ID: 936075883

View in Genome Browser
Species Human (GRCh38)
Location 2:109401626-109401648
Sequence GCTGCTGCTGTGTCCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936075879_936075883 1 Left 936075879 2:109401602-109401624 CCACAGGGCCCATGACTTTGCAA 0: 1
1: 0
2: 1
3: 23
4: 146
Right 936075883 2:109401626-109401648 GCTGCTGCTGTGTCCCAAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 273
936075881_936075883 -8 Left 936075881 2:109401611-109401633 CCATGACTTTGCAAAGCTGCTGC 0: 1
1: 0
2: 0
3: 14
4: 221
Right 936075883 2:109401626-109401648 GCTGCTGCTGTGTCCCAAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 273
936075875_936075883 24 Left 936075875 2:109401579-109401601 CCTTGGAGTTCTAAAAAAGGAGC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 936075883 2:109401626-109401648 GCTGCTGCTGTGTCCCAAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 273
936075878_936075883 2 Left 936075878 2:109401601-109401623 CCCACAGGGCCCATGACTTTGCA 0: 1
1: 0
2: 0
3: 14
4: 118
Right 936075883 2:109401626-109401648 GCTGCTGCTGTGTCCCAAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 273
936075880_936075883 -7 Left 936075880 2:109401610-109401632 CCCATGACTTTGCAAAGCTGCTG 0: 1
1: 0
2: 1
3: 18
4: 225
Right 936075883 2:109401626-109401648 GCTGCTGCTGTGTCCCAAGAGGG 0: 1
1: 0
2: 1
3: 28
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936075883 Original CRISPR GCTGCTGCTGTGTCCCAAGA GGG Intronic
900993659 1:6109061-6109083 GCTCCTGCTGTGTCCCCACTTGG - Intronic
901447378 1:9316643-9316665 CCTGCGCCTGTGCCCCAAGATGG - Intronic
901785754 1:11623351-11623373 CCTGCTGCTGTGTCCCCTGTTGG - Intergenic
902201664 1:14838093-14838115 GCTGCTGCCTTCTTCCAAGATGG + Intronic
902818495 1:18929421-18929443 GTTGCTCCTGGGTCCCCAGAGGG - Intronic
906057858 1:42930288-42930310 GCTGCTACTCTGCCACAAGAGGG + Intronic
906319006 1:44805316-44805338 GCTGCTGCAGTGGGTCAAGACGG + Exonic
906433532 1:45775618-45775640 TCAGCTGCTGAGTCCCAACATGG + Intergenic
907275351 1:53313931-53313953 GCTGCTGCTGAGATCCAGGAAGG + Intronic
907394027 1:54177245-54177267 GCTGCAGCTGTGGCCCAGGCAGG + Intronic
907517886 1:55004858-55004880 GCTGGTGCTGTGCCCCAAGTAGG + Intronic
907871575 1:58448541-58448563 ACTGATTCTGTGTTCCAAGATGG + Intronic
907929009 1:58981701-58981723 GTGGCTGCTGTTTCCAAAGATGG - Intergenic
909876361 1:80809414-80809436 GTTGCTGCTGTTTGCTAAGATGG - Intergenic
910857711 1:91712269-91712291 GCTGACGCTGTGTACGAAGATGG - Exonic
913276479 1:117143337-117143359 GCTACTGGTATCTCCCAAGATGG + Intergenic
914453146 1:147811201-147811223 GCTGCTTCTCCTTCCCAAGACGG + Intergenic
915466500 1:156101597-156101619 GCTGCTGCAGTTACCCAGGAAGG + Intronic
915700228 1:157785057-157785079 CCTGCTGCAGACTCCCAAGAAGG + Intergenic
916221181 1:162446429-162446451 GGGGCTGCTGTGTCCCACGTGGG + Intergenic
