ID: 936077064

View in Genome Browser
Species Human (GRCh38)
Location 2:109408328-109408350
Sequence CTCCCGTCCAGGGCCATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936077064 Original CRISPR CTCCCGTCCAGGGCCATCAT GGG (reversed) Intronic
900528695 1:3142133-3142155 CCCCCGTCCAGGGCCATTTCCGG + Intronic
900587768 1:3441474-3441496 CTCCAGGCAAGGGCCATTATGGG - Intergenic
901196938 1:7445519-7445541 CCCCCGTCCAGGGTCACCTTGGG - Intronic
903171492 1:21557244-21557266 CTCCCGCTTAGGGTCATCATGGG + Intronic
903353795 1:22734085-22734107 CTCCCACCCAGGGCCAGCCTGGG + Intronic
924567544 1:245211079-245211101 CTCCCGTTCAGGCCCATCGCTGG - Intronic
1070653391 10:78254093-78254115 TTCCCATCTAGGGCCAGCATGGG - Intergenic
1074500796 10:114022444-114022466 CTCCCGTCCAGGCCACTCAGCGG + Intergenic
1075396086 10:122128210-122128232 TTCCAGTCCAGGCCCACCATGGG - Intronic
1076597920 10:131637406-131637428 ATCCCCTCCAGGGCCAGCTTGGG + Intergenic
1077530682 11:3093412-3093434 CTCCCTGCCAGGGACATCCTGGG + Intronic
1077601989 11:3580711-3580733 CTCCCGGCCAGGGACGTCGTGGG + Intergenic
1083656819 11:64234062-64234084 CTCTCCTCCAGGGCCAACAGAGG + Exonic
1083667599 11:64284418-64284440 CTGCCTTCCAGGGCCACCGTTGG - Exonic
1090985576 11:131762859-131762881 CTCCTGTCCAGAGCCAGCAGGGG - Intronic
1091767021 12:3128021-3128043 CTACCGCCCAGTGACATCATAGG - Intronic
1092428131 12:8390054-8390076 CTCCCGGCCAGGGACGTCGTGGG + Intergenic
1095221337 12:39619846-39619868 CTCCCTCCCAGGCCCCTCATTGG + Intergenic
1104575659 12:129963764-129963786 CTCCCCTGCAGGGCCTCCATGGG - Intergenic
1113694231 13:112332666-112332688 CTCCGGTCGAGGGCCGTGATTGG + Intergenic
1114614478 14:24060964-24060986 CTGCCGCACAGGCCCATCATTGG - Exonic
1120963630 14:90148393-90148415 CTCCCCTTCTGGGCCATGATGGG - Intronic
1121419897 14:93805900-93805922 CTCCCGTCCTGTTCCATCCTGGG + Intergenic
1122893530 14:104744036-104744058 CTCCCTTCCTGGTCCATCTTCGG - Intronic
1127258026 15:57307587-57307609 GTCCCGTCCAGGGCCACACTGGG - Intergenic
1128812204 15:70580863-70580885 CTGCCGGCAGGGGCCATCATTGG - Intergenic
1128864396 15:71103295-71103317 CCCCAGTCCAGGCCCATGATTGG - Intronic
1129624112 15:77179008-77179030 CTCCAGTTCAGCGCCATCACTGG - Exonic
1129718700 15:77866221-77866243 CTCCCTTCCAGGGCCCTGAGTGG - Intergenic
1132175766 15:99712638-99712660 CTCCCGATCACTGCCATCATAGG - Exonic
1132736492 16:1388510-1388532 CTCCCGGGCAGGGTCAGCATGGG - Intronic
1132943094 16:2518177-2518199 CTGCCCTCCAGGGCCACCACAGG - Intronic
1142699005 17:1648542-1648564 CCCCGCCCCAGGGCCATCATGGG + Intronic
1144702425 17:17348213-17348235 TTCCCTTCAAGGGCCATGATGGG - Intergenic
1149658810 17:58324108-58324130 CTCCCTTCCAGGGCCAGCCAGGG + Intronic
1151535593 17:74737258-74737280 CTCTCGTCCAGGGACATGACGGG + Intronic
1152332384 17:79680700-79680722 CTCCCCTGCAGGGCCATCTGGGG + Intergenic
1167011727 19:46813193-46813215 CTCCCCTCCAGGCCCCTCCTGGG - Intergenic
1168544654 19:57240539-57240561 CCCCTGTCCTGGACCATCATTGG - Intergenic
