79776523 AAGTATCAGGAGAAGGCAAAAGG - Intergenic
1142694581 17:1626811-1626833 GGGATCAAGGAGAAGGCAGAGGG + Intronic
1143102215 17:4510660-4510682 CGGAGTCAGGAGGAGGCAGGAGG - Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1144484725 17:15655292-15655314 CAGCTTCAGTAGAAATCAGAAGG + Intronic
1144813242 17:18015519-18015541 CAGGAACAAGAGAAGGCAGAAGG + Intronic
1145118882 17:20237731-20237753 CACATTCCGAAGAAGTCAGAAGG + Intronic
1145839613 17:27983568-27983590 CAGGTAAAGGAGAAGGCACAGGG + Intergenic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1146636907 17:34513314-34513336 CAGATTTATGAGTAGGAAGACGG + Intergenic
1147163747 17:38582387-38582409 CAGCTGCTGGAGCAGGCAGAGGG + Intronic
1147165957 17:38593440-38593462 AAGCTTCAGGTGAAGGCGGAGGG + Intronic
1147660117 17:42112883-42112905 CAGGTTAAGGTGAAGGCAGGAGG + Intergenic
1147788770 17:42999548-42999570 CAGTCTCAGGAGATGGGAGAGGG - Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148619089 17:49021368-49021390 GTGATTCAGGAGAAAACAGAGGG - Intronic
1150146482 17:62773764-62773786 AAGATTAGGGAGAAGGAAGACGG + Intronic
1150705001 17:67478562-67478584 GAGATACAGGAGGTGGCAGAGGG - Intronic
1151172821 17:72261967-72261989 CAAATACAGGAGTAGACAGAGGG + Intergenic
1151397262 17:73831747-73831769 CAGAGGCTGTAGAAGGCAGACGG - Intergenic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1155047727 18:22117650-22117672 CAGCTTCAGGACAAGCCAGTGGG - Intergenic
1155427896 18:25725157-25725179 CAGATGCAGATGATGGCAGAGGG - Intergenic
1155521011 18:26669139-26669161 GAGCTTCATGAGAATGCAGAGGG - Intergenic
1155920204 18:31596113-31596135 GAAATTAAGGAGAAGGCAGGGGG - Intronic
1155965899 18:32035002-32035024 CAGATTCAGTAGCAACCAGATGG - Intronic
1156088243 18:33434835-33434857 TAGATGTAGGAGAAGGAAGAGGG + Intronic
1156127787 18:33928030-33928052 CAGATTGAGGAGAAAGGACAGGG + Intronic
1156571587 18:38260512-38260534 CACTTTCAGAAGAAAGCAGAGGG - Intergenic
1157820093 18:50760777-50760799 CAGATCCAAGAGAGAGCAGAAGG - Intergenic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158076139 18:53531833-53531855 CAGAGTCAGGGGGAAGCAGAGGG + Exonic
1158083658 18:53624901-53624923 AAGAATCAGAAGAAGGCAGATGG - Intergenic
1158543460 18:58376893-58376915 CAGATGGAAGAGAAAGCAGAGGG - Intronic
1158828422 18:61251102-61251124 GGGATTCAGGAAAAAGCAGATGG - Intergenic
1159189648 18:65025200-65025222 CATAGTTAGGAGAAGGGAGAAGG - Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1160102021 18:75930675-75930697 CACATGCATTAGAAGGCAGAAGG + Intergenic
1160125987 18:76172348-76172370 TATATTCAGGCAAAGGCAGAAGG - Intergenic
1161249764 19:3274179-3274201 CAAACTCAGGAGAAGGCAGCTGG - Intronic
1162601748 19:11675007-11675029 CAGGATCAGGAAAAGGCAGAGGG - Intergenic
1162768156 19:12932820-12932842 GGGATTCAGGACAAGGCAGGGGG - Intronic