918041596 1:180917076-180917098 GGTGCAGCTGTGTCCCAGGATGG - Exonic
919139468 1:193552482-193552504 GTTGTGGCTGTGTCCCCAGAAGG + Intergenic
920856473 1:209666630-209666652 AGTGATGCTGTGTCCCAAGATGG + Intergenic
923034925 1:230279104-230279126 GGTGCTGCTGGGACCCAGGAAGG - Intronic
923402603 1:233629485-233629507 CCTGCTGCTGTGTGCCAGCAGGG - Intronic
923492831 1:234499416-234499438 GCTGCTGATGTGTCCCCAGGAGG - Intergenic
1063964477 10:11336046-11336068 GGTGCTGCGGTATCCCAAGGTGG - Exonic
1065765186 10:29022849-29022871 GCTGCTGCTGGGCCCCATTATGG - Intergenic
1067528735 10:47055214-47055236 TCTGATGATGTGTCCCAGGATGG - Intergenic
1067681467 10:48444533-48444555 GCTCCTGCTGAGTCCCCAGTAGG - Intergenic
1070607612 10:77910002-77910024 GTTTCTGCTGTGTCACAAAAAGG + Intronic
1071856984 10:89635943-89635965 GCTGCTCCAGTGTTCCCAGATGG - Intronic
1073076677 10:100828849-100828871 GCTGCTGCTTTGTGGAAAGACGG + Exonic
1075483414 10:122800469-122800491 GCTGCTGCTGGGACCCAGGTGGG - Intergenic
1076726171 10:132414451-132414473 GCTGGTGCTGTGGCACAAGTGGG - Intronic
1077548597 11:3188877-3188899 GCTGCCGCAGTGTCCCTCGAAGG + Intergenic
1081683587 11:45025980-45026002 GCTGATGCTGTGGCCTAAGTAGG + Intergenic
1081825863 11:46051059-46051081 TTTGCTGCTGTTTCCCAGGAAGG - Intronic
1081967348 11:47177809-47177831 GCTGCTCCTCTGTCCCTTGAGGG - Exonic
1082809627 11:57471589-57471611 GGTGCAGGTGTGACCCAAGATGG + Intronic
1083201056 11:61121359-61121381 TATGCTGCTGTGTCTCAGGATGG + Intronic
1083611508 11:64006652-64006674 GCTCCTGCTCTGTCCCCAGCAGG - Intronic
1083630914 11:64094896-64094918 TCTGGGCCTGTGTCCCAAGAGGG + Intronic
1084145798 11:67264757-67264779 GCTGCTTCTGGGTGCCAAGCAGG + Intergenic
1084268574 11:68017326-68017348 GCTACAGCTGAGCCCCAAGAGGG - Intronic
1087379635 11:97387952-97387974 GCTACTGCTGAGTTCCAACATGG - Intergenic
1089138068 11:116265290-116265312 TCTCCTGCTAGGTCCCAAGAGGG + Intergenic
1089301021 11:117498544-117498566 GCTGCTTCTGTTTGACAAGAAGG + Intronic
1089517537 11:119043051-119043073 GCGGCTGCAGTGGGCCAAGATGG + Intergenic
1090988689 11:131796372-131796394 GCTGCTGCTGGTTCCTATGACGG + Intronic
1091078434 11:132643057-132643079 GCTCCTGCTGTGCCCCACGTGGG + Intronic
1096057709 12:48668632-48668654 GATGCTGCGGTGAGCCAAGACGG + Intronic
1096563266 12:52452037-52452059 GCTGCTGCTGTGGCTCCTGATGG + Exonic
1096565418 12:52473696-52473718 GCTGCTGCTGTGGCTCCTGATGG + Exonic
1096567438 12:52493147-52493169 GCTGCTGCTGTGGCTCCTGATGG + Exonic
1097170042 12:57107611-57107633 GGTGCTGATGTGTTGCAAGATGG + Exonic
1098070911 12:66673766-66673788 GCTGCAGCTGGGTCCCAGGCAGG - Intronic
1098678388 12:73319586-73319608 CCTCCTGCTGTTTTCCAAGAAGG + Intergenic
1101560823 12:105856107-105856129 GCTGCTGTTGTGTACAAATAGGG - Intergenic
1102546393 12:113659832-113659854 GCTTCTGCACTGTCCCAATACGG + Intergenic
