ID: 936073956

View in Genome Browser
Species Human (GRCh38)
Location 2:109389953-109389975
Sequence AGGTGGGTGAGGAGGAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 798
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 732}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936073956_936073964 11 Left 936073956 2:109389953-109389975 CCCTTGTTCCTCCTCACCCACCT 0: 1
1: 0
2: 2
3: 63
4: 732
Right 936073964 2:109389987-109390009 TTTCTAAGGCAGAAGCGCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 89
936073956_936073965 12 Left 936073956 2:109389953-109389975 CCCTTGTTCCTCCTCACCCACCT 0: 1
1: 0
2: 2
3: 63
4: 732
Right 936073965 2:109389988-109390010 TTCTAAGGCAGAAGCGCCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 82
936073956_936073963 -3 Left 936073956 2:109389953-109389975 CCCTTGTTCCTCCTCACCCACCT 0: 1
1: 0
2: 2
3: 63
4: 732
Right 936073963 2:109389973-109389995 CCTAAGATCTGCGATTTCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 62
936073956_936073967 28 Left 936073956 2:109389953-109389975 CCCTTGTTCCTCCTCACCCACCT 0: 1
1: 0
2: 2
3: 63
4: 732
Right 936073967 2:109390004-109390026 CCCTGGGAAATTAATCACTTTGG 0: 1
1: 0
2: 1
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936073956 Original CRISPR AGGTGGGTGAGGAGGAACAA GGG (reversed) Intronic
900115358 1:1025748-1025770 AGGTGAGTGGGGAGGGACAGAGG - Intronic
900299212 1:1968752-1968774 AGGAGGCTGAGGAGGAAAAGAGG - Exonic
901296820 1:8167229-8167251 CAGAGGGGGAGGAGGAACAATGG + Intergenic
901928959 1:12584468-12584490 GGGGGGGTGAGGAGGCAGAAAGG - Intronic
902455524 1:16531149-16531171 AGGAGGCTGAGGCGGAAGAATGG - Intergenic
902594383 1:17498343-17498365 ACGTGTGTGAGGATGATCAAAGG - Intergenic
902844531 1:19099502-19099524 AGGTAAGTGATGATGAACAATGG + Intronic
902920837 1:19665298-19665320 AGGTGGGTGAGGGGGGTGAATGG - Exonic
902922128 1:19672307-19672329 AGGAGGGGGAGGAGGAAAAGCGG - Intronic
903066312 1:20701639-20701661 AGGTGGGTGGGGAGGCAGGAAGG + Intronic
903363291 1:22790590-22790612 AGGTGGGTAAGGAGAGACCAAGG - Intronic
903618982 1:24684065-24684087 AGATGGGGCAGGAGGAACGACGG + Intergenic
904050337 1:27634729-27634751 AGGTGGGGGAGAAGGATTAAGGG - Intronic
904068525 1:27773778-27773800 AGGTGGGTGGGGAGGAAGGTGGG - Intronic
904130037 1:28268717-28268739 AGGAGGAGGAGGAGGAAGAAAGG + Intronic
904674465 1:32190350-32190372 AGGAGGAGGAGGAGGAAGAAAGG - Intronic
904686782 1:32266580-32266602 AGGAGGAGGAGGAGGAAGAAAGG - Intronic
904850791 1:33457866-33457888 AGGTGGATGGGGAGAAACAAGGG - Intergenic
905114996 1:35630922-35630944 ATGTGGGTGAGGAGGAATGTGGG + Intronic
905274661 1:36809426-36809448 AGATGGGTGAGAAGGAGAAAGGG - Intronic
905394449 1:37657997-37658019 AGGTGGGTGCGTTGGCACAAAGG - Intergenic
905524222 1:38624254-38624276 AGGTGGGTGGAGAGGAACTGGGG + Intergenic
905878598 1:41449130-41449152 AGGCGGGTGAGAAAGAAGAAGGG + Intergenic
905894860 1:41538962-41538984 GGGTGGGGGAGGAGGACCCAGGG - Intronic
905950540 1:41946950-41946972 AGCTGGGTATAGAGGAACAACGG - Intronic
906583580 1:46956313-46956335 AGCTGGGTGTAGAGGGACAACGG - Intergenic
907238083 1:53064993-53065015 AGGTGTGTGGGGAAGAACAGGGG - Intronic
907391003 1:54158222-54158244 AGGTGGTAGAGAGGGAACAAAGG + Intronic
907412402 1:54292023-54292045 AGGTGGGTGCTGAGTAGCAATGG + Intronic
907426124 1:54380289-54380311 ATGGGGGTGAGGAGGAACCATGG - Intronic
907830487 1:58060127-58060149 AGCAGGGTGAGGAGGAAGGATGG + Intronic
907937203 1:59052906-59052928 TGGTGGGAGAGACGGAACAATGG - Intergenic
908319914 1:62969078-62969100 TGGTGGTTGAGGAGGACCACTGG + Intergenic
909239601 1:73195594-73195616 AGGAGGCTGAGGAGGGAGAATGG - Intergenic
909637036 1:77828082-77828104 AGGTGGGTGGGGAGGTTTAATGG + Intronic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
911040831 1:93589433-93589455 AGGTGAGTGAGGAGTAGGAAAGG + Intronic
911683371 1:100744973-100744995 AGGAGGCTGAGGCGGAAGAATGG + Intergenic
912184272 1:107256176-107256198 TTGTGGGTGGGGAGTAACAATGG - Intronic
912449450 1:109760248-109760270 GGGTGAGTGAGGAGGAAGACTGG - Intronic
912762536 1:112381997-112382019 TGGTGGGTGAGGGGAAAGAAGGG + Intergenic
912956984 1:114161315-114161337 AGCTGGGTGATGAGGAAAAGAGG - Intergenic
913162510 1:116157073-116157095 AGGTGGGAGTGGAGGGGCAAGGG - Intergenic
913490230 1:119372748-119372770 AGGCTGGGGAGGAGGAGCAAAGG + Intronic
914196810 1:145451967-145451989 AGGAGGGGGAGGGGGAAGAAGGG + Intergenic
914683773 1:149960039-149960061 AGGTGGGTGAGCAGGATGGAGGG - Intronic
914953431 1:152139822-152139844 ATATGAGTGAGGAGGAAAAATGG - Intergenic
915298833 1:154940643-154940665 AACTGGGTGAAGAGGAAGAAAGG - Intergenic
915354857 1:155250161-155250183 AGGTCCCTGAGGAGGAAGAAAGG - Intronic
915444420 1:155966714-155966736 AGGTGGGTGGTGAGAAACACAGG + Intronic
915858583 1:159418305-159418327 AGGAGGCTTAGGAGGAAAAAGGG + Intergenic
916368178 1:164057731-164057753 AGGAGGGGGAGGAGGAGCAAAGG - Intergenic
916711822 1:167417456-167417478 AAGTGGATGAAGAGGAATAAGGG + Exonic
917186019 1:172356706-172356728 ATGTGGGTGGAGAGAAACAAAGG - Intronic
917425221 1:174906120-174906142 AGGAGGCTGAGGTGGAAGAATGG - Intronic
917477787 1:175383836-175383858 AGGAGGGTGAGGGGAAAGAAGGG - Intronic
918117427 1:181509008-181509030 AGGTGCGTGGGAAGGAACGATGG + Intronic
918222133 1:182444687-182444709 AGGTTGTTGGGGAGAAACAAGGG - Intergenic
918239483 1:182609341-182609363 AGGAGGATGGGGAGGAACAAAGG - Intergenic
919343157 1:196339634-196339656 AAGTCTCTGAGGAGGAACAAGGG + Intronic
919743112 1:200992351-200992373 AGATGCGTGAGGAGCAACAGCGG - Exonic
920043711 1:203120363-203120385 TGATGGGTGGGGAGGAATAAGGG + Intronic
920353898 1:205356392-205356414 ATGGGGGTCAGGAGGGACAAGGG - Intronic
920567201 1:206983660-206983682 GGGTGGGTGAGGGGGAAAAAAGG - Intergenic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
921620678 1:217323027-217323049 TGCTGTGTGAGGAGGAGCAAAGG - Intergenic
921739185 1:218664471-218664493 AGGAGGTGGAGGAGGAAGAAGGG - Intergenic
922096760 1:222449648-222449670 AGGTTGGGGCTGAGGAACAATGG - Intergenic
922237249 1:223731429-223731451 AGCTGGGTGAGGAAGAGCAGGGG - Intronic
922350217 1:224729069-224729091 AGGGGAGGGTGGAGGAACAAGGG + Intronic
922917843 1:229272689-229272711 AGGTGGATGAGGAGGCAGAGAGG + Intronic
923684761 1:236146368-236146390 AGCTGGGTGGGGAGGAAGAGAGG + Intronic
924819276 1:247472811-247472833 AGGTTGGTGAGGAGGAGGCATGG - Intergenic
1063369835 10:5514053-5514075 AGGGGGATGGGGAGGAAGAATGG - Intergenic
1063379938 10:5577984-5578006 AGGTGCCAGAGGAGGGACAAAGG - Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064165309 10:12980538-12980560 AGGAGGGGGTGGAGGAAGAAAGG + Intronic
1064286077 10:13992436-13992458 AGGTGGGTGGGCAGGACCCAAGG - Intronic
1065110477 10:22436060-22436082 AGGTGGTTGTTGAGGAATAAGGG - Intronic
1065532515 10:26686840-26686862 AGGAGGCTGAGGAGGGAGAATGG + Intergenic
1066033986 10:31461980-31462002 AGGTTGGGGATCAGGAACAAGGG + Intronic
1066336112 10:34480149-34480171 AGATAGGTGTGGAGGATCAAAGG + Intronic
1067186394 10:44031764-44031786 AGATGTGTGACCAGGAACAAAGG + Intergenic
1067358182 10:45550696-45550718 AGGTGGGACAGAATGAACAAGGG - Intronic