1163026697 19:14517055-14517077 CAGATTTAGAAGCAGTCAGATGG + Intronic
1163298112 19:16425365-16425387 GACCATCAGGAGAAGGCAGAGGG + Intronic
1163314088 19:16530967-16530989 CCGATTCCCGAGAAGGCAGAGGG - Intronic
1164577708 19:29415720-29415742 CAGTTGCAGGAGAAACCAGAAGG + Intergenic
1164849526 19:31470076-31470098 AAGATAAAGGAGAAGGCAGGTGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165792018 19:38498337-38498359 CAGATTGAGGGGAAGGCAGAAGG + Intronic
1166182558 19:41119153-41119175 AGTATTCAGGAGAAGGCAGGGGG + Intronic
1166306945 19:41940515-41940537 CAGATTCAGGAAAGGGGAGGGGG + Intergenic
1166979543 19:46624390-46624412 GAGATACTGGAGAAGCCAGAGGG - Intronic
1167267677 19:48491549-48491571 CAGATTAGGGGGAAGCCAGAGGG + Intronic
1167270140 19:48501814-48501836 GAGAAGCAGGAGAAGCCAGAAGG - Intronic
1167809882 19:51820138-51820160 TAGTTTGAGGAGAAAGCAGAAGG + Intronic
925058844 2:875790-875812 CAGACTCCGCAGAAGCCAGAGGG - Intergenic
926886056 2:17599868-17599890 CACATTCAGGAGCAGGCATCTGG + Intronic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927670619 2:25065876-25065898 CAGAGGCAGGAGACAGCAGAGGG - Intronic
928016306 2:27661125-27661147 CAGAATCAGCAGCAGACAGAAGG - Exonic
928101390 2:28439567-28439589 CGGACTGAGGAGGAGGCAGAGGG + Intergenic
928256672 2:29728919-29728941 CTTAATCAGGAGAAGGCAGCAGG - Intronic
928997253 2:37306299-37306321 GGGAATCAGGAGAATGCAGAAGG - Intronic
929014047 2:37476300-37476322 AGCAGTCAGGAGAAGGCAGAGGG + Intergenic
930238977 2:48916151-48916173 CAGATTGAGGATGTGGCAGATGG + Intergenic
930687399 2:54324464-54324486 TGGCATCAGGAGAAGGCAGAGGG - Intergenic
931858564 2:66329623-66329645 CAGATACAGCGGGAGGCAGATGG + Intergenic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
933129021 2:78649770-78649792 CAGATTCAGAAGAGAGGAGAAGG - Intergenic
933613338 2:84459311-84459333 CAGAGGCCGGAGGAGGCAGAGGG + Exonic
933637352 2:84722408-84722430 CAGAGTTAGGAATAGGCAGAGGG - Intronic
933980978 2:87550514-87550536 AAGCTTCAGGAGAAGGGAGAAGG - Intergenic
934605314 2:95690743-95690765 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
935386325 2:102503031-102503053 GACATTCAGGTGCAGGCAGAAGG - Intronic
936073949 2:109389909-109389931 CAGATTCAGGAGAAGGCAGATGG - Intronic
936312853 2:111400271-111400293 AAGCTTCAGGAGAAGGGAGAAGG + Intergenic
936538771 2:113333296-113333318 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
938238997 2:129728561-129728583 CAGGTTCAATACAAGGCAGATGG + Intergenic
938738135 2:134205068-134205090 CATGTTCAGGAGAGGACAGAAGG + Intronic
938953186 2:136276098-136276120 CAGATGCAGGATCGGGCAGAGGG - Intergenic
938962077 2:136353040-136353062 CAGATGCGGGAGAGGTCAGAGGG - Intergenic
940040656 2:149356682-149356704 GCAACTCAGGAGAAGGCAGATGG + Intronic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