1104109922 12:125695314-125695336 GCTGGAGCTATGTCCCCAGAAGG - Intergenic
1104807778 12:131600544-131600566 GCTCCTGCTGTGTGCCAGGAAGG + Intergenic
1105568522 13:21576537-21576559 ACTGCAGCTGTTCCCCAAGAAGG - Intronic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1106331206 13:28741307-28741329 GCTGCTTCTGTCTTCCAGGATGG + Intergenic
1106888979 13:34222432-34222454 GGTCCTGGTGGGTCCCAAGAAGG - Intergenic
1108267957 13:48731078-48731100 GCTGCTGCTGAGGCCCAGGGAGG + Intergenic
1110079484 13:71292443-71292465 TCTGGTGGTGTGTCCCAGGAAGG + Intergenic
1111920795 13:94409406-94409428 AGGGCTGCTGTGTCCCACGAGGG - Intergenic
1114252279 14:20971550-20971572 GCGGCTGCGGTGTCCCAAGCCGG - Intergenic
1117068421 14:52033657-52033679 GATACTGCTGTGTACCAAGAGGG + Intronic
1117211569 14:53506335-53506357 GCCACTGCTGTGTCCTAAGCAGG + Intergenic
1118106002 14:62660260-62660282 GCCTCAGCTGTGGCCCAAGAAGG + Intergenic
1120744319 14:88140174-88140196 GCTGCTCCTGTATCCCCTGATGG - Intergenic
1121620139 14:95340814-95340836 CCTGCTGCTGTTTACCAAGGTGG - Intergenic
1122312401 14:100805472-100805494 GCTGCGGCTGTGTACGAAAAAGG + Intergenic
1122408415 14:101513737-101513759 GCTGCTGCTGTCTCCCTAGAGGG + Intergenic
1122420790 14:101575805-101575827 GCTGCTGCAGTTCCCCAAGCAGG - Intergenic
1123424923 15:20163477-20163499 GATGCTGCTGTGTCCCACCACGG - Intergenic
1123430253 15:20208843-20208865 GAGGCTGCTGTGAGCCAAGATGG + Intergenic
1123534147 15:21170010-21170032 GATGCTGCTGTGTCCCACCACGG - Intergenic
1125892982 15:43279760-43279782 GCTGCTGCTGCGTATCCAGAGGG - Exonic
1125990072 15:44097711-44097733 ACTGCTACTGTGTGCCCAGATGG + Intronic
1126312856 15:47336880-47336902 GCTGCTACTTTGTCCAAAGTAGG + Intronic
1129878829 15:78994111-78994133 TCTGCTCCTGTTTCCCAACAGGG - Intronic
1130792405 15:87169550-87169572 GCACCTGCTGTGTCCTAAGCAGG + Intergenic
1132398745 15:101491815-101491837 GCAGCTGGTGCCTCCCAAGACGG + Intronic
1132763600 16:1523517-1523539 GCTGCTGCTGGCTGCCAGGAAGG - Exonic
1133024708 16:2983452-2983474 GATGCTGCAGTGTGCCGAGATGG + Intergenic
1134514262 16:14874034-14874056 GCTGCTACAGTGACCCCAGAGGG - Intronic
1134514281 16:14874110-14874132 GCTGCTGCAGTGACCCCAGAGGG - Intronic
1134701902 16:16272532-16272554 GCTGCTACAGTGACCCCAGAGGG - Intronic
1134701958 16:16272758-16272780 GCTGCTGCAGTGATCCCAGAGGG - Intronic
1134841286 16:17404026-17404048 GTTGCTGCGGTTTCCCAGGAGGG - Intronic
1134969873 16:18521892-18521914 GCTGCTGCAGTGATCCCAGAGGG + Intronic
1134969929 16:18522118-18522140 GCTGCTACAGTGACCCCAGAGGG + Intronic
1136854384 16:33642366-33642388 GAGGCTGCTGTGAGCCAAGATGG - Intergenic
1137507925 16:49071897-49071919 GCTGAAGCTGTGTGCCAACAGGG - Intergenic
1138591467 16:58001497-58001519 GCTGCTGCTGTAGCCCACCAGGG - Exonic
1138668197 16:58590737-58590759 GGTGCTGCTTTGTCCCCACAAGG - Intronic