1067688292 10:48481025-48481047 AGGAGGGTGAGGAGCAGCCAGGG + Intronic
1068072239 10:52209734-52209756 AGATGGGTGATGAGGGAGAAGGG - Intronic
1068453171 10:57220014-57220036 AGATGGGGAAAGAGGAACAATGG - Intergenic
1069190590 10:65483158-65483180 AGGCGGGAAAGGAGGAAGAAAGG - Intergenic
1070618283 10:77986453-77986475 ACGTGGGAGAGCAAGAACAAAGG - Intronic
1070702422 10:78613436-78613458 AGGAGGGAGAGAAGGAAGAAAGG + Intergenic
1071737068 10:88312526-88312548 AGGTGGGTGAAGAGGATGGAAGG + Intronic
1072380164 10:94859558-94859580 AGGTGAGTGAGGAGTTAGAAGGG + Intergenic
1072392907 10:95007118-95007140 AGGATGGTGAAGAGGAGCAATGG - Intergenic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1072526111 10:96272914-96272936 AGGAGGGGGAGAAGGAACAGCGG + Intergenic
1072801461 10:98395166-98395188 AGGGGGGTGAGGTGGGACACAGG - Intronic
1072897181 10:99376997-99377019 GGATGGGTGGGGAGGAAGAAGGG - Intronic
1072961936 10:99937259-99937281 TGTTGGTTGAGGAGGTACAAGGG - Intronic
1073376672 10:103041180-103041202 GGGTGGGTGAGGCGGAAGACGGG - Intronic
1073434230 10:103506522-103506544 AGGAGGAGGAGGAGGAAGAAGGG - Intronic
1073597796 10:104817606-104817628 AGGAGGGAGAGGAGGAAGAAGGG - Intronic
1074075751 10:110122724-110122746 AGGAGGCTGAGGTGGAAGAATGG - Intronic
1074552294 10:114455915-114455937 AGGAGGGTGAGGCGGGAGAATGG - Intronic
1074712129 10:116186029-116186051 AGGTGGGAGAGCAAGAACCAAGG + Intronic
1074727955 10:116333861-116333883 AGGTGAGTGGGAAGGATCAAAGG + Intronic
1075405754 10:122194665-122194687 ATGTGGGTGAGTTGGCACAATGG + Intronic
1075849310 10:125574366-125574388 AGGTGTGGGAGGTGGAATAATGG - Intergenic
1076252359 10:128994633-128994655 AGGAGGGAAAGGAGGAAAAAAGG + Intergenic
1076523332 10:131094711-131094733 AGGAGGGAGAGAAGGAAGAAAGG - Intronic
1077211683 11:1374028-1374050 AGCGGAGTGAGGAGGGACAATGG - Intergenic
1077368102 11:2169372-2169394 TGGTGGGTGAGGGGGATCCAGGG + Intronic
1077411810 11:2407178-2407200 AGGTGGCTGAGCAGGATGAAGGG + Exonic
1078145462 11:8719149-8719171 AGCTGGAGGACGAGGAACAAAGG + Intronic
1078262201 11:9720482-9720504 AGGTAGGTGAGGAAGAGCTAAGG + Intronic
1078622001 11:12916849-12916871 ATGTGGGTGAGGAGGAGGAGAGG + Intronic
1079080508 11:17410499-17410521 GACTGGGTGAGGGGGAACAAGGG - Exonic
1079383872 11:19961700-19961722 AGGTGTGTGAGGAGGAGTAGAGG + Intronic
1079477818 11:20849725-20849747 AGGTAGGTCAGGAGAAAAAATGG + Intronic
1079993871 11:27274764-27274786 AGGTGGGACAGGAGGAGAAAAGG + Intergenic
1079993980 11:27275779-27275801 AGGTGGGACAGGAGGAGAAAAGG - Intergenic
1080333764 11:31173715-31173737 AAGTGTGTGAAGAGGAACATGGG - Intronic
1081049270 11:38316628-38316650 AGCTGGGTGAGGGGTAACACAGG - Intergenic
1081093282 11:38899861-38899883 AGGTGGAGGAGGAGGAGGAAGGG + Intergenic
1081575501 11:44316512-44316534 AGGTGGGCGAGGAGGAAGGGCGG - Intergenic
1081634120 11:44709453-44709475 AGGTGGGGAAGGAGGAAGAGAGG - Intergenic
1081730148 11:45366114-45366136 AGTTGGCAGATGAGGAACAAGGG - Intergenic
1081933567 11:46889346-46889368 AGGATGGGGAGAAGGAACAAGGG - Intronic
1081937861 11:46917642-46917664 AGGGGGCTGAGGAGGAATATAGG - Intronic
1082115577 11:48324883-48324905 AAGAGGGTTAAGAGGAACAAAGG + Intergenic
1083308334 11:61772215-61772237 AGGTGGGGAAGGAGGAACCGGGG - Intronic
1083475486 11:62912524-62912546 AGCTGAGTGAGGAGAAGCAAGGG + Intronic
1083615051 11:64022038-64022060 GGGTGGGGGACGAGGAGCAAAGG + Intronic
1083877093 11:65530026-65530048 AGGGGGGTTAGGAGGACTAAAGG + Intronic
1084406779 11:68978935-68978957 AGGTGAGGGAGGAGGAAAGACGG - Intergenic
1084467044 11:69329715-69329737 ATGGGGGTGGGGAGGAACATGGG - Intronic
1084755512 11:71236038-71236060 AGGAGGCTGAGCAGGAAGAACGG - Intronic
1084893596 11:72249807-72249829 AAGTGGCTGAGGAGGACCATGGG - Intergenic
1084898451 11:72292751-72292773 CGTGGGGTGAGGAGGAACACTGG + Exonic
1085200296 11:74697757-74697779 AGGAGGGAGAGGAGGAAGAAAGG + Intronic
1085551062 11:77372675-77372697 AGGTGGGTGATGAGGAGGATTGG - Intronic
1085569603 11:77547805-77547827 AGGTGGCTGAGGTGGGACGATGG - Intronic
1087064160 11:94011725-94011747 TGGTAGGTGTGGAGGAACCAAGG + Intergenic
1087660128 11:100977543-100977565 AAGTGGGTGAAGAAGAACAATGG + Intronic
1088274403 11:108069292-108069314 AGGTAGGGAAGGAAGAACAAAGG - Intronic
1088621537 11:111689385-111689407 ATGTGGGTGAGGTGGAAGACAGG + Intronic
1088982437 11:114875919-114875941 TGGTGGGTCAGGAAGAGCAAAGG + Intergenic
1088984708 11:114895432-114895454 AGGTGGGTGAAGAGGGAAAGAGG - Intergenic
1089058351 11:115606216-115606238 GGGTGGGTGAGGAGCCACAGGGG - Intergenic
1089277390 11:117346910-117346932 AGGTGGGTAAAGAAGAAGAAGGG - Intronic
1089810115 11:121124862-121124884 AGTGGGGTGAGGAGGACTAAAGG + Intronic
1090068766 11:123525944-123525966 AGCTGGGAGAGGGGGAAGAAGGG + Exonic
1090082664 11:123624430-123624452 AGGAGGGTGAGGAGGCTCCAGGG + Intronic
1090298286 11:125610165-125610187 AGGAGGGTGAGGTGGAAGGATGG - Intronic
1090778305 11:129984382-129984404 AGGTAGGTGAGCAGGAACGCGGG - Intronic
1091024488 11:132129875-132129897 AGGTAGGTGAAGATGAAAAAGGG - Intronic
1091294080 11:134460278-134460300 CTGGGGGTGGGGAGGAACAAAGG + Intergenic
1091324422 11:134675332-134675354 AGGTAGAAAAGGAGGAACAAAGG - Intergenic
1091670677 12:2449990-2450012 AGGTGGATGAGAAGGAAACAGGG + Intronic
1091698889 12:2646980-2647002 AGGTGAGGGAGGAGAAAGAAAGG - Intronic
1091760091 12:3081439-3081461 AGGTGGAAGAGGATGAACTAAGG - Intronic
1092147039 12:6221888-6221910 AGGAGGCTGAGGTGGAAGAATGG + Intronic
1092702955 12:11253482-11253504 AGGTCAGAGAGAAGGAACAAAGG + Intergenic
1092821232 12:12355551-12355573 AGGTGAGAGAGGAGGTAAAAGGG - Intergenic
1093491658 12:19711532-19711554 AGGTTGGAGAGGAGGATGAAGGG + Intronic
1094107899 12:26833093-26833115 AGGAGGAGGAGGAGGAGCAAAGG - Exonic
1095613360 12:44158944-44158966 AGAAAGGTGAGGAGGAGCAAGGG + Intronic
1095982753 12:47982289-47982311 GGGTGGGTGAGGAGCAGCAGGGG + Intronic
1096309225 12:50505379-50505401 GGGTGGGAGAGGAGGGAAAACGG - Intronic
1096793665 12:54060713-54060735 AGGTGAGATAGGAGGAAGAAAGG - Intergenic
1096924249 12:55124746-55124768 ACGTGGGTGAGGACAAATAAGGG + Intergenic
1097007063 12:55927240-55927262 AGGTGGAGGAGGAGGAAGAGTGG + Intronic
1097158307 12:57028426-57028448 AGGAGCTTGAGGAGGAAAAAGGG + Intronic
1097248855 12:57621426-57621448 AGGTGGGGGTGGAAGAAGAAAGG + Exonic
1098016184 12:66107257-66107279 AGGTGGGTGTGAAGAAAAAAAGG + Intergenic
1098523534 12:71460749-71460771 ATGTAGGAGAGGAGGAAGAATGG - Intronic
1098779420 12:74666577-74666599 AGGCAGGTGAGGGGGAACGATGG + Intergenic
1100098991 12:91079338-91079360 AGGAGGGGGAGGAGGCATAATGG + Intergenic
1100190476 12:92185822-92185844 AGGAGGAGGAGGAGGAAGAAGGG - Intergenic
1101031306 12:100662959-100662981 AGGAGGCTGAGGTGGAAGAATGG + Intergenic
1101580514 12:106037795-106037817 AGGGAGGTGAGGAGAAAGAAGGG - Intergenic
1102243652 12:111341614-111341636 AGGAGAGTGAGGAGGGAGAAAGG + Intronic
1102306162 12:111806210-111806232 AGGAGGCTGAGGCGGAAGAATGG + Intronic
1102460134 12:113094946-113094968 AGGTGGGTTGGGCGGGACAATGG + Exonic
1103398034 12:120622979-120623001 AAGTGGGTGAGCAGGAAGATAGG - Intergenic