945119993 2:206447600-206447622 AAGATACAGCAGAAAGCAGATGG - Intronic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948053449 2:234994945-234994967 CTGATTCAGGAGTAGGGTGAGGG + Intronic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948756536 2:240162818-240162840 CAGCTGGAGGAGAAGGCAGCTGG - Intergenic
1168804199 20:663123-663145 GAGATTCAGCAGAGGCCAGAGGG + Exonic
1168912472 20:1460320-1460342 CTGATTCAGGAGAATTAAGAGGG - Intronic
1168965549 20:1895870-1895892 CAGATTCTGGGGAAGCCGGACGG - Intronic
1169189182 20:3646517-3646539 CAGATGGAGGGGAAGGCGGAGGG + Intronic
1169766112 20:9149870-9149892 CGGATTCAGGACTGGGCAGAGGG + Intronic
1170033488 20:11966638-11966660 CTGATTCAGGAGGTGGGAGACGG - Intergenic
1170152749 20:13242430-13242452 AAGATCCAGGAGAAGGTTGAGGG + Intronic
1170313102 20:15013691-15013713 CAGAAGCAGGAGTGGGCAGAGGG - Intronic
1170810891 20:19673484-19673506 GATAGTAAGGAGAAGGCAGACGG - Intronic
1172307279 20:33889545-33889567 CAGCCTGAGGAGAAGGCAGGTGG - Intergenic
1172962488 20:38808283-38808305 CTGGTTTAGGAGAAGGCAGAAGG + Intronic
1173454064 20:43189689-43189711 CAGCCTCAGGAGCAGGCTGAGGG + Exonic
1174188453 20:48723265-48723287 CTGAATCTGGAGAAGCCAGAGGG + Intronic
1174583573 20:51590660-51590682 CAGACAAAGGAGAAGGCAAAGGG - Intergenic
1174665402 20:52253492-52253514 TTGAATCAGGAGAAGGCTGAGGG + Intergenic
1174704887 20:52645011-52645033 AGGATTCAGGTGAGGGCAGAAGG + Intergenic
1176426764 21:6553086-6553108 CAGCTTCCAGAGAAGGCTGAGGG - Intergenic
1176448430 21:6841314-6841336 CAGCTTGAGGAGGATGCAGATGG + Intergenic
1176826600 21:13706336-13706358 CAGCTTGAGGAGGATGCAGATGG + Intergenic
1176960002 21:15148583-15148605 CAGATGCACTAGAAGCCAGAGGG + Intergenic
1178309107 21:31514999-31515021 CAGACCCAGAAGTAGGCAGACGG + Intronic
1179003636 21:37487985-37488007 AAGAGTGAGGAGAAGGCAGGAGG - Intronic
1179570668 21:42276910-42276932 AAGCTTCAGGAGAAGGATGAAGG + Exonic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179702255 21:43161408-43161430 CAGCTTCCAGAGAAGGCTGAGGG - Intronic
1181019959 22:20094547-20094569 CAGGGTCAGGAGAGGACAGAAGG - Intronic
1181315174 22:21966326-21966348 AAGATTGAGGAGGAGTCAGAAGG + Intronic
1181455827 22:23059669-23059691 CAGCTCCAGGAGCAGGCCGATGG + Exonic
1181547081 22:23608178-23608200 CAGCTTCAGGAGCAGGCTGATGG - Intergenic
1181574131 22:23783204-23783226 CAGATTCCGGGGCAGGCAGAAGG + Intronic
1181725326 22:24806905-24806927 ACGCTTCAGGAAAAGGCAGAAGG + Intronic
1182353291 22:29710752-29710774 GAGATTCAGGAGGAGGAAGCGGG + Intergenic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183489779 22:38110253-38110275 CAGATGCTGGACAAGGCAGGAGG - Intronic
1183715156 22:39529129-39529151 CAGCTCCAGGAGTAGGAAGAAGG - Exonic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