1140335763 16:74103618-74103640 GCTGCTGCTGGCTCTGAAGATGG + Intergenic
1140725039 16:77804273-77804295 CCTCCTGCTGTGTCCCGAGGAGG + Intronic
1141090414 16:81126438-81126460 TCTGCTGCTATGTACCAAGCAGG - Intergenic
1141130199 16:81431191-81431213 GAGGCTGCTGTGAGCCAAGATGG + Intergenic
1141404234 16:83777504-83777526 GCAGCAGCTGTGTCCTGAGAGGG - Intronic
1141627562 16:85269284-85269306 CCTTCCCCTGTGTCCCAAGATGG + Intergenic
1142190605 16:88715580-88715602 GCTGCTGCTGGCGCCCGAGAGGG - Exonic
1142719523 17:1766945-1766967 GCAGCTGCTGTGCCCGAGGAGGG - Exonic
1142726818 17:1821447-1821469 GAGGCTGCTGTGAGCCAAGACGG + Intronic
1143894468 17:10125450-10125472 GATGTTGCTGTGAGCCAAGATGG + Intronic
1144778211 17:17795420-17795442 GCTGCTGCAGTGCCCCGAGGTGG + Exonic
1144803706 17:17949702-17949724 GCTGGTGGTGTGTCCCGAAAAGG + Intronic
1144862238 17:18312389-18312411 GCCTGTGCTGTGTCCTAAGATGG + Intronic
1147459032 17:40556924-40556946 GCTCCTGCTGGGTGCTAAGAGGG - Intronic
1148205215 17:45775605-45775627 GCTGCTGCTGTGTAGCCAGTGGG + Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150788702 17:68183078-68183100 GCTGCTGGTGTGAGCCAAGGGGG - Intergenic
1151140191 17:71984206-71984228 CCTGCTGCTGGATCCCAAGGGGG - Intergenic
1152700596 17:81816755-81816777 GAGGCTGCTGTGAGCCAAGATGG + Intergenic
1152862720 17:82705220-82705242 GCAGCTGCAGAGTCCAAAGACGG + Intergenic
1153282333 18:3425980-3426002 GATGCTGCTGTGACCAAATATGG - Intronic
1155927014 18:31667470-31667492 GCTGCTCCAGTTTCTCAAGATGG + Intronic
1157929812 18:51809286-51809308 GCTGCTGCTGAGTCACAATAAGG - Intergenic
1158421849 18:57301904-57301926 GTGGCTGCTGTGTCCCCAGAGGG + Intergenic
1159700778 18:71623927-71623949 CCAGCTGCTGTGTCCCAAGCAGG - Intergenic
1159918568 18:74206999-74207021 GCTGCTGCTATCTCCCTGGAAGG - Intergenic
1160016114 18:75141880-75141902 GCCGCAGCTGTGTCCCGCGATGG - Intergenic
1160859029 19:1229929-1229951 GCTGCTGCTGTGGTCCGAGGCGG + Exonic
1160952094 19:1672447-1672469 GCTGCAGCTCTGTCCCTGGAAGG - Intergenic
1161379611 19:3958152-3958174 GATGCTGCTGTGTCCCACGTGGG - Intergenic
1162992836 19:14314567-14314589 GCTGCTGCTGTGGCCTGAGCAGG + Intergenic
1163815103 19:19460355-19460377 GCTGCAGCTGTGTGCCTACAGGG + Intronic
1164596784 19:29535491-29535513 GCTGCTGCTGGGTGCCCACACGG + Intronic
1165058091 19:33191605-33191627 GTTTCTTCTGTGTCCCACGAGGG + Intronic
1165236542 19:34426622-34426644 GCTCCTGCAGTATCCCAGGAAGG + Intergenic
1165805801 19:38580016-38580038 GTTGTTGTAGTGTCCCAAGAGGG - Exonic
1166051350 19:40262496-40262518 GCTGCAGCTGTGTCAGAAGTGGG + Intronic
1167115240 19:47485424-47485446 TGTGCTGCTTTGTCCCTAGAAGG + Intergenic
925011719 2:490474-490496 GCTGCAGCTGTCTCCCAAGGAGG - Intergenic
925075871 2:1015016-1015038 GCTGCATCTCTGTCCTAAGAAGG + Intronic
925874167 2:8297862-8297884 AATGCTGCTGTGTCCCAAATAGG - Intergenic