929934785 2:46286612-46286634 CTCCCCTCCAGAGCCATTCTCGG + Intergenic
932749615 2:74363097-74363119 CTCACTGCCAGGGCCCTCATGGG + Exonic
936077064 2:109408328-109408350 CTCCCGTCCAGGGCCATCATGGG - Intronic
937303041 2:120854937-120854959 GGCCTGTCCAGGGCCAGCATGGG + Intronic
939096041 2:137834569-137834591 CTGCCGTCCAGGTGCAGCATGGG - Intergenic
1171152735 20:22842160-22842182 CTCCTTTCCAGAGCCATCAGGGG - Intergenic
1174854278 20:54028392-54028414 CTTCCCTGCAGGGACATCATCGG + Exonic
1175161342 20:57010005-57010027 CTCCCGTCCTGGGGCATCAGGGG - Intergenic
1178488009 21:33030975-33030997 CACCAGTCCAGGGCCACCCTCGG - Intergenic
1179887576 21:44320931-44320953 CTCCCTTCCATGGACATCTTTGG + Intronic
1183459573 22:37941707-37941729 CTCCCGCCCATGGTCATCACTGG + Exonic
1184247788 22:43244499-43244521 CTCCCTTCCAGGCCCAACAGAGG - Intronic
957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG + Intergenic
960011127 3:112835458-112835480 CTCCCCTCTGGGGCCATAATGGG - Intronic
961281244 3:125767012-125767034 CTCCCGGCCAGGGACGTCGTGGG - Intergenic
961873131 3:130002573-130002595 CTCCCGGCCAGGGACGTCGTGGG + Intergenic
964446777 3:156767569-156767591 CTCCCTTCCAGGGCCACAAGGGG + Intergenic
965941617 3:174189894-174189916 CTGCCCTCCAGGGCCATTTTTGG + Intronic
966946045 3:184777710-184777732 CTCTCCTCCAGGGTCATCTTGGG + Intergenic
969296310 4:6272191-6272213 GTCTTGTCCAGGGCCAGCATTGG - Intronic
972474038 4:39433937-39433959 CTCCCTTCCTGGGCCCTCTTGGG - Intronic
984561980 4:181281581-181281603 CTCCCGTCCAGAACTACCATGGG + Intergenic
990987311 5:61652644-61652666 CTCACTCCCAGGGCCATCATGGG + Intronic
998538570 5:142957434-142957456 CTTCCCTCCAAGACCATCATTGG + Intronic
1005946909 6:30602087-30602109 CCCGTGTCCAGGGCCTTCATGGG + Exonic
1007424838 6:41740228-41740250 CTGCAGTCCAGCCCCATCATGGG - Intronic
1010934892 6:81849530-81849552 CTCCCTTCCAGGACCATGAAGGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1020633029 7:10663147-10663169 GTCCTGCCAAGGGCCATCATGGG + Intergenic
1028464044 7:91129131-91129153 TTCACGCCCAGGGCCTTCATGGG + Intronic
1032401691 7:131628730-131628752 CTCCAGTTCAGGGCCTTCTTGGG + Intergenic
1035244392 7:157552809-157552831 TTCCCGGCCAGGCCCAGCATAGG - Intronic
1038516991 8:28195721-28195743 CTCCCTCCGAGGACCATCATGGG - Intergenic
1052833610 9:33234483-33234505 CTCCTCTCCAGGGCCCTCACAGG + Intronic
1055480619 9:76705818-76705840 CTCCCGTCCAGGCTCATAAATGG + Exonic
1056578847 9:87876014-87876036 CTCCCGTCCAGGTCCTGCCTGGG - Intergenic
1186266914 X:7843047-7843069 TTCCCGCCCAGGGCGACCATTGG + Exonic
1186298189 X:8170778-8170800 TTCCCGCCCAGGGCTACCATTGG - Exonic
1186324607 X:8465294-8465316 TTCCCGCCCAGGGCTACCATTGG + Exonic
1198488265 X:137110231-137110253 TTCCAGACCTGGGCCATCATCGG + Intergenic
1199688911 X:150291253-150291275 CTCCTGGCCAGGGGCATCCTGGG - Intergenic
1202379028 Y:24260530-24260552 CTCCCTTCCAGGGCCCTGAGTGG - Intergenic
1202491754 Y:25409591-25409613 CTCCCTTCCAGGGCCCTGAGTGG + Intergenic