1184341158 22:43886633-43886655 CAGGGCCAGGGGAAGGCAGAAGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1185085843 22:48740645-48740667 CAGATTCCAGAGAGAGCAGATGG + Intronic
949115960 3:323707-323729 CAATTTCTTGAGAAGGCAGATGG - Intronic
950664146 3:14484780-14484802 CCAATTCAGGAGGAGGCAGATGG + Intronic
951590391 3:24258274-24258296 CAGAGACAGGAAAAGGCCGAAGG + Intronic
951610520 3:24487577-24487599 CATATTCAGGAGCAAGTAGAAGG + Intronic
952447705 3:33398660-33398682 CAGGATAAGGAAAAGGCAGAAGG + Intronic
952486006 3:33810872-33810894 CACAAACATGAGAAGGCAGAAGG - Intronic
953178471 3:40574145-40574167 CTGAGTCAGGAATAGGCAGAGGG + Intronic
954379018 3:50209841-50209863 CATATCCAGGGGAAGGCAGATGG - Intronic
955734197 3:62019166-62019188 CTGATTCAGGAGGTCGCAGAGGG - Intronic
956273138 3:67469297-67469319 GAGATTCAGGAGAAATCAGTGGG + Intronic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957062811 3:75495883-75495905 CTGATTCATGAAAAGGCAGGAGG + Intergenic
957361199 3:79161160-79161182 CAGATTTAGCAAATGGCAGAAGG + Intronic
958155480 3:89750586-89750608 CACATTCAAAAGCAGGCAGAAGG + Intergenic
958489944 3:94759772-94759794 CATATTCTGGAAAAGGAAGATGG + Intergenic
959191721 3:103121049-103121071 CAGATTCAGAAGCAGGAGGATGG + Intergenic
960959404 3:123058746-123058768 CAGCTTCAGGAGAATGAAGCTGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
960999985 3:123367666-123367688 CAGATTCAGGGGCGGGAAGAAGG + Intronic
961290587 3:125843533-125843555 CTGATTCATGACAAGGCAGGAGG - Intergenic
962812634 3:138972497-138972519 CAGAGACAGGAGAAGCCAGCTGG + Intergenic
962929617 3:140024312-140024334 CAGATACAAGAAAAGGCAGAAGG - Intronic
963291418 3:143493705-143493727 TAGATTCAGGAGGAAGGAGAGGG + Exonic
963338755 3:144008068-144008090 CAGATTCAAGGGAAGACAAATGG + Intronic
964540612 3:157775203-157775225 CAAATTCAGGTGATGGCAGTGGG + Intergenic
964727209 3:159825862-159825884 GTGACTCAGGTGAAGGCAGAGGG + Intronic
964907160 3:161731440-161731462 TATTTTCAGGAGAAAGCAGAGGG + Intergenic
965531496 3:169774488-169774510 CAGAGTCAGGTGAAGGCTGATGG + Exonic
965532913 3:169792759-169792781 GAGATTCAGAAGATGGCTGAAGG - Intergenic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966517396 3:180832903-180832925 CAGATTCAGACGAACACAGAAGG + Intronic
967161423 3:186742005-186742027 CAGACACAAGAGAAGACAGAAGG + Exonic
967778236 3:193406835-193406857 AAGGCCCAGGAGAAGGCAGAAGG + Intronic
967845909 3:194042642-194042664 CTGATTCTGGCAAAGGCAGATGG + Intergenic
968045259 3:195620383-195620405 CGAAATCAGGAAAAGGCAGATGG + Intergenic
968061114 3:195726726-195726748 CGAAATCAGGAAAAGGCAGATGG + Intronic
968689821 4:1984675-1984697 CAGATTCTGGCTGAGGCAGAAGG + Intronic
969006710 4:4026017-4026039 CTGATTCATGAAAAGGCAGGAGG + Intergenic
969154815 4:5201269-5201291 CAGAAACAGGAGAAGGGACAAGG - Intronic
969313772 4:6369643-6369665 CGGATGCATGAGGAGGCAGAAGG - Intronic