926225141 2:10961760-10961782 GCTCCTGCTGTGTTCGAAGTGGG - Intergenic
926994548 2:18720371-18720393 ACTGGTGCTGTGTCCCATGTGGG + Intergenic
928905028 2:36358396-36358418 GAAACTGCTGTGTTCCAAGAAGG + Intronic
929113583 2:38425597-38425619 GCTACTGTAGTGGCCCAAGAGGG - Intergenic
930703248 2:54480706-54480728 GCTGCTGCTGGTTCCCACAAAGG + Intronic
930707766 2:54521281-54521303 GCTGCTGTTGAGTGCCTAGAAGG + Intronic
931340108 2:61392557-61392579 GATGCTGCAGTGAGCCAAGATGG + Intronic
932288785 2:70557763-70557785 TCTGCTGCTGTCACCCAGGAAGG - Intergenic
933977771 2:87525640-87525662 GCTGCTCCTGAGTCCCTAGTTGG - Intergenic
935223185 2:101032340-101032362 GCTGCTGCTGTACACCAAGGAGG - Exonic
936075883 2:109401626-109401648 GCTGCTGCTGTGTCCCAAGAGGG + Intronic
936316059 2:111425167-111425189 GCTGCTCCTGAGTCCCCAGTTGG + Intergenic
937234801 2:120424331-120424353 GTAGCTGCTGGGTTCCAAGAAGG - Intergenic
938402538 2:131005248-131005270 GCTGCTGCTGTGTCCCTCACAGG - Intronic
938727327 2:134120267-134120289 GCTGCTGCTGCTGCCCAACAAGG + Exonic
942447263 2:176086204-176086226 GCTGCTCCTGTGACCCAGGAAGG + Intergenic
942738139 2:179139989-179140011 GCTCCTTCTGTGTCGCAGGAAGG - Intronic
946106411 2:217373918-217373940 GCTTCTGCTGTGTGCCAGGATGG - Intronic
947376487 2:229501963-229501985 GCTGCTGCTTTGGTCAAAGAAGG + Intronic
947733742 2:232444476-232444498 GCTGCTACTCTGGCCCAGGAAGG - Intergenic
947875136 2:233462708-233462730 GCTGCTGCTGTCTGGGAAGATGG + Exonic
947905463 2:233758295-233758317 GCTTCTGCTGTGTACCTGGATGG - Intronic
948880979 2:240856971-240856993 GCAGCAGCTGGGTCCCAAAAAGG - Intergenic
948992701 2:241562847-241562869 CATGGTGCTGTGTCCCAAGGAGG + Intronic
1169200554 20:3707142-3707164 GCTGCTCCTGTTGCCTAAGAGGG + Intergenic
1169234800 20:3922418-3922440 GCTGCTTCTGTGTCTCAGGAGGG + Intronic
1169726254 20:8736174-8736196 GCTTCTGCTGTATACCAGGAAGG - Intronic
1170075757 20:12417042-12417064 GCTGTTGCTGTCTCAGAAGATGG - Intergenic
1170488812 20:16849433-16849455 GAGGCTGCTGTGAGCCAAGATGG - Intergenic
1170593108 20:17786253-17786275 GCAGCTGCTCTGTCACGAGAGGG - Intergenic
1171399097 20:24860122-24860144 GCTGTTGCTGTGGCCCAGGCAGG - Intergenic
1171406763 20:24916997-24917019 GCTGCCCCTGTGTACCAAAAAGG + Intergenic
1172426571 20:34859992-34860014 GCAGCAGCTGTGGCCCAAGATGG - Exonic
1173322479 20:42000978-42001000 TCTGCCTCTGTGTCCCATGATGG + Intergenic
1173600274 20:44290037-44290059 GCTGAGGCAGTGCCCCAAGAGGG - Intergenic
1175502537 20:59460594-59460616 GCTGCTGCTGGCACCCTAGAGGG - Intergenic
1176822023 21:13666241-13666263 GCTGCTTCCCTGCCCCAAGAAGG - Intergenic
1179732387 21:43375022-43375044 GGTGCTTGTGTGTCCCATGAGGG - Intergenic
1180082513 21:45493325-45493347 GCTGCTGCTGTGACACGTGAGGG + Intronic
1181173538 22:21023410-21023432 GTTGCTGGTGGGTCCCAAGTTGG + Exonic
1181531461 22:23519839-23519861 GGAGCTGGTGTGACCCAAGATGG - Intergenic