1104148655 12:126060326-126060348 AGGAGGCTGAGGAGGGAGAATGG - Intergenic
1104786408 12:131452449-131452471 CAGTGGGTCATGAGGAACAAGGG + Intergenic
1104803458 12:131570218-131570240 AGGTGGGTGAGGTGGAAGAGGGG + Intergenic
1105544117 13:21339435-21339457 GGGAGGGTGAGGAGGGAAAATGG - Intergenic
1106087557 13:26557465-26557487 AGCTGGGGGCGGAGGACCAAGGG + Intergenic
1107153302 13:37137765-37137787 TGGAGGGTGAGGAGGAATGAAGG - Intergenic
1107652803 13:42561581-42561603 AGGTGAGTGAGGAGCAAGAGAGG + Intergenic
1108458557 13:50642045-50642067 AAGAGAGTGAGGAGGAACAGAGG + Intronic
1109482633 13:62975655-62975677 ACCTGCTTGAGGAGGAACAAGGG - Intergenic
1110450641 13:75635672-75635694 AGGTGGGTGCGGTGGAAGGAGGG - Intronic
1110967411 13:81716925-81716947 AAGAGGGTGAGGAGGAATGAAGG - Intergenic
1111342882 13:86911029-86911051 AGGAGGGTGAGGAAACACAAGGG + Intergenic
1111590579 13:90342439-90342461 AGGTAGGTGAGGGGGAAGAGAGG + Intergenic
1111708149 13:91777102-91777124 TGGTGGGGGAGGAGGAAGAAAGG - Intronic
1111732469 13:92094413-92094435 AGGTGGCTGAGGCGGGAAAATGG + Intronic
1111830363 13:93321957-93321979 AGGTGGAGGAGGGGGAAGAAGGG - Intronic
1112005839 13:95253058-95253080 AGGAAGGTGAGGAAGAACAGTGG - Intronic
1112968184 13:105225157-105225179 GAGTCGGGGAGGAGGAACAACGG - Intergenic
1113122280 13:106936241-106936263 AGGAGGGAGAGGAGGAGAAAAGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113646134 13:111997951-111997973 AGATGGGAGAGGAGGATGAAGGG - Intergenic
1114426336 14:22626807-22626829 AGGAGGGTGGGGACGAAGAAGGG - Intergenic
1114450066 14:22819610-22819632 AGGTGGGAGAGGAGGGACAATGG - Intronic
1114613783 14:24057878-24057900 AGGTGGGAGAGGAGGGGGAAGGG + Exonic
1115325141 14:32129702-32129724 AGGTAGGGCAGGAGAAACAAGGG - Intronic
1115334262 14:32229447-32229469 GTTTGGGTGAGGAGGAGCAAAGG + Intergenic
1115498289 14:34027457-34027479 AGGGAGGAGAGGAGGAAGAAGGG + Intronic
1116091299 14:40310151-40310173 AGGTGGGTGACAAGGACAAAGGG + Intergenic
1116472724 14:45305146-45305168 ATGTGGGTCAGGAGGAAGAGAGG + Intergenic
1116584653 14:46687211-46687233 AGTTGGGTGAGGGGTGACAAAGG + Intergenic
1116830475 14:49714366-49714388 AGGAGGATGAGGCAGAACAATGG + Intronic
1116850819 14:49907140-49907162 AGGTAGGGGATGAGGCACAAGGG + Intergenic
1117098937 14:52325664-52325686 AGCTAGGTGAGGAGGTGCAATGG - Intronic
1117622059 14:57597573-57597595 AGCTGGGGGAGCAGGAAGAAAGG + Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118424137 14:65639723-65639745 AGCTGGGTGATGAGGACAAAAGG - Intronic
1119162572 14:72465335-72465357 AGCAGAGTGAGGAGGAAGAAGGG + Intronic
1119180391 14:72601063-72601085 AGGGGGAGGAGGAGGAAGAAGGG + Intergenic
1119625926 14:76175370-76175392 AGATGGGGGAGGGGGAAGAAGGG - Intronic
1120154397 14:81076623-81076645 AAGTGGGTGATGAGGAAAGAAGG - Intronic
1120251576 14:82065700-82065722 AGGTGGGGGAGCAGAAATAAGGG + Intergenic
1120484939 14:85101676-85101698 AGGAGGCTGAGGCGGAAGAATGG - Intergenic
1120706213 14:87748585-87748607 AGGTGGGTGGGAAGTAGCAATGG + Intergenic
1120828798 14:88979749-88979771 TGGTGGGTGATGAGGAAATAAGG + Intergenic
1121227782 14:92334027-92334049 AAGTGGGTGAGGAGGTGCAATGG + Intronic
1121645042 14:95512447-95512469 AGGAGGCTGAGGCAGAACAATGG + Intergenic
1121667845 14:95686297-95686319 AGGAGGGGGAGGAGGAGGAAGGG - Intergenic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1122801121 14:104229998-104230020 TGATGGCTGAGGACGAACAAGGG + Intergenic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124352100 15:28963417-28963439 AGGTGGGTGGGGAGGATGAAAGG - Intronic
1124950491 15:34314782-34314804 AGGAGTGAGAGAAGGAACAAAGG - Intronic
1124953568 15:34344911-34344933 AGGAGGGTGAGGCAGGACAATGG + Intronic
1124966109 15:34434598-34434620 AGGGGGGTGGGGAGGAACTCTGG + Intronic
1125679970 15:41524351-41524373 AGGAGGATGAGGAGGAAGAGTGG + Intronic
1126104460 15:45138454-45138476 AGGGGGGTGGGGAGGAAGCAGGG + Intronic
1126675232 15:51155138-51155160 AGGAAGGTGAGGAGGAACCATGG - Intergenic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1127346830 15:58109502-58109524 ACGTGTGGGAGGAGGTACAATGG + Intronic
1127505437 15:59593474-59593496 AGGAGGCTGAGGAGGAAGGATGG + Intergenic
1127607198 15:60598431-60598453 AGTAGGCTGAGGAGGAAAAAAGG - Intronic
1127922532 15:63504670-63504692 AGGTGGGGGCGGAGGAACTCCGG - Exonic
1128047886 15:64635111-64635133 AGGTGTGTGAGCATGCACAAAGG - Intronic
1128721694 15:69955058-69955080 AGGTGGAGGAGGAAGAAAAAGGG - Intergenic
1129442127 15:75588965-75588987 AGGGGGGAGAGGAGGAAAAGGGG + Intergenic
1129512856 15:76137682-76137704 GGGTTGGAGAGGAGGAACAATGG - Intronic
1129540016 15:76341421-76341443 CGGTGGGGGAGGGGGAACAGTGG + Intronic
1129739374 15:77982621-77982643 AGTTGGGGGAGGAAGACCAAGGG - Intergenic
1129756445 15:78101873-78101895 AGGTGAGGGAGTAGGAGCAAAGG - Intronic
1130430476 15:83842213-83842235 AGATGGATGAGGAGGCAGAAGGG + Intronic
1130776228 15:86986553-86986575 AGGAGGAGGAGGAGGAAAAAGGG + Intronic
1131183004 15:90253282-90253304 AGGTGGGGGAGGATGAAGAGTGG + Exonic
1131330395 15:91493212-91493234 AGGGGGGAGAGGAGGAGAAAAGG + Intergenic
1131432625 15:92398956-92398978 AGGTGAATGAGGAGGACCAGAGG + Intronic
1131507656 15:93031413-93031435 AGGTGATGGAGGAGGAAGAAAGG - Intergenic
1131666102 15:94572623-94572645 TGGTGAGCAAGGAGGAACAAGGG - Intergenic
1132664056 16:1073627-1073649 GGGTGGGGGAGGAGGGCCAAGGG - Intergenic
1132894198 16:2220166-2220188 AGGTGGGTGAGGTGAAGCCATGG - Intergenic
1132989867 16:2787064-2787086 AGGGGAGTGAGGAGGAGCAGGGG - Intronic
1133409961 16:5559902-5559924 TGGAGGGTGAGGAAGAATAAAGG - Intergenic
1133585276 16:7188533-7188555 AGGTGGGTGATGGGGAGAAAAGG - Intronic
1134125572 16:11613666-11613688 AGGTGGGAGAGGAGCAGGAAAGG + Intronic
1134287173 16:12872015-12872037 AGGAGGGGGAGGAGGAGGAAAGG - Intergenic
1134303169 16:13009356-13009378 AGGTGGGTCAGCCGGAGCAAAGG + Intronic
1134465574 16:14474095-14474117 AGGAGGTTGAGGTGGTACAATGG - Intronic
1135344521 16:21677584-21677606 AGGAGGCTGAGGAAGAAGAATGG - Intergenic
1135576706 16:23591556-23591578 AGGTGGCGGAGAAGGAACAGAGG - Intronic
1135701358 16:24635385-24635407 AGGAGGCTGAGGCGGAAGAATGG - Intergenic
1135777375 16:25268693-25268715 AAGTTGAAGAGGAGGAACAATGG + Intergenic
1135823769 16:25707993-25708015 GGGTGGGTGTGGAGTAACTATGG - Intronic
1135868608 16:26128066-26128088 AGGAGGAAGAGGAGGAGCAAAGG - Intronic
1136350063 16:29700994-29701016 GGGTGGGTGAGGAGGAGGACAGG - Intergenic
1136363738 16:29798763-29798785 GGTTGGGAGAGGAGCAACAAAGG + Intronic
1136605511 16:31331021-31331043 AGGTGGGGGAGGAGGACTGAGGG + Intronic
1137763993 16:50963633-50963655 AGGTGGCTGAGAAGGATCCAAGG + Intergenic
1138059490 16:53875051-53875073 AGGTAGGTAAGGACGAACAGAGG + Intronic
1138569458 16:57859915-57859937 AGGAGGCTGAGGAGGAAAGATGG + Intronic
1139210103 16:65068364-65068386 AGGTGGGTGAGAAGAATGAAGGG + Intronic
1139933420 16:70548631-70548653 AGGTGGGAAAGGGGGAACATAGG + Intronic
1139975072 16:70803399-70803421 AGGTCAGAGAAGAGGAACAAGGG - Intergenic
1140655190 16:77132469-77132491 AGGAGGGGGAGGAGGAGGAAGGG - Intergenic
1141075912 16:81006675-81006697 AGGGACCTGAGGAGGAACAACGG + Intronic