969422530 4:7105596-7105618 CAGAGTCAGGGGAAGGCTCATGG - Intergenic
970573722 4:17407380-17407402 AAGATTCAGAGGAAGGCAGCAGG - Intergenic
971096458 4:23409911-23409933 CAGAATCAACAGAAGCCAGAAGG - Intergenic
972620061 4:40738602-40738624 CAGATTTGGGAGAAGGGAGCAGG - Intergenic
972931110 4:44072260-44072282 CAAAGTCAGGAGGGGGCAGAGGG + Intergenic
974163214 4:58166790-58166812 CAAATTCATGTGTAGGCAGATGG - Intergenic
974594002 4:63994097-63994119 CAGATACAGGAAAAGAAAGAAGG - Intergenic
975109211 4:70605207-70605229 AAGAGTCAGGAGAAAGGAGAAGG + Intronic
975169336 4:71215171-71215193 AAGATTGAGGAGAGGACAGAAGG - Intronic
975250840 4:72176193-72176215 CAGATACAGCAAAAGGAAGAAGG + Intergenic
976902689 4:90198192-90198214 CAACTTCAGGGGAAGGAAGAAGG - Intronic
978548305 4:109897335-109897357 CACATTCAAGAGCTGGCAGAAGG - Intergenic
978853492 4:113366581-113366603 CTGAAACAGGAGAATGCAGAGGG - Intronic
980320530 4:131267048-131267070 CAGGTTCAGGAAAAGGGAGTGGG + Intergenic
981225316 4:142287549-142287571 GAGATTTAGAAGAAGGCAGAGGG - Intronic
981231751 4:142364740-142364762 CAGATTCAGGAGACTGCAGAAGG + Intronic
981359814 4:143833223-143833245 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981370581 4:143954302-143954324 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981380347 4:144064222-144064244 TAGATGCAGGAGAAGGAAGAGGG - Intergenic
981608106 4:146562302-146562324 GAATTTCAGTAGAAGGCAGAGGG - Intergenic
982634333 4:157873582-157873604 GACAGTCAGGAGAACGCAGAAGG - Intergenic
983467781 4:168116365-168116387 TAGATTCAGAAGAAGACAAATGG - Intronic
984603651 4:181758294-181758316 CATCTTCAGGGGAAGGGAGAAGG + Intergenic
984813140 4:183813041-183813063 CAGATTCAGCCAATGGCAGATGG + Intergenic
985627577 5:997851-997873 CAGAGCCAGGTGAGGGCAGATGG - Intergenic
985995020 5:3592968-3592990 CAGATGCTGGAGCAGGCAGAAGG - Intergenic
987627516 5:20421198-20421220 CATATTCAGGAGCAGGGAGCAGG + Intronic
988361139 5:30238286-30238308 CAAATTCTGGAGAAGCCAGGTGG - Intergenic
989205233 5:38803481-38803503 CATATTCAGTAGAAGGCAATAGG - Intergenic
989585987 5:43074233-43074255 AAGCCTCAGGAGAAGGCAGTAGG + Intronic
992004806 5:72466964-72466986 CAGATTCCTGAAAAGGCCGAAGG + Intronic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
996031203 5:118705841-118705863 CAGTTTAAGGAGCAGGGAGAAGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
997053851 5:130416553-130416575 CATATTTCGGAGAATGCAGAAGG - Intergenic
998265103 5:140662065-140662087 CAGATTCAGGAACAGGCAAGGGG + Intronic
998519594 5:142787615-142787637 GAAAGTCAGGAGAAGGCAGAAGG - Intronic
998611993 5:143699423-143699445 CAGACTCAGTGGAAGGTAGAGGG + Intergenic
998652972 5:144141939-144141961 GAGATCCAGGAGAAGGGAAATGG + Intergenic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
999389576 5:151180456-151180478 CAGGTACAGCAGGAGGCAGAGGG + Intergenic