1182117452 22:27765329-27765351 GTTTCTGCTGTAGCCCAAGAGGG - Intronic
1182351429 22:29702245-29702267 GCTGCTGAGGTGTCCCAGGCAGG + Intergenic
1182446828 22:30394612-30394634 GAGGCTGCAGTGACCCAAGATGG - Intronic
1183180009 22:36253613-36253635 GCTGCTGCTGAGGCCCAATGGGG + Intronic
1183457225 22:37929480-37929502 GCTTCTGTTGTGTGCCATGAGGG + Intronic
1183761470 22:39823407-39823429 GAGGCTGCTGTGAGCCAAGATGG - Intronic
1184019374 22:41810237-41810259 GCTGCTGATGTGCTCCCAGATGG + Exonic
1184370115 22:44076764-44076786 CATGCTGCTGTGTCCCATGGAGG + Intronic
1184491380 22:44811173-44811195 TCTGCTGCTTTCTCCCAAGCGGG - Intronic
1184652586 22:45925914-45925936 GCTCCTGCTGTGGCCCAGGATGG + Intronic
1185318961 22:50191446-50191468 GCTGTGGCTGTGTGCCAACAGGG + Intronic
950606755 3:14088313-14088335 GCTTCTGCTGTGGGCCATGATGG + Intergenic
952173887 3:30840371-30840393 GCCACAGCTGTCTCCCAAGATGG - Intronic
953476777 3:43211995-43212017 GCAGCTGCGGTGCTCCAAGATGG + Intergenic
953487740 3:43318043-43318065 GTTGCTGCTGTGGTCCCAGAGGG + Intronic
954234751 3:49247722-49247744 GAAGCTGCTGTGAGCCAAGATGG + Intronic
956545316 3:70394783-70394805 GCAGCTTTTGTGTCCCATGATGG - Intergenic
958454699 3:94315991-94316013 CCTGTTGCTGTGTCCTAACATGG + Intergenic
960692569 3:120362154-120362176 CCTGCTGCTGGGACCCAGGATGG - Intergenic
961667792 3:128504404-128504426 GCCCCTGCTGTGTCCCATGCAGG - Intergenic
961764236 3:129196067-129196089 GCTGCTGCTTTCTCCCCTGATGG + Intergenic
965792161 3:172401296-172401318 GCTGCTGCTGTCTCTGCAGAAGG - Exonic
968619178 4:1596046-1596068 CCTGCTGATGTGGCCCATGAGGG + Intergenic
968956909 4:3724157-3724179 GGTGCAGCTGTGCCCCAAGAAGG + Intergenic
969029864 4:4203290-4203312 GCTGCAGCTGTAGCCCAAGCTGG - Intronic
969068166 4:4507177-4507199 GCTGCTGCTGAGCATCAAGAGGG - Intronic
972277495 4:37570852-37570874 GGTTTTGCTGTCTCCCAAGATGG + Intronic
972675744 4:41257710-41257732 GCTGCTGCTGTTTCCCCTCACGG + Exonic
974767589 4:66367405-66367427 TCTGCTACTGTATCCCAAGGGGG + Intergenic
978435611 4:108681449-108681471 CCTGCAGCTGGGTTCCAAGAGGG - Intergenic
981251928 4:142613079-142613101 GCTGCTGCTTTGTACCACGAGGG + Intronic
981833478 4:149028501-149028523 ACTTCTGCTGTGTCCCTAGGTGG + Intergenic
982851800 4:160326937-160326959 TCTGTTCCTGTGTCCCAAAATGG + Intergenic
983652688 4:170049161-170049183 GCTGATGCTGAGTTCCAAGGGGG + Intergenic
985391647 4:189496805-189496827 TCTGCTGCTCTGCCACAAGAAGG + Intergenic
985821872 5:2166133-2166155 GCGGCTGCTGTGTTCCAACCTGG - Intergenic
988051799 5:26041179-26041201 GCTGCTGCACTGCCCCAAGGAGG + Intergenic
988236017 5:28545724-28545746 GCTATTGCTGTCTCTCAAGAAGG + Intergenic
991047487 5:62237815-62237837 GAGGCTGCTGTGAGCCAAGACGG + Intergenic
993500957 5:88666237-88666259 GATGCTTCTCTGTTCCAAGAGGG - Intergenic
993882485 5:93379471-93379493 GTTGCTGGTGTGTCCTGAGAAGG - Intergenic