1141263374 16:82474004-82474026 AGGAGAGTGAGGAAGAAAAAAGG - Intergenic
1142676791 17:1518410-1518432 AGGTGGGTGAGGAGGAAAGGGGG + Exonic
1143313135 17:6010053-6010075 AGATGAGTGAGGAGACACAATGG - Intronic
1143374407 17:6458773-6458795 AGGTGTGGGAGGAGGATGAAGGG - Intronic
1143651280 17:8265487-8265509 AGGGAGGGGAGGAGGAACTATGG + Intronic
1144041385 17:11414093-11414115 AGGAGGGAAAGGAGGAGCAATGG - Intronic
1144396977 17:14853982-14854004 AGGTCAGTGAGGAGGCAAAATGG + Intergenic
1144657629 17:17047664-17047686 AGGTGGGTGTTGAGGAACCTGGG + Intronic
1144943017 17:18954369-18954391 AGGTGGGTCATGGGCAACAAGGG - Intronic
1145775657 17:27526499-27526521 AGATGGCAGAGGAGGAACACAGG - Intronic
1145782154 17:27570485-27570507 TGGTGGGTGTGGAGGAATAGAGG - Intronic
1146422616 17:32702562-32702584 TGGGGGGCGAGGAGGGACAAAGG - Intronic
1146688480 17:34857107-34857129 AGGGGGGTGGGGAGGAACGAGGG + Intergenic
1147005782 17:37402775-37402797 AGGAGGCTGAGGAAGAAGAATGG - Intronic
1147710914 17:42463986-42464008 AGGAGGCTGAGGAGGAGGAAGGG + Intronic
1147765288 17:42830980-42831002 AGGTGGGAGAGAAGGAATACTGG + Intronic
1149013296 17:51880212-51880234 GGGTTGGTCAGGAGGAATAAAGG - Intronic
1149103979 17:52939712-52939734 AGGAGGCTGAGGCGGAAGAATGG - Intergenic
1150371792 17:64645055-64645077 AGGTGGGGAAGGAGGAAGATGGG + Intronic
1150573172 17:66405934-66405956 TGGTTGGTGTGGAGGAAAAATGG + Intronic
1150984032 17:70175218-70175240 ATGTGGGTGAGAAGGGGCAACGG + Exonic
1151080439 17:71323250-71323272 AGGTGGGGCAGGAAGAAGAAAGG + Intergenic
1151388642 17:73770827-73770849 AGGCGGGTGAGGATGAAGGAGGG + Intergenic
1151619075 17:75234154-75234176 AGGAGGCTGAGGAGGAAGAATGG - Intronic
1151867444 17:76813562-76813584 GGGTGGGGGAGGAGGAATAGGGG - Intergenic
1151887536 17:76932060-76932082 AGGAGGAGGAGGAGGAAAAAAGG - Intronic
1152472792 17:80499749-80499771 AGCTGGGTGAGGAGCAGCAAAGG + Intergenic
1152676421 17:81643676-81643698 AGGAGGCTGAGGAGGAAGGATGG + Intronic
1153314687 18:3710356-3710378 AGCTGGGTGTGGAGGAGAAAGGG - Intronic
1154343207 18:13521599-13521621 AGTGGCGTGAGGAGGAAGAAGGG + Intronic
1155158217 18:23175769-23175791 GGTTGGCTCAGGAGGAACAAGGG - Intronic
1156046985 18:32888201-32888223 AGGTGGGGGAGGGGGAAGCAGGG + Intergenic
1156457610 18:37303585-37303607 AGGCGGGTGGGGAGAAAAAAAGG + Intronic
1157480610 18:48051271-48051293 AGATGGGTGAGGAAGAATGAGGG + Intronic
1157483709 18:48072715-48072737 AGGTGGGATTGGAGGAGCAATGG - Intronic
1157605634 18:48924310-48924332 AGGAGGAGGAGGAGGAGCAAGGG + Intronic
1158594877 18:58807271-58807293 AGGTGGGTCAGGAGGCAGAAAGG - Intergenic
1159617080 18:70593608-70593630 AGGTGGGTGATGAGTAAAAAGGG + Intergenic
1160030587 18:75255156-75255178 AGATGGTAGAGGAGGAAGAAAGG - Intronic
1160155311 18:76429253-76429275 AGGTGTGTGGGGAGCAACAATGG + Intronic
1160254215 18:77233834-77233856 AGGAGGGTGAGGAGGAGGAGGGG - Intergenic
1160362336 18:78294554-78294576 AGGAGGGGGAGGAGGAACGATGG + Intergenic
1160623509 18:80187547-80187569 GGGAGGGTCACGAGGAACAAAGG + Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161607353 19:5222444-5222466 AGGTGGAGGAGGAGGAAGAGGGG + Intronic
1161865995 19:6832569-6832591 AGGAGGGCGAGGAGGAGGAAGGG - Intronic
1161866017 19:6832647-6832669 AGGAGGAGGAGGAGGAAGAAGGG - Intronic
1161915464 19:7224922-7224944 AGGTGGGGGTGGGGGAACAGAGG + Intronic
1162024207 19:7884553-7884575 AGGAGGGGGAGGAGGAAGATGGG + Intergenic
1162032842 19:7924903-7924925 AGGGGAGGGAGGAGGGACAAGGG + Exonic
1163074153 19:14874263-14874285 AGGAGGCTGAGGCGGAAGAATGG - Intergenic
1163372529 19:16909437-16909459 AGGAGGCTGAGGTGGAAGAATGG + Intronic
1164292723 19:23881969-23881991 AGGAGGAAGAGGAGGAAGAAAGG + Intergenic
1164591893 19:29511977-29511999 AGGAGGATGAGGAGGAAGGAGGG + Intergenic
1164592304 19:29513526-29513548 AGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165221102 19:34317421-34317443 AGCTGGAGGAGGAGGAAAAAGGG - Intronic
1165428475 19:35758256-35758278 AGGAGGCTGGGGAGGACCAACGG + Intronic
1165727312 19:38122244-38122266 AGAGGGGTGGGGAGGAACACAGG - Intronic
1165894959 19:39136081-39136103 AGGGGGGTGACGAGGAAGAGGGG - Intronic
1165937439 19:39397879-39397901 AGGAGGGGGAGCAGGAAGAAGGG - Exonic
1166778434 19:45326540-45326562 AGTTGGGTCAGGAGGGACAGTGG - Intergenic
1166794363 19:45417424-45417446 AGGAGGATGAGGAGGAGGAAAGG + Intronic
1166931945 19:46306383-46306405 AGGTGGGAGAAGAGGAATAGGGG + Intronic
1166974652 19:46598544-46598566 AGGGAGCTGAGGAGGAGCAAGGG - Intronic
1167122939 19:47529687-47529709 AGGTGGGGGAAGAGGACCACAGG + Intronic
1167190858 19:47988573-47988595 AAGAGGATGAGGAGGAACCATGG - Intronic
1167449886 19:49560809-49560831 AGGGGGGTGAGGTGGAAGAGAGG + Intronic
1167874386 19:52399066-52399088 AGGTGGGAGAGAAGGAATAGAGG + Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
1167915005 19:52733762-52733784 AGGTGGAAGAGAAGGAATAAAGG - Intronic
1167932351 19:52876600-52876622 AGGAGGGTGAGGCAGAAGAATGG - Exonic
1168137432 19:54360760-54360782 AGGTGTGTGCAGAGGAAGAAGGG + Intronic
1168160645 19:54508322-54508344 AGGTGTGTGCAGAGGAAGAAGGG - Intronic
1168162537 19:54521139-54521161 ACGTGGGTGAGGAGGGACTCGGG + Intergenic
1168232440 19:55041773-55041795 AGGTGGCTGTGAAGGAACCAGGG - Intronic
1168288701 19:55346917-55346939 GGCAGGGAGAGGAGGAACAAAGG - Intronic
925056522 2:861135-861157 AGGTGGGGGCTGAGGAATAAGGG - Intergenic
925182998 2:1829183-1829205 AGTTGGGGGAGAAGGAACCAGGG - Intronic
925459952 2:4053266-4053288 AGGAGAGTGAGGATGAAGAAAGG - Intergenic
925674644 2:6349005-6349027 AGGAGGGTGAGGCTGAACAGAGG - Intergenic
926647503 2:15305328-15305350 AGGAAGGTGAGCAGGAACCAAGG - Intronic
926890420 2:17634664-17634686 AGTAGGGTGAGGAGGAAAACAGG + Intronic
927009081 2:18882874-18882896 AGGAGGGTGAGGCGGGAGAATGG - Intergenic
927576885 2:24207851-24207873 AGGAGGGTGAGGAGGAGCAGTGG + Intronic
927651059 2:24914049-24914071 GGCTGGGTGAGGAGGAAGGAGGG - Intronic
927705480 2:25294076-25294098 AGCTGGGTGTGGAGGAAGGAAGG - Intronic
928061369 2:28116525-28116547 GGCTGGGTGGGTAGGAACAAAGG + Intronic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
928399676 2:30968934-30968956 AGGTAGTTGAGGTGGAACCAGGG + Intronic
928404358 2:31003391-31003413 AGGAGGGTGAGGAGGAAAGTGGG - Intronic
928475367 2:31621265-31621287 AGATGGGAGATGAGGAGCAATGG - Intergenic
928846304 2:35677099-35677121 AGGTGGGGAAGGAGCAACACTGG + Intergenic
929460170 2:42097559-42097581 AGGTGGGTACAGAGGAATAATGG - Intergenic
929597982 2:43187998-43188020 AGGAGGCTGAGGAAGAAGAATGG - Intergenic
929939700 2:46324169-46324191 AGGAGGGTGAGGAAGGAGAATGG - Intronic
930117431 2:47730648-47730670 GGGAGGGTGAGGTGGAAGAATGG - Intronic
930354433 2:50299923-50299945 AGGTGATTAAAGAGGAACAAAGG + Intronic
930364648 2:50424168-50424190 AGGAGGGGGAGGAGGAAGAGGGG + Intronic
931683974 2:64777349-64777371 AGATGGATGATGAGGAGCAAGGG + Intergenic
931767288 2:65468081-65468103 AGGGTGATAAGGAGGAACAAAGG + Intergenic
931992796 2:67807891-67807913 AAGTGGAGGAGGAGGAAGAAGGG - Intergenic
932403089 2:71495725-71495747 ATGTGGGTGTGCAGGAACCAGGG - Intronic
932670930 2:73737475-73737497 AGGTTGGGGAGGCGGAAGAATGG - Intergenic