999486007 5:151997115-151997137 GAGATACAAGAGAATGCAGATGG - Intergenic
999690648 5:154143278-154143300 CAGTGTCAGGAGAAGGCTGTGGG - Intronic
999869259 5:155732071-155732093 TAGTTCCAGGGGAAGGCAGATGG + Intergenic
999942363 5:156557755-156557777 CAGCTTGATGAGGAGGCAGAGGG - Intronic
1000456097 5:161451231-161451253 AAGATTCAGCAGGAAGCAGAAGG - Intronic
1000831876 5:166111982-166112004 AAGATAAAGGAGAAGGCAGAAGG - Intergenic
1001298392 5:170515425-170515447 CTTCTTCAGGGGAAGGCAGATGG - Intronic
1001804776 5:174574014-174574036 CTCATTAAGGAGAAGGGAGAGGG + Intergenic
1002485828 5:179535506-179535528 CAGATGCTGGAGAAGGGCGATGG - Intergenic
1002581221 5:180210419-180210441 CAGAGTGAGGTGAAGGCAGCTGG - Intergenic
1004584676 6:16988023-16988045 CAGATTCTGGGGAAGGCTCAGGG + Intergenic
1005441997 6:25880094-25880116 TAGATTTAAGAGAAGGGAGAAGG - Intronic
1005829387 6:29658426-29658448 AAGATACAGGGGAAGGAAGAGGG + Intronic
1006079806 6:31558644-31558666 CAGCCTCAGGATGAGGCAGAAGG + Exonic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1006730904 6:36235612-36235634 CAGCTTCAGTAGAGGCCAGAAGG - Intergenic
1006896852 6:37476690-37476712 CAGAGTCAGGAGGAGACAGATGG + Intronic
1007297547 6:40837602-40837624 TAGATTCAGTAGAAACCAGAGGG - Intergenic
1007963171 6:45979521-45979543 GTGATTCAGGACAAGGCAGAAGG - Intronic
1008262609 6:49385643-49385665 CAGGTTCAGCACAAAGCAGAGGG - Intergenic
1010595666 6:77760620-77760642 TAAAGTCAGGAGAAGACAGAAGG - Intronic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1010893788 6:81342933-81342955 TAGAATCAGGAGAAGGAAAAAGG + Intergenic
1011291836 6:85785114-85785136 CAAATTCAAAAGCAGGCAGAAGG - Intergenic
1013455919 6:110329680-110329702 CAATTACAGGAGAAGGCTGAGGG - Intronic
1014192512 6:118514180-118514202 CTAATTCAAGAGAAGGCAAAGGG + Intronic
1014484081 6:121977755-121977777 GAGAGTCAGGAGAAGGGAGTGGG + Intergenic
1014671886 6:124314494-124314516 AAGATCCAGGAAAGGGCAGAGGG + Intronic
1015822953 6:137282377-137282399 CAGATTAACAGGAAGGCAGATGG + Intergenic
1016921610 6:149300559-149300581 CTGAATCAGGAAAAGGCTGAAGG - Intronic
1017210543 6:151850900-151850922 TAGATGAAGGAGAAGGCAAATGG - Intronic
1017603418 6:156107801-156107823 CCGATTCAGGAGGGGACAGAAGG + Intergenic
1018299740 6:162388726-162388748 CAGATACTGGAGAAGAGAGAGGG - Intronic
1018529882 6:164751398-164751420 CAGAATCAGGGGAAGCCAGATGG + Intergenic
1018649969 6:165985520-165985542 CAACTTCAGGAGGAGGCACAGGG + Intronic
1018757178 6:166860354-166860376 CAGCCCCAGGAGAGGGCAGATGG - Intronic
1018891837 6:167988313-167988335 CAGAGGCAGGAGGAGGCAGGAGG + Intergenic
1019223704 6:170494223-170494245 GAGAATGAGGAGAGGGCAGATGG - Intergenic
1021012830 7:15492880-15492902 AAGATGTAGGAGAAGACAGAGGG - Intronic
1021489672 7:21205432-21205454 CAGATTGAGCAGAGGCCAGAGGG + Intergenic
1023451667 7:40292621-40292643 CAGACTTAGCAGAAGGCAAAAGG - Intronic