994450039 5:99929895-99929917 GCTGCAGCTGCATCCCCAGAGGG + Intergenic
994719953 5:103369134-103369156 TCTGCTGTTGTGCCCCAAGGAGG + Intergenic
995803949 5:116030222-116030244 GCTGCTACTGTCTCTCAGGAGGG - Intronic
997443766 5:133926717-133926739 GATGCTCCTGTGGCCCAGGAAGG + Intergenic
997472080 5:134122751-134122773 CCTGCTGCTGTGTACAAACAAGG + Intronic
997900603 5:137760459-137760481 GCTGCTGCTGTGACAGTAGACGG + Intergenic
997974254 5:138430162-138430184 GCTGCAGCAATGTCCTAAGATGG - Intronic
1001456268 5:171862690-171862712 GCTGCTGCTGTGGCCCCAGCAGG - Exonic
1001545313 5:172567448-172567470 GCTGCAGCTGCGTCCCTATAGGG + Intergenic
1002204911 5:177555745-177555767 TGTGCTGATCTGTCCCAAGAAGG - Intergenic
1003115959 6:3284104-3284126 GGTGCTGCTTGGTCCCCAGAGGG - Intronic
1003855442 6:10268955-10268977 GCTGCTGCTCTTTCCCAAGCAGG + Intergenic
1004705706 6:18122192-18122214 ACTGGCGCTTTGTCCCAAGACGG - Exonic
1005290622 6:24375279-24375301 GATGCGGCTGTGTCCCGAGAGGG + Intergenic
1007710217 6:43818138-43818160 GCTGCTACTATGATCCAAGAAGG + Intergenic
1008535268 6:52502592-52502614 GTGGCTGCTGTGCCTCAAGATGG + Exonic
1012418178 6:99032613-99032635 GCAGCTGCTGAGTGGCAAGAAGG - Intergenic
1012964406 6:105657699-105657721 GCTCCTGCTGTGGCTCAAGCAGG + Intergenic
1015029724 6:128580400-128580422 GCTGCGGCTGTACGCCAAGAAGG - Intergenic
1016813537 6:148283123-148283145 GCTGCCGATGTCTCCCAAGAAGG - Intronic
1017151424 6:151283918-151283940 GCTGCTGCTGTGTCCATTCAGGG - Intronic
1017663389 6:156695629-156695651 CCAGTTGCTGTCTCCCAAGAGGG - Intergenic
1017985330 6:159438571-159438593 GCTGGTTCTGTCTCCCAAGGGGG - Intergenic
1018830117 6:167435584-167435606 GCTGCTGCTGTGCTCGGAGAGGG + Intergenic
1019294872 7:268697-268719 CCTGCTGGCGTGTCCCAGGACGG - Intergenic
1019850609 7:3552771-3552793 GCTGCTGCTTTGTTCTGAGAAGG - Intronic
1020089861 7:5332966-5332988 GGGGCTGCTGCGGCCCAAGAAGG - Exonic
1021837691 7:24696489-24696511 GCTGCTGCTGGCTCTGAAGATGG - Intergenic
1023363657 7:39441502-39441524 AATGCTGATGTTTCCCAAGAGGG - Intronic
1024417271 7:49121337-49121359 GCTGCAGCTGGGTACCAAGCAGG - Intergenic
1027960503 7:84940007-84940029 GCCGCTGCTGTGTCCCTTGGTGG - Intergenic
1031235377 7:119168892-119168914 GCTGCTGCAGTGTGCAAAGTAGG + Intergenic
1032232706 7:130089344-130089366 CCTGCTTCTGTCTCCCAATAGGG - Intronic
1032326809 7:130936524-130936546 GCTGCTGTTGTGGTCCAGGAGGG - Intergenic
1033055324 7:138047207-138047229 GCTTCTCCAGTGACCCAAGAAGG + Intronic
1033398773 7:141001125-141001147 GATGTTGCTGTGAGCCAAGATGG + Intergenic
1038782813 8:30582750-30582772 CTTGCTACTGTGCCCCAAGAAGG - Intronic
1042595184 8:70439751-70439773 TCTGCTGCTCTGTGCCAAGGTGG + Intergenic
1043662215 8:82758151-82758173 GGTGATGCTGTATCCCAAGGTGG - Intergenic
1045260671 8:100570742-100570764 GCTGCTGCTTTGATCAAAGAAGG - Intergenic