932763554 2:74456163-74456185 AGGAGGAAGAGGAGGAACAGAGG + Exonic
932910391 2:75800206-75800228 TGGTGGGTGGGGAGGAACGTTGG + Intergenic
933009565 2:77042810-77042832 AGTTGGTTGAGGAGGTAAAAAGG - Intronic
933573499 2:84040620-84040642 GGGTGGGTGAGGAGGCAGCATGG + Intergenic
933589965 2:84221373-84221395 AAGGGGGTGAGTAGGAACACTGG - Intergenic
933729282 2:85445074-85445096 AGGCGGGGGAGCAGGAACACGGG - Intergenic
933821795 2:86119459-86119481 AGGAGGCTGAGGAGGGAGAATGG - Intronic
934650150 2:96085945-96085967 AGCTGGGTGAGGAGGAAGTGGGG - Intergenic
934653198 2:96104057-96104079 AGGGGGGAGAGGAAGAAGAAGGG - Intergenic
935188793 2:100759011-100759033 AGGGGCTTGAGGAGGAAGAATGG + Intergenic
935270065 2:101426985-101427007 AGGTGGGTGGAGAGGACCAGAGG - Intronic
935474330 2:103499664-103499686 AGGAGGCTGAGGTGGAAGAATGG - Intergenic
935688308 2:105706433-105706455 AGGTGGGGGAGGATGAAGAGAGG + Intergenic
935721503 2:105983290-105983312 AGGAGAGTCAGGAGGGACAAAGG + Intergenic
935795228 2:106634540-106634562 AGATGAGGGAGGAGGAAGAAGGG - Intergenic
935961120 2:108426538-108426560 AGCTGGGTGATTAGGAACATGGG + Intergenic
936073956 2:109389953-109389975 AGGTGGGTGAGGAGGAACAAGGG - Intronic
936232111 2:110712161-110712183 AGCAGGGTGAGGAGGGAAAATGG - Intergenic
936292684 2:111238627-111238649 AGCTGGATCTGGAGGAACAATGG - Intergenic
936863144 2:117046100-117046122 ATGTTGTTGAGGGGGAACAATGG + Intergenic
938029239 2:127978050-127978072 AGGAGGCTGAGGAGGAATGAGGG + Exonic
938161932 2:128993666-128993688 AGGTGGATGAGGATGAGGAAGGG + Intergenic
938342496 2:130544791-130544813 AGGTGGGAAAGGAGGAGCTAGGG - Intronic
938347336 2:130575918-130575940 AGGTGGGAAAGGAGGAGCTAGGG + Intronic
938572073 2:132570130-132570152 AGCTGGGTGGGGAGGGCCAAGGG - Intronic
938654111 2:133413110-133413132 ATGTGGGTGGGGAGGCACAGTGG + Intronic
939884148 2:147662816-147662838 AGGAGGAAGAGGAGGAGCAATGG - Intergenic
940111145 2:150155286-150155308 GGGAGGGCGAGGAAGAACAATGG + Intergenic
941592747 2:167440236-167440258 AGGAGGGTGAGGCGGGAGAATGG + Intergenic
941673800 2:168322601-168322623 AGGTGGGTGGGGAGGGTGAAAGG + Intergenic
942207820 2:173639522-173639544 AGAAGGATGAGGAGGAAGAAAGG - Intergenic
943102376 2:183504112-183504134 AGGGAGTTGAGGAAGAACAAGGG - Intergenic
943771706 2:191724345-191724367 GGGAGGCTGGGGAGGAACAAGGG + Intergenic
944552275 2:200855518-200855540 AGGAGGCTGAGGTGGGACAATGG + Intronic
944687789 2:202132998-202133020 AGGAGGCTGAGGTGGAAGAATGG + Intronic
945048561 2:205802388-205802410 AGGGGTGAGAGGAGGAAAAAAGG - Intergenic
945223260 2:207505832-207505854 AGGTGGGTGTGGTGGAGCAGGGG - Intergenic
946048078 2:216837779-216837801 GGGGGGATGAGGAGGAGCAAGGG - Intergenic
946163935 2:217852404-217852426 TGGGGGATGAGGAGGCACAAAGG - Intronic
946276290 2:218634216-218634238 AGATGGGTGAGGAGGCAGCAGGG + Exonic
946289634 2:218734560-218734582 AGTTGGGTGAAGAAGAAGAAAGG + Intronic
946632496 2:221685355-221685377 AGGAGGCTGAGGTGGGACAATGG - Intergenic
946703264 2:222433445-222433467 TGGCTGGTGAGGAAGAACAATGG + Intronic
947523904 2:230867013-230867035 TGCTGGGTGAGGGGGAAGAAAGG - Intronic
947666768 2:231910903-231910925 AGGTGGGTGGGGAGGGGCAGAGG - Intergenic
948043459 2:234923839-234923861 AGGAGGGTGAGGAGCAAAAAAGG - Intergenic
948548970 2:238754854-238754876 AGGTGAAAAAGGAGGAACAAAGG + Intergenic
1168741247 20:193270-193292 AGGTGGGTATGGAGCGACAATGG + Intergenic
1168876000 20:1172692-1172714 TGGTGGGTGAGGGGGAGGAAGGG + Intronic
1169999660 20:11601181-11601203 AGGTCAGTTAGGAGGCACAAGGG + Intergenic
1170123435 20:12935973-12935995 AGATGGGTGAGAAGGAACCAAGG - Intergenic
1170138245 20:13099511-13099533 ATGTGGGTGTGTGGGAACAAGGG - Intronic
1170349631 20:15424613-15424635 AGGAGGCTGAGGAGGGAGAATGG + Intronic
1170598576 20:17823605-17823627 AGGAGGGGGAGGAGGGAGAAGGG - Intergenic
1171035097 20:21707646-21707668 AAGTGGGTGACGAGGAAGATGGG + Intronic
1172941332 20:38656659-38656681 AGGTGGGCGAGGTGGAGAAATGG + Intergenic
1172962688 20:38809589-38809611 AGCTGGGTGAGGATGGACAGAGG + Intronic
1173001822 20:39110448-39110470 AGGTGGGAGAGAAGGAAGAGGGG - Intergenic
1173384404 20:42574566-42574588 GGGAGGGAGAGGAAGAACAAAGG + Intronic
1173886048 20:46459509-46459531 TGGTGGGTTATGAGGAACTAGGG - Intergenic
1173937237 20:46877557-46877579 AGGAGGGTGAGGTGGAAGACAGG + Intergenic
1174139028 20:48400088-48400110 AGGGGGCAGAGGAGCAACAAAGG - Intergenic
1174256225 20:49257633-49257655 AAGGGGATGAGGAGGAAGAAGGG - Exonic
1174571656 20:51506481-51506503 GGGTGGGTGGGGAGGAACACGGG - Intronic
1175048361 20:56128566-56128588 AGGTGGGTAACAAGGAAGAAGGG + Intergenic
1175868129 20:62192351-62192373 AGCTGGGTGAGGAGGGGCACGGG + Intronic
1176148826 20:63578650-63578672 CGCTGGGTGAGGAGGACCTAGGG - Intergenic
1176300111 21:5095371-5095393 AGGGGTGTGAGGAGGTGCAAAGG - Intergenic
1176720412 21:10388121-10388143 AGGAGGAGGAGGAGGAAGAAGGG + Intergenic
1177063607 21:16402043-16402065 AGGTGGGGGAGGAAGAAAAGGGG + Intergenic
1178139702 21:29668868-29668890 ATGAGAGTGAGGAGGAGCAATGG + Intronic
1178144475 21:29722449-29722471 AGGTGGGTGAGGCAGGAGAATGG + Intronic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1179030130 21:37712799-37712821 AGTTGGGTGGGGAGGAGGAAGGG - Intronic
1179324955 21:40333467-40333489 AGGTGGCTGAGGAGGGAGGATGG - Intronic
1179587856 21:42385076-42385098 AGGGGGGTGGGGAGGAAAAGAGG - Intronic
1179629008 21:42665423-42665445 GGGTGGGGGAGGAGGACCAGAGG - Intronic
1179856911 21:44166540-44166562 AGGGGTGTGAGGAGGTGCAAAGG + Intergenic
1179904948 21:44418027-44418049 AGGTGGCTGAGGAGGATGAAGGG - Exonic
1179977349 21:44875917-44875939 AGGAGGAGGAGGAGGAAGAAAGG - Intergenic
1180651446 22:17380632-17380654 TGATGGGTGGGGAGGAGCAAGGG - Intronic
1180996463 22:19968208-19968230 AGCTGGGTGAGTGGAAACAATGG - Intronic
1181679179 22:24479789-24479811 GGGAGGTTGAGGAGGAAAAATGG + Intergenic
1182322733 22:29489082-29489104 AGGAGGGCAAGGAGGAAGAAGGG + Exonic
1182972346 22:34590165-34590187 AGGTGGCAGAGAAGGAAGAATGG - Intergenic
1183154874 22:36067048-36067070 GGGTGGGTGGGGAGGAGCACAGG - Intergenic
1183317484 22:37144767-37144789 AGGGGGGTGGTGAGTAACAAAGG - Intronic
1183333460 22:37233703-37233725 AGGGGAGTGGGGAGGAATAAAGG + Intronic
1183388959 22:37532701-37532723 AGGAGGGTGAGGCAGAAGAATGG + Intergenic
1183468331 22:37991642-37991664 AGGTGGATGTGGAGGCACCATGG + Intronic
1183645124 22:39121380-39121402 AAGTGGGAGAGAAGAAACAAGGG + Intronic
1184813401 22:46852616-46852638 AGGTGAGTGAAGTGGAGCAAAGG - Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1185104240 22:48858219-48858241 AGCTGGGTGAGGTGGAGCCAGGG - Intergenic
949609241 3:5687243-5687265 AGCTGGGTGTGGAGGAATTAGGG + Intergenic
950139196 3:10603670-10603692 AGCTGGGGGAGGAGGAACAGAGG - Intronic
950329902 3:12148007-12148029 AGGTGGCTGAGGCGGGAGAATGG + Intronic
950674454 3:14546176-14546198 AGCTGGATGAGAAGGCACAAAGG + Intergenic
950742084 3:15060138-15060160 TGGGGGGTGAGAAGTAACAATGG + Intronic
950973540 3:17215216-17215238 GGGTGAGTCAGGGGGAACAAAGG + Intronic
951595741 3:24316487-24316509 TGGTGGGGGAGGAGGAACAAGGG - Intronic
951702874 3:25513509-25513531 AAGTGGGAGAGGAGGCAGAATGG - Intronic