1023631362 7:42167273-42167295 CAGATTAAGGACAAGACAAATGG + Intronic
1023934906 7:44732791-44732813 CAGATGCAGGAGGAGGCAGGAGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025823334 7:64991765-64991787 CAGATCCAGTAGAGGCCAGAGGG + Exonic
1026079354 7:67203933-67203955 CAGATACCAGAGAAGCCAGAAGG - Intronic
1026627773 7:72011482-72011504 CAGGTTCAGGAGAGGGAACAGGG - Intronic
1028280099 7:88914043-88914065 CACATTCAATAGGAGGCAGAAGG - Intronic
1028826924 7:95284168-95284190 GAGTCTCAGGAGAAGGCTGAAGG - Exonic
1028873473 7:95794191-95794213 CAGAATCAGAAGAAAGGAGATGG - Intronic
1028889608 7:95972228-95972250 CAGAATCAACAGGAGGCAGAAGG + Intronic
1029536365 7:101160115-101160137 CAGAGTGGGGAAAAGGCAGAGGG - Intronic
1030618087 7:111759562-111759584 CAGTTTCAGGAAAAGGCAGAGGG + Intronic
1031927153 7:127649903-127649925 AGGATCCAGGAGAAGGCAGAGGG + Intergenic
1032019882 7:128401421-128401443 CCGATTAAGTAGAAGTCAGAGGG + Intronic
1032511102 7:132473044-132473066 CAAATGCAGCAGCAGGCAGAAGG + Intronic
1032803332 7:135333957-135333979 CAAAGTCATCAGAAGGCAGAAGG + Intergenic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1033108944 7:138558129-138558151 CAGATCCAGTAGAGGCCAGAGGG + Intronic
1033242308 7:139690282-139690304 CAGAGTCAGGGGAGGGCAGAGGG + Intronic
1033279000 7:139992550-139992572 CAGCTGCAGAAGAAGGCAAAGGG + Intronic
1034143635 7:148848585-148848607 CAGATGACAGAGAAGGCAGATGG + Intronic
1034262661 7:149766399-149766421 CAGGTTCAGGAGAATGCAGGAGG - Intronic
1034841966 7:154406682-154406704 AAGTTCCAGGAGAAGGCTGATGG - Intronic
1034848717 7:154473273-154473295 CAGCCTCAGGAAAAGGCACATGG - Intronic
1035587478 8:786944-786966 CTCTTTCAGGTGAAGGCAGAAGG + Intergenic
1036082637 8:5574224-5574246 CAGATGCAGGTTAAGGCAGAAGG + Intergenic
1036777083 8:11620856-11620878 GAGGCTCAGGAGAAGACAGAGGG + Intergenic
1036921181 8:12856805-12856827 CATATTGAAGAGAAGGCACAGGG - Intergenic
1037620983 8:20563244-20563266 CAGATTCTGTAGCAGACAGAGGG - Intergenic
1038308052 8:26422208-26422230 AGGATACAGGAGAGGGCAGAGGG + Intronic
1039793752 8:40895546-40895568 AGGATTGAGGAGGAGGCAGAGGG + Intronic
1040421161 8:47241698-47241720 CAGAGTCAGGATCAGGCTGAAGG + Intergenic
1041140065 8:54808180-54808202 CAGAATCAGGAGCAGGAAAATGG + Intergenic
1041790595 8:61692608-61692630 CTGACTCATGAGAAGGCTGATGG - Intronic
1042402419 8:68364855-68364877 CACATTCAAAAGCAGGCAGAAGG + Intronic
1042581192 8:70280952-70280974 CATCTGCAGGGGAAGGCAGAGGG + Intronic
1042596804 8:70458171-70458193 CAGAGCCAGGAGAACACAGAGGG - Intergenic
1042777344 8:72448075-72448097 CACATACAGGAGAAGGAAGGCGG + Intergenic
1044691059 8:94878919-94878941 AAGTTTAAGGAGTAGGCAGAAGG - Intronic
1045258811 8:100553293-100553315 AAGACTGAGGAGAGGGCAGAGGG + Intronic
1048374103 8:133807135-133807157 CAGTTTCAGCATAAGCCAGATGG - Intergenic