1045470329 8:102506719-102506741 CTTGTTGCTGTGTCCCAACATGG + Intergenic
1046326663 8:112657125-112657147 GACGCTGCAGTGACCCAAGATGG - Intronic
1046887972 8:119389601-119389623 GCTGCTGCTCTATGCCAACAAGG - Intergenic
1047514262 8:125539794-125539816 GATGTTCCTGTGTCCCAGGAAGG - Intergenic
1048315451 8:133358542-133358564 GCTGCTGCTGTGCCCTATAAGGG - Intergenic
1048556891 8:135487299-135487321 GGTGCTGCTGGTTCCCAGGAGGG + Intronic
1048968306 8:139629732-139629754 CTTCCTGCTGTGTCCCCAGATGG + Intronic
1049081849 8:140449386-140449408 GCAGCAGCTGTTTGCCAAGAGGG - Intronic
1049253946 8:141604121-141604143 GCCTCTGCTGGGCCCCAAGAGGG + Intergenic
1049375698 8:142288068-142288090 GATGCTGCTGTGTCCCTGGGGGG + Intronic
1049592466 8:143468845-143468867 TCAGGTGCTGTGTCCCCAGAGGG - Intronic
1049681273 8:143919527-143919549 GCAGCTGCTGTCTGCCGAGAAGG - Exonic
1050134877 9:2452120-2452142 GATGCTCCTGTGCCCCATGAAGG + Intergenic
1050833278 9:10042069-10042091 TCTGCTGCTGTGTTCCCACAGGG - Intronic
1052122072 9:24730510-24730532 GCTCCTGCTGGGGCCCAAAACGG - Intergenic
1055599199 9:77897751-77897773 GCAGCTGCTAAGTGCCAAGATGG + Intronic
1055769711 9:79704176-79704198 GATGCTGCAGTGAGCCAAGATGG - Intronic
1056756726 9:89386366-89386388 CCTGCTGCTGTCTTCAAAGAAGG - Exonic
1056837720 9:89970858-89970880 GCGGGAGCTGTGTCCCATGAAGG + Intergenic
1058128883 9:101227043-101227065 GCTGCTTCTGTGTCACAATTAGG - Intronic
1058481734 9:105402802-105402824 GCTGCTTTTGTTTTCCAAGAAGG + Intronic
1059218207 9:112587000-112587022 ACTCCTGCTGAGACCCAAGATGG - Intronic
1060486692 9:124052230-124052252 GGTTCTGCTTTGTCCCAAGCTGG + Intergenic
1062004785 9:134233722-134233744 GCGGCGGCTGTGACCCAAGCAGG + Intergenic
1062355221 9:136158670-136158692 TCTGCTGCTGTGTCCCTGCAGGG + Intergenic
1186978661 X:14935733-14935755 TCTGCTGCTGTATAGCAAGAGGG + Intergenic
1187311521 X:18148906-18148928 TCTGGTGCTGTGTCCCATGCTGG + Intergenic
1190299624 X:49049392-49049414 GCTGCTGCTGTGACAGAAGCTGG + Intergenic
1191781128 X:64866909-64866931 ACTGCTGCTATGTTCCAAGCTGG - Intergenic
1191802127 X:65093062-65093084 GCTCCAGCTGTGTCTCAAAAGGG + Intergenic
1192179664 X:68908610-68908632 GCTACTCCTGGGTTCCAAGAAGG - Intergenic
1193010684 X:76671560-76671582 GCAGGTGCTGTGTCCCAGGGAGG - Intergenic
1194070625 X:89321480-89321502 GATTGTGCTGTGGCCCAAGAGGG - Intergenic
1197770339 X:130085401-130085423 GCTGCTCCTGTGTCACAACTCGG + Intronic
1197809305 X:130427382-130427404 GCTGCCTCTGTGTTCCAAGAGGG - Intergenic
1198566640 X:137912043-137912065 GCTGTTGCTGTGGTCCAGGAGGG - Intergenic
1198924201 X:141769611-141769633 CCTTCTGCTGTGACACAAGAGGG - Intergenic
1199682952 X:150240087-150240109 GCTGCTGCCCTGACCCAGGAGGG - Intergenic
1200724867 Y:6657222-6657244 GATTGTGCTGTGGCCCAAGAGGG - Intergenic
1200949279 Y:8878462-8878484 CCTTCTGCTGTGACACAAGAGGG - Intergenic