951800130 3:26586656-26586678 AGGTAGGTGAGGAGGAGGGAAGG - Intergenic
952882078 3:37991444-37991466 AGGTGCCTGGGGAGGAAAAATGG + Intronic
952968780 3:38637587-38637609 AGCTGGGTGAGGGGGCACAGAGG - Intronic
952981420 3:38739080-38739102 GGGTGGGTGAGGAAAAAGAATGG - Intronic
953032037 3:39185669-39185691 AGTAGGAGGAGGAGGAACAAAGG + Exonic
953367171 3:42354756-42354778 AGGAGGGTGAAGAAGAAGAAAGG - Intergenic
953581831 3:44164326-44164348 AGGAGGCTGAGGCGGAAGAACGG + Intergenic
953628359 3:44589523-44589545 AGGTGGTAGTGGAGGAACTATGG + Intronic
953914088 3:46906816-46906838 AGTTGGCTGAGGAGGAACCAGGG - Intergenic
954423207 3:50429663-50429685 GGGAGGCTGAGGCGGAACAATGG + Intronic
954482830 3:50817394-50817416 AGGAGGCTGAGGAGGACAAATGG - Intronic
955076845 3:55621795-55621817 AGGAGGGAGAGAAAGAACAAAGG + Intronic
955715549 3:61825747-61825769 AGGAGGATGAGGAGGGAGAATGG - Intronic
955752932 3:62200946-62200968 AGATAGTAGAGGAGGAACAATGG + Intronic
956062037 3:65357473-65357495 GGGTGGGAAAGGAAGAACAAGGG - Intronic
956433348 3:69209037-69209059 AGGAGGGTGAGGCAGAAGAATGG + Intronic
956514667 3:70033679-70033701 AGGTGAGAGAGGATGAACTAGGG + Intergenic
956561195 3:70576841-70576863 AGGTGGGTGAGGGGGAGAAGAGG + Intergenic
958077623 3:88703097-88703119 AGGAGGAGGAGGAGGAAGAAAGG - Intergenic
958168953 3:89914828-89914850 AGGAGGATGAGGAGGTAGAAAGG + Intergenic
958517216 3:95132317-95132339 AGGAGGAGGAGGAGGAAAAAGGG + Intergenic
959340488 3:105123539-105123561 AGGTGGGAGAGAAGGAAGGAGGG + Intergenic
959352295 3:105281106-105281128 ATGTGGGGGAGGAAGGACAAAGG + Intergenic
960045521 3:113193602-113193624 AGGTGGGTGGGGAGGAGAAAAGG + Intergenic
960200977 3:114836062-114836084 AGGTGAGTGAGGTGGCATAAGGG + Intronic
960805461 3:121579446-121579468 ATGTGGCTGAGGAGTCACAAAGG - Intronic
961428636 3:126864642-126864664 AGGTGGAGGAGGAGGAAAAAAGG - Intronic
961645762 3:128392030-128392052 AACTGGGTGAAGAGGAGCAAAGG - Intronic
961721367 3:128898850-128898872 AGGGTGGTGAGGAGGAGGAAAGG - Intronic
961743749 3:129050191-129050213 AGATGGGGAAGGATGAACAAGGG + Intergenic
962197412 3:133376303-133376325 AGGTGGGAGAGGAGCCACCATGG - Intronic
962380940 3:134897703-134897725 GGGTGTGTGAGGAGGAATAAAGG - Intronic
962733865 3:138306756-138306778 AGGTGGCAGAGGAGGAACATGGG + Intronic
962738525 3:138346634-138346656 AGGTGGGAGTGGAGGCACAGGGG + Intergenic
963032628 3:140993812-140993834 AGGAGGAGGAGGAGGAAGAAGGG - Intergenic
963145474 3:141989556-141989578 AGGTGGGATAAGAGGTACAAGGG + Intronic
963601069 3:147379612-147379634 AGGTGAGGGAGGAGGAGCAGAGG + Intergenic
963603772 3:147397487-147397509 AGGAGGGGGAGGAGGCTCAAGGG - Intronic
963915922 3:150858755-150858777 AGCTGGGTATAGAGGAACAATGG - Intergenic
964306167 3:155342574-155342596 AGGAGGGTGAGGAGGAGGAGGGG + Intergenic
964564323 3:158033129-158033151 GGGTGGGGGAGGAGGATGAAGGG + Intergenic
965628694 3:170708228-170708250 AGGTAAGTGAGGAGGAAGAAGGG + Intronic
965785148 3:172327503-172327525 AGGGGGCTGAGGAGGGAGAATGG - Intronic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
966442356 3:179959791-179959813 TGGTGAGTGAGAAGGAACAGTGG - Intronic
966645839 3:182245662-182245684 AGGTGGATCAGCACGAACAAAGG + Intergenic
966917923 3:184594898-184594920 AGAAGGGGGAGGAGGACCAAGGG + Intronic
967028151 3:185582425-185582447 AGGTAGGTTTGGAGGAAGAAGGG + Intergenic
967732282 3:192917613-192917635 TGCTGGGTAAGGAGGAAAAAGGG - Exonic
968088820 3:195886944-195886966 AGGTGGGTGAGGAGGTGGGAGGG - Intronic
968151321 3:196338746-196338768 AGGAGAGTGATGAGGAAAAAGGG - Intergenic
969121080 4:4911687-4911709 ATGAGGGTGAGGAAAAACAAAGG + Intergenic
970876008 4:20870862-20870884 AGAAGGTTGAGGAGGAAGAACGG - Intronic
972475737 4:39447346-39447368 CGGTGGGTCCGGAGGAACTACGG + Exonic
972579840 4:40385487-40385509 AGGAGGGAGAGAAGGAAGAAGGG + Intergenic
972746345 4:41935782-41935804 AGGTGGGAGAAGAGGAAAGAAGG - Intronic
972782729 4:42300123-42300145 AGGAGGGAGGGGAGGAAGAAAGG - Intergenic
975873507 4:78808368-78808390 AGGAGGGTGAGGCGGGAGAATGG - Intronic
976132298 4:81897550-81897572 AGGGGGGAGAGGAGGAGGAAGGG - Intronic
976530968 4:86151390-86151412 TGGTTGCTGAGCAGGAACAAGGG + Intronic
976709076 4:88050077-88050099 AGGAGGCTGAGGAGGGAGAATGG - Intronic
978346747 4:107777965-107777987 AGGAGGGAGAGGGGGAAGAAAGG + Intergenic
981156411 4:141441951-141441973 AGGTGACTGAGGAGGATGAAGGG + Intergenic
982260685 4:153491809-153491831 AGGAGGGTGAGGTGGAAGGATGG - Intronic
982301007 4:153879543-153879565 AGGTGGCTGGGGAGAACCAAAGG - Intergenic
982771571 4:159401534-159401556 AGGCGGGAGAGGAAGAACAGAGG - Intergenic
983440662 4:167779638-167779660 AGGTAGGGGAGGAGAAACGAGGG - Intergenic
983827997 4:172288193-172288215 AGGAGGCTGAGGCGGAAGAATGG - Intronic
984381957 4:179005708-179005730 AGGTGGGAGAGAAAGAAGAAGGG + Intergenic
984567388 4:181347238-181347260 AGGTGGGTGAGGCAGGAGAATGG + Intergenic
985271266 4:188197004-188197026 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985271302 4:188197124-188197146 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271350 4:188197304-188197326 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271397 4:188197484-188197506 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271411 4:188197544-188197566 AGGTGGGTGGGGAGTGAGAAGGG - Intergenic
985271425 4:188197604-188197626 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985715328 5:1455647-1455669 AGGTGGGAGGGAAAGAACAAAGG - Intergenic
985824619 5:2183195-2183217 GGGTGGGTGAGGAGGGGCCAGGG + Intergenic
985847698 5:2364601-2364623 AGGTGGGTGCACAGAAACAAGGG - Intergenic
985930387 5:3052394-3052416 AAGTGGGAGAGGAGAGACAAAGG + Intergenic
986566765 5:9123432-9123454 AGGAGGGGGAGGAGGAGGAAAGG + Intronic
986887572 5:12258661-12258683 AGGAGGGTGAGGGGGATGAAAGG - Intergenic
987643369 5:20639958-20639980 AGGAGGCTGAGGAGGGAGAACGG - Intergenic
987846190 5:23290407-23290429 TGGTGGGTGGCGAGGAATAAAGG - Intergenic
988568305 5:32338930-32338952 AGGTGGCTGAGGCAGAAGAATGG - Intergenic
989285126 5:39690637-39690659 AGTTGGGTGAGAAGGTAAAAAGG + Intergenic
990142986 5:52726939-52726961 AAATGGGAGAGGAGTAACAATGG - Intergenic
991063548 5:62403252-62403274 AGGTGGGTGTGGAAGAGGAAAGG - Exonic
991533415 5:67639585-67639607 ATGTGTGGGAGGAGGAAGAAAGG - Intergenic
991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG + Intergenic
991631088 5:68656956-68656978 AGGAAGGTGAGGAAGGACAAAGG - Intergenic
991761716 5:69922397-69922419 AGGTGGGTGAAAAGAAAAAATGG + Intergenic
991785613 5:70195703-70195725 AGGTGGGTGAAAAGAAAAAATGG - Intergenic
991840944 5:70797446-70797468 AGGTGGGTGAAAAGAAAAAATGG + Intergenic
991878058 5:71196093-71196115 AGGTGGGTGAAAAGAAAAAATGG - Intergenic
991952792 5:71963011-71963033 GTGAGGGGGAGGAGGAACAAAGG - Intergenic
992376899 5:76197269-76197291 ATGTATGTGAGGAGGAACAAAGG - Intronic
993335825 5:86657277-86657299 AGGTGGGTGAGGAAGAAGATGGG + Intergenic
993549358 5:89254779-89254801 AGGAGGGAAAGGAGGAAGAAAGG + Intergenic
993948994 5:94150393-94150415 GGGTGGGGGAGGAGGAAAAGGGG - Intergenic
994882913 5:105520523-105520545 AGGAGGCTGAGGAAGAATAATGG + Intergenic