1048798000 8:138169636-138169658 CAGATTCAGAAGGTGGCAAAAGG - Intronic
1048907983 8:139106648-139106670 TAGAAACAGGAGAGGGCAGATGG - Intergenic
1049967363 9:791739-791761 CAGGTTCAGGAGTAGGCTGGAGG + Intergenic
1050150571 9:2615840-2615862 TAGACTTAGGAGAAGTCAGATGG - Intergenic
1051344293 9:16138647-16138669 GATTTGCAGGAGAAGGCAGATGG + Intergenic
1054810765 9:69432300-69432322 CAGATGAAAGAGAAGGCTGAGGG + Intronic
1055129377 9:72756907-72756929 CAAATTCAGGGGAAAGTAGAGGG + Intronic
1055202994 9:73690476-73690498 CAGATTCAAGACAAGGTAGAGGG + Intergenic
1055369032 9:75577022-75577044 GAGGCTAAGGAGAAGGCAGATGG - Intergenic
1055679276 9:78698209-78698231 CTGATTCAGGAGCAGGGAAAGGG + Intergenic
1055913824 9:81379954-81379976 CAGATTAGGGAGAAGGGAAAGGG + Intergenic
1056179126 9:84064543-84064565 CAGTTTCTGGTGAGGGCAGATGG + Intergenic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1056551629 9:87657891-87657913 AAGTTTCAGGAGAAGGGAGATGG + Intronic
1057308405 9:93925867-93925889 GAGATTCAGGAGAAAGCAACAGG + Intergenic
1059057427 9:110998887-110998909 TAGATTCAAAAGAAGGCATAAGG + Intronic
1059935911 9:119310510-119310532 CAAATGCAGGAGAAAGAAGATGG + Intronic
1060025892 9:120171275-120171297 GAAAAACAGGAGAAGGCAGAGGG - Intergenic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060671224 9:125471451-125471473 AAGAGTTAGGAGTAGGCAGATGG + Intronic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061263245 9:129491398-129491420 CGGAATCAGGAGAAGACAGAGGG + Intergenic
1061910426 9:133719489-133719511 AAGATTCAAGAGGAGGCAGGAGG - Intronic
1062081526 9:134626593-134626615 CAGCTTCTTAAGAAGGCAGATGG + Intergenic
1062219793 9:135409093-135409115 CATATGCTGGAGAAGGCAGAGGG - Intergenic
1062366103 9:136209761-136209783 CACCTTCAGGAAAGGGCAGAGGG + Intronic
1062621665 9:137425247-137425269 CAGACTCAGGAGGACACAGAAGG - Intronic
1203520761 Un_GL000213v1:43204-43226 CAGCTTGAGGAGGATGCAGATGG - Intergenic
1186892930 X:13977787-13977809 CACATTCAAAAGCAGGCAGAAGG + Intergenic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1189682295 X:43529234-43529256 AGGAATCAGGAGTAGGCAGAGGG - Intergenic
1189937633 X:46086565-46086587 CAGGTTCAGGAGATGGGAAAGGG + Intergenic
1190223533 X:48528642-48528664 CAGATACAAGAGAAGCCAGGAGG + Exonic
1191567516 X:62558547-62558569 CACATTCAAAAGCAGGCAGAAGG + Intergenic
1192053275 X:67746576-67746598 ATGATTGAGGTGAAGGCAGAAGG - Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1195273603 X:103256441-103256463 GAGAGTCAGAAGAAGACAGAGGG + Intergenic
1195537617 X:106026674-106026696 CAGATTCAGGCAAAGATAGAGGG + Intergenic
1199941802 X:152635124-152635146 CAGATTCAGTAGAAGCCATCAGG + Intergenic
1200061714 X:153486733-153486755 CGGGTGCAGGAGAAGGCAGTGGG - Exonic
1200531695 Y:4347687-4347709 CAGATGCAGCAGCAGGCTGAAGG - Intergenic