995058030 5:107783311-107783333 ATTTGGGTAAGGAGGAACAAGGG + Intergenic
995391939 5:111649494-111649516 AAGTGGATGGGGAGGAAAAATGG + Intergenic
995552360 5:113294022-113294044 AAGCGGGTGGGAAGGAACAAGGG + Intronic
996008379 5:118451232-118451254 ATGGGGGTGGGGAGGAAGAATGG + Intergenic
996116449 5:119625387-119625409 AGGAGGAAGAGGAGGAACAAAGG - Intronic
996402909 5:123082783-123082805 AGGTGGGTAGGGAGGAACTGAGG - Intergenic
996554102 5:124759917-124759939 AGGAGGCTGAGGCGGAAGAATGG - Intergenic
996693533 5:126367483-126367505 AGGAGGGAGAGGAGGAAAAGGGG + Intronic
996805113 5:127445996-127446018 AGGGGGGTGAGGAGGAAGAGAGG + Intronic
997384070 5:133458772-133458794 AGGTGGGAGAGGAGGAGGGAAGG + Intronic
997516313 5:134492298-134492320 AGGTGGGTGAGGAGCCAGAGTGG - Intergenic
998062705 5:139131775-139131797 GGCTGGGTGAGGATGAACAAGGG + Intronic
998251228 5:140554445-140554467 AGGTGGGTTAGGAGGAATGGTGG - Intronic
998424565 5:142015401-142015423 AGGAGGGTTAGGAGGAAATAAGG - Intergenic
998622138 5:143806666-143806688 AGTTGGGTGAGTAGGAAGAAAGG - Intergenic
999409728 5:151340211-151340233 AGGAGGGAGAGGAGGAGGAAGGG + Intronic
1000753308 5:165124685-165124707 AGCTGAGAGAGGAGGAAGAATGG + Intergenic
1000900118 5:166902519-166902541 GGGTAGGTGAGGAGGAGGAAAGG + Intergenic
1001483671 5:172105145-172105167 AGGTGGGGGAGCAGGAGCACAGG - Intronic
1001686651 5:173598626-173598648 AGGTGGCGGAGGAGGACAAACGG - Intergenic
1002021706 5:176367795-176367817 AAGTGGCTGAGGTGGAACAGGGG - Intronic
1002065606 5:176650246-176650268 ACGAGCGTGAGGAGGAAGAACGG + Intronic
1002588349 5:180267965-180267987 AGGAGGGTGAGGTGGGAGAATGG - Intronic
1002701975 5:181130752-181130774 AGCTGGGGGAGGAGGAACGCAGG + Intergenic
1003177684 6:3764949-3764971 AGGTGGGTGGGGAGGGACTTGGG - Intergenic
1003408635 6:5843946-5843968 TGGTGGCTGAGGAGGAAGACAGG + Intergenic
1003527603 6:6911068-6911090 AGCTGGGTGAGGATGAAGCATGG - Intergenic
1003681155 6:8258401-8258423 AGGAGGGAGAGGAGGAAGAAGGG + Intergenic
1003823294 6:9924486-9924508 AGGAGGGAGAGGAGCAAAAAAGG + Intronic
1004550933 6:16646534-16646556 AGGTGTGTGAGGTGGAACAGTGG - Intronic
1005546362 6:26877449-26877471 AGGTGGGTGAAAAGAAAAAATGG - Intergenic
1006055623 6:31382332-31382354 ATGTGGGAGAGGAGGAATTATGG + Intergenic
1006191376 6:32211644-32211666 AGGTATGTGAGGAGGAGGAAGGG + Intronic
1006255651 6:32830144-32830166 AGGTAGGTGGGGAGGACAAAAGG - Intronic
1006496141 6:34425047-34425069 AGGAGGGTGAGGAGGAAGATGGG - Intronic
1007215269 6:40232481-40232503 ATTTGGGTGATGGGGAACAAAGG - Intergenic
1007813473 6:44503289-44503311 AGGTGGGTGAGGAGCAGAGAGGG + Intergenic
1008232579 6:49001765-49001787 TAATGGGTGAGGAGGAAGAAGGG - Intergenic
1008863188 6:56176634-56176656 AGGGGGGGAAGGAGGAAGAAAGG + Intronic
1009017075 6:57918247-57918269 AGGTGGGTGAAAAGAAAAAATGG - Intergenic
1009858774 6:69297558-69297580 CGGTGGGGGAGGAGGAATATTGG + Intronic
1009978879 6:70702733-70702755 AGGAGGCTGAGGTGGGACAATGG - Intronic
1010022949 6:71182245-71182267 AAGTGGGTTAGTGGGAACAAAGG + Intergenic
1011087640 6:83560203-83560225 AGGAGGCTGAGGAGGAAGAATGG + Exonic
1011163130 6:84414958-84414980 AGGTGGGTGAGGGAGAAGGAGGG + Intergenic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1011713101 6:90074919-90074941 GGGTAGGTAAGCAGGAACAAAGG + Intronic
1012421282 6:99068350-99068372 AGGTGGAGGAGGAGGAAGAGAGG - Intergenic
1012492448 6:99797441-99797463 AGGTGAGTTAGCAGGAGCAAAGG - Intergenic
1013057971 6:106603544-106603566 AGGAGGGTGGGGCGGGACAAGGG + Intronic
1013425867 6:110012126-110012148 AGGTGGGAGAGAGGGAGCAAGGG - Intergenic
1013448022 6:110250824-110250846 ATGTGGCTGAGAAGGAACCAAGG - Intronic
1014217461 6:118766610-118766632 AGGTGTGGGAGGCAGAACAATGG - Intergenic
1014264512 6:119261081-119261103 AGGTGGCTGAGGCAGAAGAATGG - Intronic
1014483847 6:121974792-121974814 AGTTGGGGAAGGAGAAACAAGGG - Intergenic
1014494388 6:122102339-122102361 AAGTGGGGGAGGAGGAAGGAAGG + Intergenic
1014655929 6:124103979-124104001 AGGAGGCTGAGGCGGGACAATGG + Intronic
1014999789 6:128200863-128200885 GGGAGGGTGAGGAGGAAGAAGGG + Intronic
1016060947 6:139629347-139629369 GGGAGGGTGGGGAGGAACTAGGG - Intergenic
1016245806 6:141979347-141979369 ATGAGGGTGAGGATGAACCAGGG + Intergenic
1016993880 6:149947487-149947509 AGGTGGGTGAGGAGGCAGGATGG + Intronic
1017004453 6:150020050-150020072 AGGTGGGTGAGGAGGCAGGATGG - Intronic
1017395757 6:153997589-153997611 AGATGGTTTAGGAGGAAGAAAGG + Intergenic
1017719197 6:157233248-157233270 AGGTACAGGAGGAGGAACAAGGG - Intergenic
1017814888 6:158009526-158009548 AGGGGGCTGAGGAGGTAGAAGGG + Intronic
1018567409 6:165169238-165169260 AGCTGGTTGAGGAGGAAGAGAGG + Intergenic
1019027986 6:168987896-168987918 ACATGGCTGAGGAGGAGCAAAGG + Intergenic
1019548918 7:1592621-1592643 ATGTGGGTGGGGGCGAACAACGG - Intergenic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1019936781 7:4262935-4262957 TGGTGGGTGATGAGGTAGAAGGG - Intronic
1020119110 7:5492813-5492835 AGGATGGTGAGGAGGAACTCGGG - Intronic
1021423449 7:20471656-20471678 GGGTAGTTGAGGAGGAACAAAGG - Intergenic
1021456246 7:20832217-20832239 AGGAGGGAGAGGAGGTACCAGGG - Intergenic
1021475090 7:21051634-21051656 ACGTGGGAAAGCAGGAACAAAGG - Intergenic
1022457430 7:30570560-30570582 ACGTGGGTGGGGACGAATAAGGG + Intergenic
1022529440 7:31057771-31057793 AGGAGGGAGAGGAGGAAGTAGGG + Intronic
1023415651 7:39929948-39929970 AGGAGGCTGAGGAAGAAGAATGG - Intergenic
1023586875 7:41739834-41739856 GGGAGGGAGAGGAGGAACTAAGG + Intergenic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1023799488 7:43821620-43821642 AGGAGAGTCAGGAGGAACAAAGG - Intergenic
1023910657 7:44553330-44553352 AGGAGGGGGAGGAGGAGGAAGGG + Intergenic
1024182190 7:46907828-46907850 AGGTGGGTAAGGAGGAGCTGTGG - Intergenic
1024226645 7:47330619-47330641 AGGAGGGAGAGGAGGAACAGAGG + Intronic
1024344208 7:48296562-48296584 AGGAGGCTGAGGAGGGAGAATGG - Intronic
1024581189 7:50802375-50802397 AGGGAGGAGAGGAGGAATAAGGG + Intergenic
1027339366 7:77189633-77189655 GGGTGGTTGGGGATGAACAAGGG - Intronic
1027557058 7:79678096-79678118 ATGTAAGTGAGGAGGAAAAACGG - Intergenic
1029071764 7:97905308-97905330 AGGTGGGTGTGGTTGAAGAAAGG - Intergenic
1029151919 7:98486315-98486337 AGCTGGGTGAGGGGGGACATGGG - Intergenic
1029906676 7:104100049-104100071 AGATGGCAAAGGAGGAACAAAGG - Intergenic
1030635178 7:111940010-111940032 AGGTGGGTAGAGAAGAACAATGG - Intronic
1030862902 7:114658814-114658836 AGGTGGGGGAGAAGGGAGAAGGG - Intronic
1031214808 7:118877127-118877149 AGGAGGGGGAAGAGGAAGAAGGG + Intergenic
1031444508 7:121834620-121834642 AGGAGGCTGAGGCGGAAGAATGG - Intergenic
1032070843 7:128805807-128805829 AGGTCAGTGAGGAGGAGCAGAGG + Exonic
1032669371 7:134069307-134069329 AGGAGGGGGAGAAGGAAGAAAGG - Intergenic
1034021271 7:147645903-147645925 AGGTGGGAGAGGCAGAAAAATGG + Intronic
1034549467 7:151811049-151811071 AGGTGGGATTGGAAGAACAAAGG + Intronic
1034681273 7:152930159-152930181 AGGTGATGGAGGAGGAAGAAAGG - Intergenic
1035046103 7:155967564-155967586 AGGTGGGTGGAGAAAAACAAAGG - Intergenic
1035472194 7:159117624-159117646 AGGAGGGTGTGGGGGAACCATGG - Intronic
1035583573 8:755589-755611 TGGTGCGTGAGTAGGAACGAGGG + Intergenic
1036612525 8:10362639-10362661 TGGTGGGGGAGCAGGGACAACGG - Intronic
1037110077 8:15155188-15155210 GGGAGGCTGAGGTGGAACAATGG + Intronic
1037417049 8:18662948-18662970 AGGTGGGGGAAGGGGAGCAATGG + Intronic
1037760420 8:21738178-21738200 AGGAGGGGGAGGAGGAGGAACGG - Intronic
1038633903 8:29270263-29270285 AGGTGTATGAGCAGGAAAAATGG - Intergenic
1038863881 8:31417291-31417313 AAGTAGGTGAGTGGGAACAATGG + Intergenic
1039005333 8:33030200-33030222 AGGAGGATGAGGTGGAAGAATGG + Intergenic
1039165973 8:34680444-34680466 AGGTGGGGGTGGGGGAACATAGG - Intergenic
1039280804 8:35981614-35981636 AGATAGGTGAGAAGGAAAAAGGG + Intergenic
1039385504 8:37132066-37132088 CGGGGGGTGGGGGGGAACAAGGG - Intergenic
1039427724 8:37500661-37500683 AGGTGGGAGAGGAGGAGGCAGGG - Intergenic
1039465020 8:37778827-37778849 TGGTGGCTGAGGTGGAAGAATGG + Exonic
1039500344 8:38011655-38011677 AGGAGGCTGAGGAGGGAGAATGG - Intergenic
1039582443 8:38677954-38677976 AGGTGGGGGAGGATAAAAAAGGG + Intergenic
1039986308 8:42451214-42451236 AGGGGGATGAGGAGGAGAAAGGG + Intronic
1040011019 8:42661301-42661323 AGGTGGGGGAGGAGGGAGAATGG - Intergenic
1040071905 8:43195553-43195575 AGGAGGATGAGGAGGAAGAGGGG + Intronic
1040682558 8:49831035-49831057 AGATGGAGGAGGAGGAAGAAGGG + Intergenic
1041797174 8:61757530-61757552 AGGAGGCTGAGGTGGGACAATGG + Intergenic
1041881176 8:62751214-62751236 AGGTGGGGTAGGAGGGAGAAGGG - Intronic
1042350683 8:67774278-67774300 AGGTGGGTGAGGTGGCAGATGGG + Intergenic
1044004222 8:86922294-86922316 AGGTGGGAGAGGAGACAAAAAGG + Intronic
1044841259 8:96338936-96338958 AGGAGGAGGAGGAGGAGCAAAGG - Intergenic
1045360066 8:101424843-101424865 AAAGAGGTGAGGAGGAACAAAGG - Intergenic
1046165745 8:110432467-110432489 AGGAAGGTGAAGAGGAAGAAAGG - Intergenic
1047629944 8:126695797-126695819 AGGGTGGTGAGGAGGAGCAGTGG - Intergenic
1048048144 8:130792516-130792538 GGGTCGATGAGGAGGAACAAGGG - Intronic
1049033555 8:140056303-140056325 AGGAGGCTGAGGAGGAAGAATGG + Intronic
1049187479 8:141265200-141265222 CTGTGGGTGAGGAGGACCAGAGG - Intronic
1049199804 8:141334498-141334520 AGGAGGGTGTGGAGGACCCAAGG - Intergenic
1049241516 8:141539724-141539746 ATGTGGGTGAGGGGGAACCAGGG - Intergenic
1050115228 9:2256524-2256546 AGGAGGATGAGGAGTAAGAATGG - Intergenic
1050115639 9:2260654-2260676 AGGCAGCTGAGGAGGGACAATGG - Intergenic
1050703076 9:8363517-8363539 AGGTAAGAGAGGAGGAAAAAGGG - Intronic
1051436611 9:17040406-17040428 AGGTGGGTGGGGAGGAAATGGGG - Intergenic
1051691549 9:19718395-19718417 AGGAGGCTGAGGTGGGACAATGG - Intronic
1052605139 9:30689443-30689465 AGGAGGAAGTGGAGGAACAAGGG + Intergenic
1053275029 9:36776737-36776759 AGAGGGCTGGGGAGGAACAACGG - Intergenic
1054983777 9:71237445-71237467 AGGTGGCTGAGGGGAAAAAAGGG + Intronic
1055325098 9:75120576-75120598 AGGTCGGTGAGAAAGGACAAAGG - Intronic
1055656040 9:78451344-78451366 AGGTGGGAGAGGCAGACCAAGGG + Intergenic
1056177652 9:84051113-84051135 AGTGGGGTGAGGAAGGACAATGG - Intergenic
1056260067 9:84840018-84840040 AGGAGGAGGAGGAGGAAGAAAGG - Intronic
1056870107 9:90269258-90269280 GGGAGAGGGAGGAGGAACAAGGG - Intergenic
1056912330 9:90713696-90713718 AGGGTGGTGAGGAGGAATGAGGG + Intergenic
1056937801 9:90930795-90930817 AGGAGGGAAAGGAGGAAGAAAGG + Intergenic
1057127668 9:92631899-92631921 GGGTTGGCAAGGAGGAACAAGGG - Intronic
1057129145 9:92641141-92641163 AGTTGCGGCAGGAGGAACAAGGG - Intronic
1057221755 9:93261293-93261315 AAGTGGGGAAGGAGGAACCATGG - Intronic
1057330013 9:94105561-94105583 AGGAGGCTGAGGTGGAAGAATGG + Intronic
1058056128 9:100450830-100450852 AGATGGCAGAGGAGGAACACAGG + Exonic
1058702940 9:107615609-107615631 AGGTGGTTGAGTAAGAAAAATGG - Intergenic
1058841293 9:108912071-108912093 TGGTGGGGGAGGGGGGACAATGG + Intronic
1058930552 9:109714819-109714841 TGGTGGATGAGGAGGAATAACGG + Intronic
1059421600 9:114195920-114195942 AGGTGGGTGAGGCAGGAAAACGG - Intronic
1060202123 9:121657360-121657382 GGGTGGGTCAGGAAGGACAAAGG - Intronic
1060709004 9:125837693-125837715 GGGTGGCTGAGGCGGAAGAATGG - Intronic
1061448655 9:130656532-130656554 AGATGGGTCAGGAGGGACCACGG + Intergenic
1061564845 9:131431689-131431711 AGGAGGCTGAGGCGGAAGAATGG - Intronic
1061613905 9:131766676-131766698 ATGTGGGGGAGAGGGAACAATGG + Intergenic
1062470452 9:136701288-136701310 AGGTGGGGGTGGAGAGACAAGGG - Intergenic
1062697922 9:137884875-137884897 AGGAGGGGGAGGGGGAAGAAGGG - Intronic
1185449565 X:275236-275258 AGGAGGGGGAGGAGGAGCAGGGG + Intergenic
1185603660 X:1355163-1355185 AGGAGGGGGAGGAGGAAGGAGGG + Intronic
1186125553 X:6409980-6410002 AGGTGGAAGAGGAGGAAGAAAGG + Intergenic
1186137016 X:6532760-6532782 AGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186275942 X:7938539-7938561 AGGTGTGGGAGAAGGAAAAAGGG + Intergenic
1187019534 X:15366109-15366131 AGGAGGCTGAGGAGGGAGAATGG - Intronic
1187401829 X:18967044-18967066 AGGTGGGAGAGGGGAAAAAAGGG + Intronic
1188267132 X:28091100-28091122 AAGTGGGAGAGGAGGCAAAAAGG - Intergenic
1189502801 X:41579979-41580001 ATTTGGGTGAGGAGCACCAAGGG + Intronic
1189783767 X:44541722-44541744 AGGAGGGAGAAGAGGAACAGTGG + Intronic
1190073836 X:47300971-47300993 AGGAGGAGGAGGAGGAAAAAGGG + Intergenic
1190250274 X:48718197-48718219 AGATGGGGGAGGAGGAAGAAAGG - Intergenic
1190302597 X:49065322-49065344 AGCAGGCTGAGGAGGAACTAAGG - Intronic
1190427233 X:50345169-50345191 AGGTGAGTGAGGGGCAACAAAGG - Intronic
1190454001 X:50607827-50607849 AGGAGGGCGAGGAGGAGGAAAGG + Exonic
1192408994 X:70915756-70915778 AGGTGGGTGGAGGGGAACTATGG + Intergenic
1195001092 X:100644244-100644266 AGATGGGGGAGAAGGAACACAGG - Exonic
1195379346 X:104256049-104256071 GGGAGGGGGAGGAGGAAGAAGGG - Intergenic
1195538016 X:106030919-106030941 AAGTGGGGGAGGAGGATCCAGGG + Intergenic
1195756606 X:108205044-108205066 AGGAGGGGGAGGAGGAGAAAGGG + Intronic
1195942397 X:110176856-110176878 AGGTAGGGGAGGAGGAAAAAAGG + Exonic
1196126741 X:112109454-112109476 AGGTGGGTGGGGACAAATAAGGG - Intergenic
1196719463 X:118839855-118839877 AGGCCGGTGGGGAGGCACAAAGG - Intergenic
1197037650 X:121895796-121895818 AGTAGGCTGAGGAGGAAGAATGG - Intergenic
1197537042 X:127702905-127702927 AGGAGGCTGAGGAGGGAGAATGG + Intergenic
1197874692 X:131090293-131090315 TGGGGGGTGAGGTGGAATAAAGG + Intergenic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198517238 X:137421803-137421825 AGGAGAGTGAGGAAGAACCAAGG + Intergenic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199712232 X:150477527-150477549 AGGTGGCTGAGGAGCAGCCAAGG + Intronic
1199986136 X:152952918-152952940 AGGAGGATGAGGAGGAGGAAGGG + Intronic
1200068712 X:153517587-153517609 AGCTGGGTGAGGAGGAGGGAGGG - Intergenic
1200069423 X:153520379-153520401 AGGTGGGGGAGGAGGTGAAAAGG - Intronic
1200088938 X:153625506-153625528 AGGTGGGTGAGGAGGGGCTGGGG + Intergenic
1200266516 X:154649128-154649150 AGGTTGGTGAGGAGGGGGAATGG - Intergenic
1201524679 Y:14919357-14919379 AGGAAGGAGAGAAGGAACAAGGG + Intergenic
1201625707 Y:16012245-16012267 AGGAGGGAGGGGAGGAAGAACGG + Intergenic
1202058229 Y:20857993-20858015 AGCAGGGTGAGGAAGCACAAGGG - Intergenic